ID: 914624190

View in Genome Browser
Species Human (GRCh38)
Location 1:149443323-149443345
Sequence CTATAAATACACTTGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914624190_914624194 -9 Left 914624190 1:149443323-149443345 CCAAACTTCAAGTGTATTTATAG No data
Right 914624194 1:149443337-149443359 TATTTATAGGGTCTTTTTAAGGG No data
914624190_914624193 -10 Left 914624190 1:149443323-149443345 CCAAACTTCAAGTGTATTTATAG No data
Right 914624193 1:149443336-149443358 GTATTTATAGGGTCTTTTTAAGG No data
914624190_914624195 -8 Left 914624190 1:149443323-149443345 CCAAACTTCAAGTGTATTTATAG No data
Right 914624195 1:149443338-149443360 ATTTATAGGGTCTTTTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914624190 Original CRISPR CTATAAATACACTTGAAGTT TGG (reversed) Intergenic
No off target data available for this crispr