ID: 914593994

View in Genome Browser
Species Human (GRCh38)
Location 1:149131649-149131671
Sequence TAACTTCCCTGTAGTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914593994_914593997 18 Left 914593994 1:149131649-149131671 CCCTCAGGACTACAGGGAAGTTA No data
Right 914593997 1:149131690-149131712 TTCCATGTTTTTGTTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914593994 Original CRISPR TAACTTCCCTGTAGTCCTGA GGG (reversed) Intergenic