ID: 914593997

View in Genome Browser
Species Human (GRCh38)
Location 1:149131690-149131712
Sequence TTCCATGTTTTTGTTTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914593994_914593997 18 Left 914593994 1:149131649-149131671 CCCTCAGGACTACAGGGAAGTTA No data
Right 914593997 1:149131690-149131712 TTCCATGTTTTTGTTTCCATAGG No data
914593993_914593997 21 Left 914593993 1:149131646-149131668 CCACCCTCAGGACTACAGGGAAG No data
Right 914593997 1:149131690-149131712 TTCCATGTTTTTGTTTCCATAGG No data
914593995_914593997 17 Left 914593995 1:149131650-149131672 CCTCAGGACTACAGGGAAGTTAT No data
Right 914593997 1:149131690-149131712 TTCCATGTTTTTGTTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914593997 Original CRISPR TTCCATGTTTTTGTTTCCAT AGG Intergenic