ID: 914652103

View in Genome Browser
Species Human (GRCh38)
Location 1:149704976-149704998
Sequence CTCCCATAGCAACCAGGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 4, 1: 0, 2: 2, 3: 20, 4: 179}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914652103_914652109 3 Left 914652103 1:149704976-149704998 CCCTGGCCTGGTTGCTATGGGAG 0: 4
1: 0
2: 2
3: 20
4: 179
Right 914652109 1:149705002-149705024 CAGTGGCCTGATGGAGCCTGAGG 0: 6
1: 3
2: 2
3: 22
4: 303
914652103_914652108 -6 Left 914652103 1:149704976-149704998 CCCTGGCCTGGTTGCTATGGGAG 0: 4
1: 0
2: 2
3: 20
4: 179
Right 914652108 1:149704993-149705015 TGGGAGGCACAGTGGCCTGATGG 0: 4
1: 2
2: 6
3: 35
4: 345
914652103_914652115 22 Left 914652103 1:149704976-149704998 CCCTGGCCTGGTTGCTATGGGAG 0: 4
1: 0
2: 2
3: 20
4: 179
Right 914652115 1:149705021-149705043 GAGGCAGGTGTGGGAAGATGTGG 0: 9
1: 1
2: 8
3: 127
4: 803
914652103_914652112 12 Left 914652103 1:149704976-149704998 CCCTGGCCTGGTTGCTATGGGAG 0: 4
1: 0
2: 2
3: 20
4: 179
Right 914652112 1:149705011-149705033 GATGGAGCCTGAGGCAGGTGTGG 0: 9
1: 0
2: 2
3: 58
4: 586
914652103_914652110 7 Left 914652103 1:149704976-149704998 CCCTGGCCTGGTTGCTATGGGAG 0: 4
1: 0
2: 2
3: 20
4: 179
Right 914652110 1:149705006-149705028 GGCCTGATGGAGCCTGAGGCAGG 0: 6
1: 3
2: 2
3: 40
4: 557
914652103_914652113 13 Left 914652103 1:149704976-149704998 CCCTGGCCTGGTTGCTATGGGAG 0: 4
1: 0
2: 2
3: 20
4: 179
Right 914652113 1:149705012-149705034 ATGGAGCCTGAGGCAGGTGTGGG 0: 9
1: 0
2: 2
3: 43
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914652103 Original CRISPR CTCCCATAGCAACCAGGCCA GGG (reversed) Exonic
900497505 1:2982728-2982750 CTCCCATGGCACCCAGGCACTGG - Intergenic
900826082 1:4928070-4928092 CTCCCACAGCAGCCAGGAAAGGG + Intergenic
900990082 1:6094594-6094616 CTCCCTTAGCACCCAGGCATCGG - Intronic
902456855 1:16539539-16539561 CTCCCGCAGCAACCAGGCCAGGG - Intergenic
902474377 1:16673476-16673498 CTCCTGCAGCAACCAGGCCAGGG - Exonic
902484426 1:16733966-16733988 CTCCTGCAGCAACCAGGCCAGGG + Exonic
902495314 1:16868374-16868396 CTCCCGCAGCAACCAGGCCAGGG + Intronic
903759166 1:25685721-25685743 CTCCCACAGCAACCAGCACAGGG - Intronic
906452274 1:45960638-45960660 ATCCCAGGGGAACCAGGCCACGG + Intronic
910758585 1:90714757-90714779 CTACCATAGAAACCCAGCCACGG + Intronic
913199169 1:116482328-116482350 TGCCCATAGCAAAGAGGCCAAGG - Intergenic
913662104 1:121013182-121013204 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914013478 1:143796367-143796389 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG + Intergenic
914652103 1:149704976-149704998 CTCCCATAGCAACCAGGCCAGGG - Exonic
916520350 1:165557932-165557954 CCCCCAAAGGAGCCAGGCCATGG - Intronic
919749909 1:201031013-201031035 CGTCAACAGCAACCAGGCCAGGG - Intergenic
920669285 1:207990987-207991009 CTCGCATTGCCACCAGGCCGGGG - Intergenic
920905069 1:210156572-210156594 CTCCCAGTTCAACAAGGCCAGGG + Intronic
923453165 1:234138845-234138867 CTTCCAAAGCAACAAGGCCAGGG - Intronic
924470607 1:244339778-244339800 CTCCCAGAGGAACCAGTCTAAGG + Intergenic
1063669978 10:8092259-8092281 CTCCCAAAGCATTCAGGCCAGGG + Intergenic
1066200379 10:33138247-33138269 CTCTCATAGCAACCTAGCTAAGG - Intergenic
