ID: 914620035

View in Genome Browser
Species Human (GRCh38)
Location 1:149397116-149397138
Sequence CTCAGGTAACATTCTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914620035_914620038 -6 Left 914620035 1:149397116-149397138 CCTCCATTAGAATGTTACCTGAG No data
Right 914620038 1:149397133-149397155 CCTGAGATGTTAGAATGCATAGG No data
914620035_914620039 13 Left 914620035 1:149397116-149397138 CCTCCATTAGAATGTTACCTGAG No data
Right 914620039 1:149397152-149397174 TAGGAGTTCCACAGCCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914620035 Original CRISPR CTCAGGTAACATTCTAATGG AGG (reversed) Intergenic
No off target data available for this crispr