ID: 914606253 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:149257007-149257029 |
| Sequence | CTTTGTGACCTAAAGATAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914606253_914606256 | -5 | Left | 914606253 | 1:149257007-149257029 | CCCACTATCTTTAGGTCACAAAG | No data | ||
| Right | 914606256 | 1:149257025-149257047 | CAAAGACATCAGGTGTTTTCAGG | No data | ||||
| 914606253_914606257 | 14 | Left | 914606253 | 1:149257007-149257029 | CCCACTATCTTTAGGTCACAAAG | No data | ||
| Right | 914606257 | 1:149257044-149257066 | CAGGCTCAATCATGAGTTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914606253 | Original CRISPR | CTTTGTGACCTAAAGATAGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||