ID: 914621462

View in Genome Browser
Species Human (GRCh38)
Location 1:149413460-149413482
Sequence CTGCTGTGCTTGAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914621460_914621462 15 Left 914621460 1:149413422-149413444 CCAAAGTCTGCAGATAAAGATGT No data
Right 914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG No data
914621459_914621462 16 Left 914621459 1:149413421-149413443 CCCAAAGTCTGCAGATAAAGATG No data
Right 914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG No data
914621458_914621462 17 Left 914621458 1:149413420-149413442 CCCCAAAGTCTGCAGATAAAGAT No data
Right 914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG No data
914621456_914621462 26 Left 914621456 1:149413411-149413433 CCTTGGATCCCCCAAAGTCTGCA No data
Right 914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG No data
914621457_914621462 18 Left 914621457 1:149413419-149413441 CCCCCAAAGTCTGCAGATAAAGA No data
Right 914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914621462 Original CRISPR CTGCTGTGCTTGAAGGAAAG AGG Intergenic
No off target data available for this crispr