ID: 914615823

View in Genome Browser
Species Human (GRCh38)
Location 1:149354038-149354060
Sequence GGCCATCAAAGTACTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914615823_914615825 -10 Left 914615823 1:149354038-149354060 CCTACCTCAGTACTTTGATGGCC No data
Right 914615825 1:149354051-149354073 TTTGATGGCCATGAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914615823 Original CRISPR GGCCATCAAAGTACTGAGGT AGG (reversed) Intergenic
No off target data available for this crispr