ID: 914661312

View in Genome Browser
Species Human (GRCh38)
Location 1:149793037-149793059
Sequence GTGGCGCCGCGCCGGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 2, 1: 0, 2: 2, 3: 33, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914661312_914661325 21 Left 914661312 1:149793037-149793059 CCCGGGCCCCGGCGCGGCGCCAC 0: 2
1: 0
2: 2
3: 33
4: 378
Right 914661325 1:149793081-149793103 TGCAGCTGCCGCCAAGCCCCGGG 0: 1
1: 2
2: 2
3: 29
4: 305
914661312_914661326 22 Left 914661312 1:149793037-149793059 CCCGGGCCCCGGCGCGGCGCCAC 0: 2
1: 0
2: 2
3: 33
4: 378
Right 914661326 1:149793082-149793104 GCAGCTGCCGCCAAGCCCCGGGG 0: 1
1: 2
2: 3
3: 17
4: 228
914661312_914661324 20 Left 914661312 1:149793037-149793059 CCCGGGCCCCGGCGCGGCGCCAC 0: 2
1: 0
2: 2
3: 33
4: 378
Right 914661324 1:149793080-149793102 TTGCAGCTGCCGCCAAGCCCCGG 0: 1
1: 2
2: 0
3: 24
4: 210
914661312_914661321 -3 Left 914661312 1:149793037-149793059 CCCGGGCCCCGGCGCGGCGCCAC 0: 2
1: 0
2: 2
3: 33
4: 378
Right 914661321 1:149793057-149793079 CACCTGGCGGCCGTCTGTGGAGG 0: 3
1: 0
2: 1
3: 5
4: 171
914661312_914661319 -6 Left 914661312 1:149793037-149793059 CCCGGGCCCCGGCGCGGCGCCAC 0: 2
1: 0
2: 2
3: 33
4: 378
Right 914661319 1:149793054-149793076 CGCCACCTGGCGGCCGTCTGTGG 0: 3
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914661312 Original CRISPR GTGGCGCCGCGCCGGGGCCC GGG (reversed) Intronic
900117424 1:1034530-1034552 GGGGCGCAGAGCCGGAGCCCCGG + Intronic
900243991 1:1629402-1629424 GGGGCGCGGCCCCGGGCCCCAGG + Exonic
900313283 1:2044941-2044963 CTGGCGGCGCGTGGGGGCCCGGG - Intergenic
900349681 1:2228536-2228558 GTGGCGCCGGGCCCGGGCGGCGG + Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
901279900 1:8026076-8026098 GGGGCCCCGCGCCGGGCGCCGGG - Intronic
901332809 1:8423868-8423890 GGGGCCCCGCGCCCCGGCCCCGG + Intronic
901540067 1:9910029-9910051 GCCGCGCCGCGCCGGGGCTTGGG - Intronic
901556071 1:10032642-10032664 GTGGCGCTGGCCCGCGGCCCGGG - Intergenic
902585945 1:17438692-17438714 AAGGAGCCGCGCCGGGGCCAGGG - Intronic
902911025 1:19597251-19597273 GTGACCTCCCGCCGGGGCCCGGG - Intronic
903184675 1:21622430-21622452 GTGCCGCCCCGGCGGGGGCCGGG - Intronic
903514779 1:23902974-23902996 CTCGCGCCGCGCCGGGGCCTCGG + Intronic
904696781 1:32335698-32335720 GGGGGGCAGCGCCGGGGACCGGG + Intronic
904778297 1:32925219-32925241 GTGGAGGCGCGCCTGGCCCCTGG + Intergenic
904837670 1:33349672-33349694 GAGGCGGCCCGCCCGGGCCCGGG - Intronic
904837685 1:33349706-33349728 GAGCCTCCGAGCCGGGGCCCGGG + Intronic
905108261 1:35576828-35576850 GTGGCGGCGCGCTGGCTCCCTGG + Intronic
906033525 1:42737514-42737536 GTGGCACCGTGCCCGGGCCCTGG - Intronic
906960989 1:50419382-50419404 GTGAGGCCGCGCCGGCGCCAGGG - Exonic
907012689 1:50978107-50978129 GGGGCGCTGCGCCGGCGGCCGGG - Intergenic
907261211 1:53220238-53220260 GTGCGGCCGGGGCGGGGCCCGGG - Intronic
907277757 1:53326637-53326659 GTGGGGCCGGGGCGGAGCCCCGG - Intronic
