ID: 914652429

View in Genome Browser
Species Human (GRCh38)
Location 1:149708057-149708079
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 4, 1: 0, 2: 1, 3: 4, 4: 70}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914652429_914652433 0 Left 914652429 1:149708057-149708079 CCACGGTGGCTGAAGATGTTAGC 0: 4
1: 0
2: 1
3: 4
4: 70
Right 914652433 1:149708080-149708102 AAATTCGGTTCGCGGTGTCTGGG 0: 4
1: 3
2: 1
3: 0
4: 13
914652429_914652431 -8 Left 914652429 1:149708057-149708079 CCACGGTGGCTGAAGATGTTAGC 0: 4
1: 0
2: 1
3: 4
4: 70
Right 914652431 1:149708072-149708094 ATGTTAGCAAATTCGGTTCGCGG 0: 4
1: 1
2: 2
3: 1
4: 43
914652429_914652436 15 Left 914652429 1:149708057-149708079 CCACGGTGGCTGAAGATGTTAGC 0: 4
1: 0
2: 1
3: 4
4: 70
Right 914652436 1:149708095-149708117 TGTCTGGGGTACAGCCTCGAGGG 0: 4
1: 0
2: 4
3: 7
4: 90
914652429_914652434 1 Left 914652429 1:149708057-149708079 CCACGGTGGCTGAAGATGTTAGC 0: 4
1: 0
2: 1
3: 4
4: 70
Right 914652434 1:149708081-149708103 AATTCGGTTCGCGGTGTCTGGGG 0: 4
1: 3
2: 1
3: 0
4: 10
914652429_914652435 14 Left 914652429 1:149708057-149708079 CCACGGTGGCTGAAGATGTTAGC 0: 4
1: 0
2: 1
3: 4
4: 70
Right 914652435 1:149708094-149708116 GTGTCTGGGGTACAGCCTCGAGG 0: 4
1: 0
2: 5
3: 15
4: 124
914652429_914652432 -1 Left 914652429 1:149708057-149708079 CCACGGTGGCTGAAGATGTTAGC 0: 4
1: 0
2: 1
3: 4
4: 70
Right 914652432 1:149708079-149708101 CAAATTCGGTTCGCGGTGTCTGG 0: 4
1: 3
2: 1
3: 0
4: 5
914652429_914652437 23 Left 914652429 1:149708057-149708079 CCACGGTGGCTGAAGATGTTAGC 0: 4
1: 0
2: 1
3: 4
4: 70
Right 914652437 1:149708103-149708125 GTACAGCCTCGAGGGTCCATTGG 0: 4
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914652429 Original CRISPR GCTAACATCTTCAGCCACCG TGG (reversed) Intergenic
902457436 1:16545351-16545373 GCTCACATCGTCAGCGACCGCGG - Intergenic
902483782 1:16727921-16727943 GCTCACATCGTCAGCGGCCGCGG + Intergenic
902494729 1:16862557-16862579 GCTAACATCGTCAGCGACCGCGG + Intronic
902742443 1:18448244-18448266 GCTAACATCATCTGCCATCATGG - Intergenic
908197471 1:61759313-61759335 GCTCACTCCTTCAGCCACAGGGG - Intronic
913662426 1:121016242-121016264 GCTAACATCTTCAGCCACCGTGG - Intergenic
914013806 1:143799438-143799460 GCTAACATCTTCAGCCACCGTGG - Intergenic
914164018 1:145161759-145161781 GCTAACATCTTCAGCCACCGTGG + Intergenic
914341155 1:146761740-146761762 GCTAACACCTCCAGCCACATGGG + Intergenic
914652429 1:149708057-149708079 GCTAACATCTTCAGCCACCGTGG - Intergenic
1062763916 10:47298-47320 GCTGACATTTTTAGCCCCCGGGG + Exonic
1063488487 10:6441912-6441934 GCTTCCTTCTCCAGCCACCGTGG + Exonic
1065642079 10:27793595-27793617 TCTAAGATCTTCAGCCTCCTAGG - Intergenic
1071903105 10:90141693-90141715 GCTAACATATTCAGCAGCCAAGG - Intergenic
1073459630 10:103659222-103659244 GCTCTCATCTTCAGCCATCCTGG + Intronic
1073628953 10:105128582-105128604 AGAAACATCTTCAGCCACAGGGG - Intronic
1078342025 11:10504456-10504478 GCTAACAACATCAGACACTGCGG - Intronic
1079658825 11:23016227-23016249 CCTAAAATCTTCACCCACAGAGG - Intergenic
1088819201 11:113442737-113442759 GCTAATCTCTTCAGCAACTGAGG + Intronic
1089348146 11:117804852-117804874 ACTAACATCCTCAGCCTCCCAGG - Intronic
1090994297 11:131851428-131851450 GCTAACATTTTCATTCACCATGG + Intronic
1099787758 12:87287859-87287881 ACTAACCTCTTCAGCCTCCAGGG + Intergenic
1100826991 12:98483810-98483832 GCTAACAACTTGAGCTACCTTGG + Intergenic
1111548497 13:89777032-89777054 TTTTACATCTTCAGCCACCAGGG - Intergenic
1119483325 14:74973409-74973431 GTCAGCAGCTTCAGCCACCGTGG - Intergenic
1119704457 14:76775316-76775338 GCTCACCTCTCCAGCCCCCGGGG - Intronic
