ID: 914655412

View in Genome Browser
Species Human (GRCh38)
Location 1:149735523-149735545
Sequence TCTAGGACTCCCAATTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914655410_914655412 -8 Left 914655410 1:149735508-149735530 CCTAGGCTATAGACCTCTAGGAC No data
Right 914655412 1:149735523-149735545 TCTAGGACTCCCAATTTGAGAGG No data
914655408_914655412 -1 Left 914655408 1:149735501-149735523 CCACATTCCTAGGCTATAGACCT No data
Right 914655412 1:149735523-149735545 TCTAGGACTCCCAATTTGAGAGG No data
914655407_914655412 0 Left 914655407 1:149735500-149735522 CCCACATTCCTAGGCTATAGACC No data
Right 914655412 1:149735523-149735545 TCTAGGACTCCCAATTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914655412 Original CRISPR TCTAGGACTCCCAATTTGAG AGG Intergenic
No off target data available for this crispr