1067179923 10:43977437-43977459 CTCCCATAGTTCCCAGGCTAGGG - Intergenic
1067569433 10:47360602-47360624 ATCCCATAGGAACCAGGAGATGG - Intergenic
1067776103 10:49165915-49165937 ATCACATAGCAGCCAGGCCCCGG - Intronic
1067944647 10:50682337-50682359 CTCCCATCCCAGCCTGGCCAGGG + Intergenic
1069562261 10:69439199-69439221 GTCCCATAGCAACCAGCACATGG + Intergenic
1070866149 10:79709208-79709230 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1070879943 10:79847339-79847361 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1071298880 10:84241784-84241806 ATCCCATCCCAACAAGGCCACGG + Intergenic
1071423533 10:85525941-85525963 CTCCCAGACCTTCCAGGCCAGGG + Intergenic
1071633052 10:87231429-87231451 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1071646501 10:87363647-87363669 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1072437561 10:95427968-95427990 CTCCCATTGCCACCATGCTAGGG + Intronic
1074028746 10:109663713-109663735 CTCCCCTCGGCACCAGGCCAGGG + Intergenic
1076518956 10:131067873-131067895 CTCTCATGGCAAGGAGGCCAGGG - Intergenic
1077030225 11:462180-462202 TTCCCATAGGAACCAGGCCTGGG - Intronic
1077549328 11:3193111-3193133 CTCCCACAGGAACCCGGCTAAGG + Intergenic
1083678838 11:64342203-64342225 CTCCCGTAGCCACCAGGGCTAGG - Intronic
1084117360 11:67050068-67050090 CCCCCACAGCGATCAGGCCAAGG - Exonic
1084768246 11:71326137-71326159 GTCCCATAGGATCCAGGCCCAGG - Intergenic
1085053318 11:73390746-73390768 CTCCCACAGGACCCAGGGCAGGG + Exonic
1085469836 11:76750650-76750672 CTCCCACACCAACCAGACCTTGG - Intergenic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089752392 11:120660928-120660950 GTCCCACAGCAACAAGGCAAGGG - Intronic
1090252852 11:125263523-125263545 TTTCCATAGCAACCAGCCAACGG + Intronic
1091545701 12:1500206-1500228 CTCCCGCAGCAGCCAGGCCCGGG + Intergenic
1091798571 12:3310778-3310800 CTTGAATAGCAACCAGGGCAGGG - Intergenic
1094696034 12:32819758-32819780 CTCCCACAGAATCCAGACCAGGG - Intronic
1095665184 12:44788985-44789007 CCCCCACAGCAACCTGCCCAAGG + Intronic
1101078834 12:101160546-101160568 CATCCATAGCAGCCACGCCAGGG - Intronic
1102075356 12:110055671-110055693 CTCCCCTAGCAATCAGGGAATGG + Intronic
1102905417 12:116670951-116670973 CTCCCCTGGCACCCAGGCCCTGG + Intergenic
1106469115 13:30039020-30039042 CTTCCTTAGCAAGCAGTCCAAGG - Intergenic
1106680443 13:32001691-32001713 CAGCCAGAACAACCAGGCCATGG - Intergenic
1109676321 13:65679123-65679145 CCCCCATAGCAACCAGGACTGGG + Intergenic
1112006134 13:95255329-95255351 CTCCCCTTGGAGCCAGGCCATGG - Intronic
1119057596 14:71438877-71438899 TTCCCATAGTAACCAGCCCACGG - Intronic
1119318809 14:73717574-73717596 CTTCCAGAGCAACCAGGTGAGGG + Exonic
1119853274 14:77881336-77881358 CTCCCAGAGCAAGCAATCCAAGG + Intronic
1119887435 14:78154689-78154711 CTCCCAGAGCCACCATGCCATGG - Intergenic
1120431236 14:84418775-84418797 CTCCCATAGGAGCAAGGCCCTGG + Intergenic
1122075020 14:99230405-99230427 CTGCCACAGAAACCAGGCCACGG + Intronic
1123473101 15:20569203-20569225 CTCCCACAGCCACCAGAGCAGGG - Intergenic
1123644905 15:22431150-22431172 CTCCCACAGCCACCAGAGCAGGG + Intergenic
1123733402 15:23164214-23164236 CTCCCACAGCCACCAGAGCAGGG - Intergenic
