ID: 914624483

View in Genome Browser
Species Human (GRCh38)
Location 1:149446432-149446454
Sequence TTCAAACATACGCATGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914624483_914624488 -3 Left 914624483 1:149446432-149446454 CCAACCCCATGCGTATGTTTGAA No data
Right 914624488 1:149446452-149446474 GAACAGTAACAATGGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914624483 Original CRISPR TTCAAACATACGCATGGGGT TGG (reversed) Intergenic
No off target data available for this crispr