907689243 1:56645603-56645625 GTCGCGCGGAGCTGGGGCCCCGG + Intronic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
913144637 1:115976864-115976886 GAGGCGCCGCGCGGTGGCCTGGG + Intronic
914022825 1:143885093-143885115 GTGGCGCCGCGCCGGGGCCCGGG - Intergenic
914661312 1:149793037-149793059 GTGGCGCCGCGCCGGGGCCCGGG - Intronic
914702895 1:150150198-150150220 GCGGCCCCGCGTCGGGGCCTCGG - Exonic
914817135 1:151071226-151071248 GCGGCGCGGAGCCGGGGCCGAGG + Intronic
914831951 1:151176703-151176725 GAGGTGGCGGGCCGGGGCCCAGG + Exonic
915167807 1:153958320-153958342 GAGGGGCCGCGCCGGGGAGCCGG - Intronic
915937793 1:160099002-160099024 CTGGGGCGGGGCCGGGGCCCGGG - Intergenic
916414037 1:164576389-164576411 GCGGCGCCGCGCCGGCGGACCGG - Intronic
919789771 1:201283665-201283687 GTGGCGCGCGGCCGGGGCCTAGG - Exonic
920920257 1:210292540-210292562 CCGGAGCCGCGCGGGGGCCCGGG + Intergenic
922196378 1:223363719-223363741 TTGGCTCCGCGCCGGTCCCCGGG + Exonic
922987874 1:229880444-229880466 GTGGGGCCACCCCAGGGCCCTGG - Intergenic
1062874087 10:931483-931505 GTGGCGCGGCCGCCGGGCCCCGG - Exonic
1063360095 10:5446559-5446581 GTGGCCCCGCCCCCGAGCCCTGG + Intronic
1064231034 10:13529185-13529207 GCGGCGCAGCGCCCTGGCCCGGG + Intergenic
1064298928 10:14104559-14104581 GTGGCCCCGCTCAGTGGCCCTGG + Intronic
1065161569 10:22927990-22928012 GCCGCGCCGCGCCTGCGCCCTGG - Intergenic
1065367882 10:24952750-24952772 GGGGCGCAGCGCCGGGGCCATGG - Intergenic
1065727250 10:28677839-28677861 CTGCCGCCGAGCCGGGGCTCCGG + Exonic
1067110625 10:43397160-43397182 GAGCCGCCGCGCGGGCGCCCCGG - Intronic
1067295893 10:44975089-44975111 GGGGCGCGGCGCCGAGGCTCCGG + Intronic
1067694336 10:48524152-48524174 GCCGCGCCGCCCCGGGGCGCAGG - Intronic
1069582174 10:69573517-69573539 GTGGCGCGGCCCCAGGGCCCCGG - Intergenic
1069738444 10:70672620-70672642 GCGGCGCCGCGCAGGGGACCCGG + Intergenic
1071527636 10:86367229-86367251 GGGGCGCCGGGCCAGGCCCCAGG + Intergenic
1072654302 10:97319655-97319677 GGGGCGCCGCTGCGGGCCCCGGG + Exonic
1072731569 10:97850196-97850218 GTGGCGGCGAGCTGGGGCCCGGG - Intergenic
1072793329 10:98335378-98335400 GTGGTGCAGGGCCAGGGCCCTGG - Intergenic
1074753735 10:116609735-116609757 GCGGCGCGGAGGCGGGGCCCAGG + Intergenic
1076116842 10:127907038-127907060 GTGGCTCCGCGGCGGGGGCGGGG - Intergenic
1076722222 10:132397594-132397616 GGGGCGCGGGGCCGGGGTCCCGG + Intronic
1076734698 10:132453342-132453364 GTGGCCGCGGGGCGGGGCCCGGG + Intergenic
1076798386 10:132809673-132809695 GTGGCTCCTCCCCGGGGTCCCGG + Intronic
1077049669 11:561033-561055 GGTGAGCCGCGCCGGGTCCCCGG + Exonic
1077090747 11:777259-777281 GGGGCGCCGGGCAGGGGCCGGGG - Intronic
1077182796 11:1224037-1224059 GTGGCTCCCAGCCTGGGCCCGGG + Intronic
1077323439 11:1952933-1952955 GAGACGCTGCGCTGGGGCCCAGG + Intronic
1077360987 11:2139980-2140002 CCGGTGCCGCGCCGGAGCCCCGG + Intronic
1077365506 11:2159967-2159989 GTGGAGCTGGGCGGGGGCCCTGG - Exonic
1077495470 11:2884829-2884851 GAGGCGCCGCGTCCGGGGCCGGG + Exonic