1123751531 15:23361585-23361607 CTCCCACAGCCACCAGAGCAGGG - Intronic
1124283904 15:28385510-28385532 CTCCCACAGCCACCAGAGCAGGG - Intronic
1124298794 15:28526104-28526126 CTCCCACAGCCACCAGAGCAGGG + Intronic
1128270898 15:66308534-66308556 CCCCCAGAGCACCCAGCCCAGGG + Intronic
1129656436 15:77528094-77528116 CTCCCCCAGCAGACAGGCCAAGG - Intergenic
1132432908 15:101775130-101775152 CTCCCACAGCCACCAGAGCACGG + Intergenic
1132969180 16:2677021-2677043 CTCCCATATAAGCCACGCCAAGG + Intergenic
1133008812 16:2898865-2898887 CTCCCAAGGCCACCAGGCCAGGG - Intronic
1136027897 16:27481730-27481752 CCTACATAGCCACCAGGCCAGGG - Intronic
1137721812 16:50631893-50631915 CCCCCTGAGGAACCAGGCCAGGG + Intronic
1138057880 16:53855285-53855307 CAGCCAGAGCAACCAGGCAAAGG - Intronic
1140248198 16:73270475-73270497 CGCCCACAGCACCCAGCCCAGGG + Intergenic
1142473904 17:179022-179044 CTCCCATAGGATCCAAGCCTAGG + Intronic
1142755084 17:2011625-2011647 CTCCCAAAGCCTCCAGGCAAGGG - Intronic
1143766807 17:9143231-9143253 ATCCGACAGCATCCAGGCCAAGG - Intronic
1145268950 17:21393971-21393993 CACCCATAGGACCCAGGCAAAGG + Intronic
1146477499 17:33174733-33174755 CTTCCATAGTCACCAGGACACGG - Intronic
1146498511 17:33344231-33344253 CTCCTCTAGCAACCAGTCCTGGG - Intronic
1151250113 17:72827854-72827876 GTCCCACAGTAACCTGGCCAGGG - Intronic
1152073442 17:78145263-78145285 CTCCCAGAGCCCCGAGGCCAGGG - Intergenic
1154957931 18:21277318-21277340 CTAGCATGGCAACCTGGCCAGGG - Intronic
1155689582 18:28602655-28602677 CTGCCTTAGCAAGCAGTCCAAGG - Intergenic
1158871304 18:61691042-61691064 CTCCCATGGTCACAAGGCCAAGG - Intergenic
1160120463 18:76126238-76126260 CTCCCCTAGGACCCAGGACATGG - Intergenic
1160192042 18:76722583-76722605 CCCCCATAGGACCCAGGCCATGG - Intergenic
1160898668 19:1415678-1415700 CACCCTTCGCAATCAGGCCAGGG - Intronic
1160961807 19:1725509-1725531 CTCCCCCAGCACCCAGGCCAGGG - Intergenic
1161236204 19:3199410-3199432 CTCCCATAGGAACCGGGCGCTGG - Intronic
1165072077 19:33261424-33261446 TTCCCAGAGCAGCCAAGCCAGGG - Intergenic
1165648917 19:37469014-37469036 CTCCCTTAGCAACCAGGGCGGGG - Intronic
1166802963 19:45469349-45469371 CTCCCTTAGCAACGTGGCCCCGG - Intronic
1167475894 19:49700842-49700864 CTCCCATACCAGCCAGGTCTTGG - Exonic
1202707754 1_KI270713v1_random:35880-35902 CTCCTGCAGCAACCAGGCCAGGG - Intergenic
925242094 2:2340230-2340252 CTCAGAAAGCAAACAGGCCAGGG - Intergenic
925644339 2:6020745-6020767 CTCCTACATCAACCAGGCCCGGG + Intergenic
926210309 2:10864386-10864408 CCCTCATAGTAGCCAGGCCAGGG + Intergenic
927096343 2:19750294-19750316 CTCCCAGGGCTACCAGTCCAAGG + Intergenic
932303932 2:70688083-70688105 CACCCAGAGCAACCACTCCATGG + Exonic
934870401 2:97860055-97860077 CTCCCTTGGCATCCATGCCATGG + Intronic
935111755 2:100100683-100100705 CTCCCACAGAAACCAGCACAAGG + Intronic
935320098 2:101878362-101878384 CTCCCATATCTACCTGTCCATGG + Intronic
935545379 2:104395196-104395218 CTCCTTTACCAACCAGGCGACGG - Intergenic
936123210 2:109764485-109764507 CTCCCACAGAAACCAGCACAAGG - Intergenic
936221472 2:110606984-110607006 CTCCCACAGAAACCAGCACAAGG + Intergenic
936668115 2:114621922-114621944 CTGCCACAGCAGCCAGCCCAGGG - Intronic
945120960 2:206456439-206456461 CTCTCATAGTCACCAGTCCAGGG - Intronic
