ID: 914593155

View in Genome Browser
Species Human (GRCh38)
Location 1:149124107-149124129
Sequence TGTTGCCATAGCAATTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914593144_914593155 17 Left 914593144 1:149124067-149124089 CCAAGTTCTCACGGAGTGGCCCC No data
Right 914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG No data
914593142_914593155 21 Left 914593142 1:149124063-149124085 CCAGCCAAGTTCTCACGGAGTGG No data
Right 914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG No data
914593146_914593155 -2 Left 914593146 1:149124086-149124108 CCCCTCCCTCAGCGGCTCCACTG No data
Right 914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG No data
914593147_914593155 -3 Left 914593147 1:149124087-149124109 CCCTCCCTCAGCGGCTCCACTGT No data
Right 914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG No data
914593149_914593155 -7 Left 914593149 1:149124091-149124113 CCCTCAGCGGCTCCACTGTTGCC No data
Right 914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG No data
914593150_914593155 -8 Left 914593150 1:149124092-149124114 CCTCAGCGGCTCCACTGTTGCCA No data
Right 914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG No data
914593148_914593155 -4 Left 914593148 1:149124088-149124110 CCTCCCTCAGCGGCTCCACTGTT No data
Right 914593155 1:149124107-149124129 TGTTGCCATAGCAATTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914593155 Original CRISPR TGTTGCCATAGCAATTGGGT GGG Intergenic
No off target data available for this crispr