ID: 914648507

View in Genome Browser
Species Human (GRCh38)
Location 1:149676621-149676643
Sequence GAGGAAAACCATAATTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914648507_914648515 26 Left 914648507 1:149676621-149676643 CCAACCCAATTATGGTTTTCCTC No data
Right 914648515 1:149676670-149676692 CTTGGTCTGGACCCTGCAACTGG No data
914648507_914648513 13 Left 914648507 1:149676621-149676643 CCAACCCAATTATGGTTTTCCTC No data
Right 914648513 1:149676657-149676679 CTGTGAAAGCCTTCTTGGTCTGG No data
914648507_914648512 8 Left 914648507 1:149676621-149676643 CCAACCCAATTATGGTTTTCCTC No data
Right 914648512 1:149676652-149676674 TTACGCTGTGAAAGCCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914648507 Original CRISPR GAGGAAAACCATAATTGGGT TGG (reversed) Intergenic
No off target data available for this crispr