ID: 914649630

View in Genome Browser
Species Human (GRCh38)
Location 1:149686637-149686659
Sequence TGTGGTCACCAGATGATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914649626_914649630 0 Left 914649626 1:149686614-149686636 CCTGTCCCATCTTGTCTTGTCTT No data
Right 914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG No data
914649627_914649630 -5 Left 914649627 1:149686619-149686641 CCCATCTTGTCTTGTCTTTGTGG No data
Right 914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG No data
914649629_914649630 -6 Left 914649629 1:149686620-149686642 CCATCTTGTCTTGTCTTTGTGGT No data
Right 914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG No data
914649624_914649630 22 Left 914649624 1:149686592-149686614 CCTGTCCTGTGTTATATCATGTC No data
Right 914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG No data
914649625_914649630 17 Left 914649625 1:149686597-149686619 CCTGTGTTATATCATGTCCTGTC No data
Right 914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914649630 Original CRISPR TGTGGTCACCAGATGATGCA AGG Intergenic
No off target data available for this crispr