946093817 2:217254454-217254476 TTCCCATAGACAGCAGGCCAAGG - Intergenic
948027590 2:234790312-234790334 GTGCCATTGCCACCAGGCCAAGG + Intergenic
948468144 2:238161946-238161968 CTCCCTCTGCATCCAGGCCAGGG + Intronic
1168795411 20:607695-607717 CCCCCATAGCAAGCAGGCTGGGG - Intronic
1169251013 20:4061105-4061127 CTCTCACAGGAACAAGGCCACGG - Intergenic
1170823705 20:19775777-19775799 CTCCCAAAGCAAACAGCCTAAGG + Intergenic
1173168002 20:40699664-40699686 GTCCCCTGGCAACCAAGCCAGGG - Intergenic
1178249578 21:30989428-30989450 CTCCCATTGCAGCAAGGCAATGG - Intergenic
1178956653 21:37028723-37028745 CTCCCATATCCTCCAGGCCCTGG + Intergenic
1184975149 22:48056417-48056439 CTCTCATTGACACCAGGCCAGGG + Intergenic
1185232693 22:49692623-49692645 CTCACATAGAGACCATGCCATGG + Intergenic
1185303113 22:50094012-50094034 CTATCACAGCAACCATGCCATGG - Intronic
953530406 3:43735438-43735460 GTCCCATAGGGACAAGGCCAGGG + Intergenic
953885412 3:46712184-46712206 CACCCACAGCAACCTGGGCACGG + Exonic
953902306 3:46850220-46850242 CTCCCAGAGCTCCCAGCCCAGGG + Intergenic
953989767 3:47475481-47475503 TTCCCGGAGCAACTAGGCCAGGG + Intronic
967584672 3:191197347-191197369 TTCCCATAACAACCTTGCCAAGG - Intergenic
968272610 3:197416119-197416141 CTCCTATAGCAAACAGACCCAGG + Intergenic
968846343 4:3043848-3043870 GTTCCATAGCCACCAGCCCAGGG - Intergenic
969409623 4:7019588-7019610 CTCCCACTTCAGCCAGGCCAGGG - Intronic
970828613 4:20308070-20308092 GTCCTATGGCTACCAGGCCAGGG + Intronic
971477989 4:27090096-27090118 CTCCCTAAGCAATCTGGCCATGG - Intergenic
976269504 4:83217105-83217127 CTCCCACTGCACCCAGGCCTTGG - Intergenic
979073474 4:116241082-116241104 CTCCCCTAGCCACCAGAACATGG + Intergenic
979099488 4:116598156-116598178 CTTCCCTAGGACCCAGGCCAAGG - Intergenic
984817733 4:183853426-183853448 CTGCCAGAGCAACCAGGGAAGGG + Intronic
984935218 4:184883839-184883861 CAGGCATAGCAACCATGCCAGGG + Intergenic
986814822 5:11397108-11397130 CTACCATAGCAACCAGACCCTGG - Exonic
987006397 5:13714539-13714561 CTACCAGAGCAAGCTGGCCAAGG - Exonic
990350856 5:54914445-54914467 CTCCCTTAGCAATCAATCCATGG - Intergenic
992034889 5:72763311-72763333 CTTCCATAGTTACCTGGCCAGGG + Intergenic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
997417683 5:133741531-133741553 CACCCATAGCAGCCAGGGAATGG + Intergenic
997571353 5:134930253-134930275 CTCCCATAGTACCTAGCCCAGGG + Intronic
997716417 5:136046459-136046481 CGCCCCTAGCAACGAGGCCTGGG + Exonic
998732879 5:145101072-145101094 CTTCCTTAGCAAGCAGTCCACGG - Intergenic
1008171988 6:48219447-48219469 ATCCCATAGTACCCAGACCATGG + Intergenic
1008565892 6:52767808-52767830 CTCACATGGCAAACATGCCAAGG - Intergenic
1008570082 6:52808148-52808170 CTCACATGGCAAACATGCCAAGG - Intergenic
1008577547 6:52875550-52875572 CTCACATGGCAAACATGCCAAGG - Intronic
1008866711 6:56220753-56220775 ATCCTATAGGAACCAGGCAATGG + Intronic
1012711127 6:102606842-102606864 CTCACATAGCAGCCAGCCCTGGG - Intergenic
1013264062 6:108477183-108477205 TTCCCATAGTAACTAGACCAAGG + Exonic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1017637242 6:156455688-156455710 CTCCCATAGCAAGCAGAAGAGGG + Intergenic
1018813953 6:167317231-167317253 CTCCCTGATCAGCCAGGCCAGGG - Intergenic