1078527360 11:12110894-12110916 GTGGCGCTGCGACGAAGCCCGGG + Intronic
1080386650 11:31814510-31814532 GAGGCGCAGCGCCGGCGCGCTGG + Intronic
1080540351 11:33258175-33258197 GCCGCGCCTGGCCGGGGCCCGGG + Intronic
1082003706 11:47408545-47408567 GCGGCCCCGGGCCGGGGGCCGGG + Intronic
1083207416 11:61161158-61161180 GAGGCGCCGCCCCGGCTCCCCGG - Intronic
1084779245 11:71397745-71397767 GTGGGGCCTGGCAGGGGCCCAGG - Intergenic
1087713711 11:101583426-101583448 GTTGCGCCGCGCAGCGGCTCCGG + Exonic
1089289031 11:117426734-117426756 GTGCGGCCTCACCGGGGCCCAGG + Intergenic
1090699149 11:129279152-129279174 GCGGCGGCGCGGCGGGGCCGCGG - Intronic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1091259573 11:134223931-134223953 GCGGCGGCGAGCCGGTGCCCTGG - Exonic
1091289441 11:134429307-134429329 GTGGCTCCGCTCCCAGGCCCAGG + Intergenic
1202806427 11_KI270721v1_random:8128-8150 GAGACGCTGCGCTGGGGCCCAGG + Intergenic
1091773060 12:3165921-3165943 GTGGCTCCGCACCGAGGCTCAGG + Intronic
1092743233 12:11649858-11649880 GCGGCGCGGCGCGGGGACCCGGG - Exonic
1094237953 12:28190360-28190382 GTGGCCCCAGGCCGAGGCCCGGG - Intronic
1094375426 12:29783810-29783832 GCCGCGCGCCGCCGGGGCCCCGG - Exonic
1094843637 12:34352123-34352145 GTGGCGCCCCCACGGGGCCCAGG + Intergenic
1095206105 12:39442669-39442691 GCTGCGCGGCGCCGGGTCCCTGG - Intronic
1096253783 12:50050910-50050932 GCGGCCCAGCGCCGGGGCCCCGG + Intergenic
1098161189 12:67649194-67649216 GTGCCGCCGCGCCGCATCCCCGG + Intronic
1102238715 12:111310401-111310423 GGGGCGGAGCGGCGGGGCCCGGG + Exonic
1102256602 12:111418809-111418831 CTGGCGCTGCGCCGGGCCCCGGG + Exonic
1102584317 12:113912461-113912483 GTGGCTCCAAGCCGGGGCTCTGG + Intronic
1103400611 12:120640789-120640811 GCGGCGCGGCGCGGGGCCCCCGG - Exonic
1103474775 12:121210305-121210327 GTGGGGCCGCGCGGGGGGCGCGG + Intronic
1103474810 12:121210434-121210456 CAGCCGCCGCGCCGGGGCCCCGG + Intronic
1103484620 12:121274248-121274270 GTGGGGCCGGGCCTGGGACCCGG + Exonic
1103764054 12:123269584-123269606 GGGGAGCCGCGCCTGGCCCCAGG - Intronic
1104692791 12:130839191-130839213 CTGGCGCCGGGCCGGGACCGCGG - Exonic
1104841603 12:131828512-131828534 GGGGCGGCGGGCCGGGTCCCCGG - Exonic
1105882134 13:24614505-24614527 GTGGAGCCACGTCGGGGCCTTGG - Intergenic
1105943407 13:25170687-25170709 GGCGCGCCGAGCCGGGGCCCGGG - Exonic
1106517222 13:30465598-30465620 GCTGCCCCGCGCCGGTGCCCCGG - Intronic
1109024706 13:57142778-57142800 GTTGCGCCACGTCGGGGCCAGGG - Exonic
1109025693 13:57149348-57149370 GTTGCGCCACGTCGGGGCCAGGG - Exonic
1109026683 13:57155921-57155943 GTTGCGCCACGTCGGGGCCAGGG - Exonic
1109027675 13:57162492-57162514 GTTGCGCCACGTCGGGGCCAGGG - Exonic
1109028661 13:57169057-57169079 GTTGCGCCACGTCGGGGCCAGGG - Exonic
1110119504 13:71865449-71865471 GTGGCGCCGAGCGGTGTCCCGGG - Intronic
1113775600 13:112943383-112943405 GCGGCGCGGAGCCGGGGACCGGG - Intronic
1116945381 14:50830979-50831001 GTGGCGCAACCCCGGGGACCCGG - Intronic
