ID: 914655931

View in Genome Browser
Species Human (GRCh38)
Location 1:149740653-149740675
Sequence CAGAATATACAATCGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914655930_914655931 25 Left 914655930 1:149740605-149740627 CCAGGGCGCTCAATTAGGACTTG No data
Right 914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG No data
914655929_914655931 26 Left 914655929 1:149740604-149740626 CCCAGGGCGCTCAATTAGGACTT No data
Right 914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914655931 Original CRISPR CAGAATATACAATCGAACAA TGG Intergenic
No off target data available for this crispr