ID: 914647736

View in Genome Browser
Species Human (GRCh38)
Location 1:149669225-149669247
Sequence TTCATTATACAGCTGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914647736_914647738 4 Left 914647736 1:149669225-149669247 CCATTGTCCAGCTGTATAATGAA No data
Right 914647738 1:149669252-149669274 GAGTTCTCAGAGAAGAATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914647736 Original CRISPR TTCATTATACAGCTGGACAA TGG (reversed) Intergenic
No off target data available for this crispr