ID: 914606253

View in Genome Browser
Species Human (GRCh38)
Location 1:149257007-149257029
Sequence CTTTGTGACCTAAAGATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914606253_914606256 -5 Left 914606253 1:149257007-149257029 CCCACTATCTTTAGGTCACAAAG No data
Right 914606256 1:149257025-149257047 CAAAGACATCAGGTGTTTTCAGG No data
914606253_914606257 14 Left 914606253 1:149257007-149257029 CCCACTATCTTTAGGTCACAAAG No data
Right 914606257 1:149257044-149257066 CAGGCTCAATCATGAGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914606253 Original CRISPR CTTTGTGACCTAAAGATAGT GGG (reversed) Intergenic
No off target data available for this crispr