ID: 914590688

View in Genome Browser
Species Human (GRCh38)
Location 1:149103560-149103582
Sequence GCCCCGCTGCGCCTGCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 4, 1: 2, 2: 3, 3: 25, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914590688_914590694 13 Left 914590688 1:149103560-149103582 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914590694 1:149103596-149103618 GGCCGCCTCTGCGGCACAGCGGG 0: 2
1: 3
2: 0
3: 12
4: 149
914590688_914590692 4 Left 914590688 1:149103560-149103582 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914590692 1:149103587-149103609 AAGGTACATGGCCGCCTCTGCGG 0: 2
1: 0
2: 0
3: 8
4: 92
914590688_914590693 12 Left 914590688 1:149103560-149103582 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914590693 1:149103595-149103617 TGGCCGCCTCTGCGGCACAGCGG 0: 2
1: 3
2: 0
3: 7
4: 123
914590688_914590699 28 Left 914590688 1:149103560-149103582 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914590699 1:149103611-149103633 ACAGCGGGTTCGCGCGGGCCAGG 0: 4
1: 0
2: 0
3: 7
4: 54
914590688_914590697 22 Left 914590688 1:149103560-149103582 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914590697 1:149103605-149103627 TGCGGCACAGCGGGTTCGCGCGG 0: 2
1: 3
2: 0
3: 1
4: 32
914590688_914590698 23 Left 914590688 1:149103560-149103582 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914590698 1:149103606-149103628 GCGGCACAGCGGGTTCGCGCGGG 0: 2
1: 3
2: 0
3: 4
4: 39
914590688_914590690 -8 Left 914590688 1:149103560-149103582 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914590690 1:149103575-149103597 AGCGGGGCCTTAAAGGTACATGG 0: 3
1: 2
2: 0
3: 9
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914590688 Original CRISPR GCCCCGCTGCGCCTGCGCCT TGG (reversed) Intronic