1020239348 7:6380735-6380757 CTGTCATAGAATCCAGGCCATGG - Intronic
1021766701 7:23956956-23956978 ATTCCACAGCACCCAGGCCAGGG + Intergenic
1023643757 7:42288010-42288032 CTTCCATAGCATCCTGGGCATGG + Intergenic
1024652373 7:51415944-51415966 ACCCCATAGTAACCAGTCCAGGG - Intergenic
1025037553 7:55606577-55606599 ACCCCATAGTAACCAGTCCAGGG - Intergenic
1026119419 7:67523858-67523880 GTCCCCTAGCACCCAGCCCAAGG - Intergenic
1028844319 7:95462096-95462118 CTTCTCTAGCACCCAGGCCAAGG + Intergenic
1029551729 7:101240178-101240200 GCCCCAGAACAACCAGGCCAAGG - Exonic
1029741769 7:102495142-102495164 CTCTCACAGCAGCCAGGACACGG + Intronic
1029759760 7:102594311-102594333 CTCTCACAGCAGCCAGGACACGG + Intronic
1029777122 7:102690221-102690243 CTCTCACAGCAGCCAGGACACGG + Intergenic
1031495346 7:122440285-122440307 CTGCCATGGAAACCAGGACATGG + Intronic
1031937881 7:127754611-127754633 CTCCCAAATCCACCAGGCCAGGG + Intronic
1033403016 7:141045307-141045329 TTCCCATATCAAAAAGGCCATGG - Intergenic
1035586760 8:781749-781771 TTCCCATAGCAACAATGACATGG - Intergenic
1036007839 8:4687113-4687135 CTGCCATAGCACACAGACCATGG + Intronic
1037002197 8:13733388-13733410 CTTCCAGAGCAACCAGGAGATGG - Intergenic
1038709885 8:29933732-29933754 CTTTCATAGCAACCAGGGTAAGG - Intergenic
1040576729 8:48658906-48658928 CTCCCATAGCAACCCAACCTAGG - Intergenic
1043694297 8:83201110-83201132 CTGCCATAGACACCAGGCCCAGG + Intergenic
1049002873 8:139837399-139837421 CTCCCATAGCCATCTGTCCAAGG + Intronic
1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG + Intronic
1049819890 8:144627100-144627122 CTCACAAAGGAGCCAGGCCAAGG + Intergenic
1049867613 8:144949159-144949181 CTCCCATAGCAAGCAGCCACAGG + Intronic
1051580072 9:18662238-18662260 CTCGCATAGCAGCCAGAGCAAGG - Intronic
1057261434 9:93586991-93587013 CACCCATGGCCAACAGGCCAAGG - Intronic
1057354319 9:94321798-94321820 CTCCCATCCCAGCCTGGCCAGGG - Intronic
1057381945 9:94576471-94576493 GTCCAATAGAAACCAGACCATGG - Intronic
1057416402 9:94867393-94867415 CTCTGAAAGCAAACAGGCCAGGG - Intronic
1057653445 9:96935837-96935859 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1057742233 9:97721875-97721897 TTCCCATAGCAGCCATGCAATGG + Intergenic
1061012851 9:127965620-127965642 CTCCTCCAGGAACCAGGCCAAGG - Intronic
1061309961 9:129755687-129755709 CTCCCCCAGCAACAAGGGCAGGG - Intergenic
1061394716 9:130337723-130337745 CTCCCTGAACCACCAGGCCAGGG - Intronic
1061807075 9:133142573-133142595 CTCCCAGGGCAGCCAAGCCAGGG - Intronic
1061876476 9:133546588-133546610 CACCCATGCCAGCCAGGCCAGGG + Intronic
1062137044 9:134934717-134934739 CTCCCCCAGCACCCAGGCCCAGG + Intergenic
1062541504 9:137043680-137043702 CTCCCAAAGCCACCACACCAGGG + Intronic
1190953711 X:55171395-55171417 CTCCCATGACAACAAGGCCATGG - Intronic
1195085263 X:101407760-101407782 CTCCCAGTGCAGCCAGCCCATGG + Exonic
1195342421 X:103918694-103918716 TTCTCAGCGCAACCAGGCCATGG + Intergenic
1195511755 X:105723743-105723765 CTCACATGGCAACAAGGGCAAGG + Intronic
1195750805 X:108160931-108160953 TTCCCATAGCCACCTGGCCTTGG + Intronic
1196627524 X:117893639-117893661 TTCCCCTAGCAACTGGGCCAGGG + Intergenic
1200108973 X:153729426-153729448 CTCCAAGAGGATCCAGGCCAGGG + Intronic