ID: 914637063

View in Genome Browser
Species Human (GRCh38)
Location 1:149561791-149561813
Sequence GGTAAGGGCACCGCCCGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914637063_914637068 -2 Left 914637063 1:149561791-149561813 CCTAAACGGGCGGTGCCCTTACC No data
Right 914637068 1:149561812-149561834 CCCACTGGTCCCTCCCTGCCTGG No data
914637063_914637076 24 Left 914637063 1:149561791-149561813 CCTAAACGGGCGGTGCCCTTACC No data
Right 914637076 1:149561838-149561860 CTTCGGAGCCCTAGCTCACCCGG No data
914637063_914637071 7 Left 914637063 1:149561791-149561813 CCTAAACGGGCGGTGCCCTTACC No data
Right 914637071 1:149561821-149561843 CCCTCCCTGCCTGGTGTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914637063 Original CRISPR GGTAAGGGCACCGCCCGTTT AGG (reversed) Intergenic
No off target data available for this crispr