1130607192 15:85328649-85328671 GCTCAGATCTTCAGACCCCGAGG + Intergenic
1135693988 16:24570977-24570999 GATAACATCTTCAGCTGGCGCGG - Exonic
1138235102 16:55375745-55375767 GCTCACATCTTCACCAACCCTGG + Intergenic
1139638610 16:68274791-68274813 GCTGACATCTTCTTCCACCTGGG - Exonic
1139993130 16:70955668-70955690 GCTAACACCTCCAGCCACATGGG - Intronic
1142399470 16:89851796-89851818 GAAAACACCTTCTGCCACCGAGG - Intronic
1145295363 17:21587516-21587538 GGTAACTTTTTCAGCCACAGAGG - Intergenic
1145368138 17:22282128-22282150 GGTAACTTTTTCAGCCACAGAGG + Intergenic
1147476797 17:40719729-40719751 GCTAACTGCTTCAGCATCCGTGG + Intergenic
1149816523 17:59730056-59730078 TCTAACATCTTTAGCCATCAAGG - Intronic
1150670009 17:67186052-67186074 GCCAACATCTGCAGGCACTGTGG + Intronic
1150986182 17:70199676-70199698 GCTAACTATTTCATCCACCGTGG - Intergenic
1152956824 18:47631-47653 GCTGACATTTTTAGCCCCCGGGG + Exonic
1156513509 18:37661112-37661134 GCTATCGTCCTCAGGCACCGTGG - Intergenic
1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1164707142 19:30328225-30328247 GCTCACTTCTTCAGCCATCATGG - Intronic
927364384 2:22276988-22277010 GCTGACACCTTCAGCCACAGAGG + Intergenic
941243200 2:163067769-163067791 GCTACCATCTTTAGGCACCCTGG + Intergenic
942146700 2:173034285-173034307 TCTAACACCTCCAGCCAACGGGG - Intronic
943433301 2:187831305-187831327 GCAAACTACTTCAGCCACTGTGG + Intergenic
1173496286 20:43520634-43520656 GCTAACATCATTAGCCATCAGGG - Intronic
1182026264 22:27121620-27121642 GAGAGCATCTTCAGCCACCCAGG - Intergenic
1182937246 22:34236305-34236327 GCTGCCATCTTCAGCAACTGGGG - Intergenic
1185252330 22:49810704-49810726 GGCAACATCTTCAGCCACTGTGG + Intronic
952268990 3:31814150-31814172 GCTACTTTCTTCAGCCACAGAGG + Intronic
952924782 3:38313015-38313037 CCTTTCATCATCAGCCACCGCGG - Exonic
961565286 3:127759345-127759367 GCTAACATCTCCAACCTCTGCGG + Intronic
965550040 3:169955040-169955062 CCTCTCATCTTCAGCCACTGTGG + Intergenic
967391060 3:188954819-188954841 GCCAACATCCTCAGCCATCTTGG + Intronic
968339054 3:197939528-197939550 GCTAAAAGCTTGAGCCACTGAGG + Intronic
968829993 4:2928366-2928388 GGCAGCCTCTTCAGCCACCGGGG - Exonic
970419189 4:15889401-15889423 GCTGACATTCTCAGCCACAGTGG - Intergenic
971065994 4:23033922-23033944 GCAAACTAGTTCAGCCACCGTGG - Intergenic
973105495 4:46331302-46331324 CCTTACATTTTCAGCCACCCAGG + Intronic
982458526 4:155638868-155638890 GCTAACATCTACTCCCACCTAGG + Intergenic
982939767 4:161535642-161535664 GCAAACTTGTTCAGCCACTGTGG + Intronic
983921746 4:173353311-173353333 GCAAATATCTTCACCCACCCTGG - Intergenic
988537406 5:32081221-32081243 CCAAACATCTGCACCCACCGGGG - Intronic
989223792 5:39001762-39001784 CCTAACATCATCACTCACCGGGG + Intronic
994612076 5:102055853-102055875 GCCAACATCTTCCACCACAGTGG - Intergenic
1001129411 5:169051586-169051608 GCTAACATTTTAAGCCACTTTGG + Intronic
1006092340 6:31635444-31635466 GCTAACAGCATCAGTCACTGAGG + Exonic
1013379827 6:109557307-109557329 GGTAACATCTTCAGGCATGGGGG - Intronic
1015652796 6:135481105-135481127 GCTAACACATTCAGCCCCCTTGG + Intronic
1043854623 8:85250871-85250893 GCTAAAATCATCAGCAACAGCGG + Exonic
1056486842 9:87067314-87067336 GCCAACATCTTCTGACACCCAGG + Intergenic
1057881883 9:98798105-98798127 GCAAACTAGTTCAGCCACCGTGG - Intergenic
1058941824 9:109820613-109820635 GCTAACATCACCAGCCCCTGTGG - Intronic
1060294057 9:122331183-122331205 CCTAACATCTTCACCCATCGGGG + Intergenic
1061550049 9:131329120-131329142 GCTTTCTTCTTCAGCCACTGTGG + Intergenic
1062741341 9:138177001-138177023 GCTGACATTTTTAGCCCCCGGGG - Intergenic
1201578192 Y:15483107-15483129 GGGAACTTCTTCAGCCACTGGGG + Intergenic