1116973590 14:51093756-51093778 GTAGAGCCGCGCCAGTGCCCAGG - Intronic
1117803047 14:59464687-59464709 CTGCCGCCGCCGCGGGGCCCTGG - Exonic
1119456859 14:74763572-74763594 CTGAGGCCTCGCCGGGGCCCGGG + Exonic
1119539262 14:75428107-75428129 CTGGCGCCGCGGCGGCTCCCGGG + Intronic
1120788019 14:88554711-88554733 GCGGCCGCGCGGCGGGGCCCCGG - Exonic
1121342701 14:93115039-93115061 GGGACGCGGCGCCGGCGCCCGGG - Intronic
1121417458 14:93788883-93788905 GTGGCGCCGCGCGGCTGCCCGGG + Intergenic
1122065819 14:99174020-99174042 GTGCCGCCTCCCCTGGGCCCCGG + Exonic
1122082065 14:99273350-99273372 GTGGGGCCTCTCCGTGGCCCGGG + Intergenic
1122602427 14:102928382-102928404 GCGGCGCCACGCGGGGGTCCGGG - Intronic
1122848676 14:104514712-104514734 GTGGCCCAGCCCTGGGGCCCCGG - Intronic
1122993246 14:105248790-105248812 CTCGCGCCGCGCCGGGGCCTCGG - Exonic
1123033909 14:105464096-105464118 GGGGCGCCGGGCCAGAGCCCTGG + Exonic
1123880704 15:24675919-24675941 GGGGCGCCACGCCCTGGCCCTGG - Exonic
1124743130 15:32315371-32315393 TCGGGGCCGCGCCGGGGCCGGGG - Intergenic
1126800829 15:52295446-52295468 GAGGCGCCGCGGAGGGGCCACGG - Intronic
1127867165 15:63042433-63042455 TTGGGGCCGAGCCGGGGCCGAGG - Intergenic
1128067617 15:64774836-64774858 GTGCCGCCGAGGCGGGGTCCTGG + Intronic
1128264167 15:66253251-66253273 GTGGCGCGGCGCGGGTGTCCCGG - Intronic
1128321996 15:66701085-66701107 GGGGCGCCGCGCCGGGGGTGGGG + Intergenic
1128784260 15:70383264-70383286 GTGGAGCAGCCCCAGGGCCCTGG - Intergenic
1129221513 15:74134267-74134289 CTGGCTGCGCGCTGGGGCCCTGG + Exonic
1129393655 15:75233054-75233076 GTGGCTTCCAGCCGGGGCCCGGG - Intergenic
1130335374 15:82952962-82952984 ATGGCACTGCGCCAGGGCCCCGG - Intronic
1130540348 15:84817363-84817385 GCGGCGGCGGGCAGGGGCCCGGG + Exonic
1130613431 15:85381160-85381182 GCGGCGCCGACCCGGGGACCCGG - Intronic
1131085898 15:89575557-89575579 GTGCCGCCGCCCCGGGGCCCCGG - Exonic
1131098262 15:89669536-89669558 GTGGCCCTGCTCCAGGGCCCGGG + Exonic
1131261467 15:90890212-90890234 GCGGGGGCTCGCCGGGGCCCAGG - Exonic
1132540367 16:505647-505669 GAGGCGCCACGCAGAGGCCCGGG - Intronic
1132560201 16:590061-590083 GTGGGGCGGCGCGGCGGCCCTGG + Intronic
1132604409 16:787828-787850 GTGGCTTCGCACCGGAGCCCGGG - Exonic
1132831444 16:1930192-1930214 GTGATCCCTCGCCGGGGCCCAGG - Intergenic
1132871239 16:2116666-2116688 GAGGCGCCGGGCCAGGGCCCAGG + Intronic
1132948810 16:2548612-2548634 GTGGCACCGGGGCGGGGTCCTGG - Intronic
1132965777 16:2653515-2653537 GTGGCACCGGGGCGGGGTCCTGG + Intergenic
1133038378 16:3046849-3046871 CTGGGGCCGCCCCGGGGACCTGG - Exonic
1133040673 16:3058576-3058598 GCGGCGGCGCGCCCGGACCCCGG + Exonic
1133772741 16:8877113-8877135 GTGGGGCAGCACAGGGGCCCAGG - Intergenic
1134521287 16:14920228-14920250 GAGGCGCCGGGCCAGGGCCCAGG - Intronic
1134708962 16:16318879-16318901 GAGGCGCCGGGCCAGGGCCCAGG - Intergenic
1134716172 16:16358913-16358935 GAGGCGCCGGGCCAGGGCCCAGG - Intergenic
1134950643 16:18349766-18349788 GAGGCGCCGGGCCAGGGCCCAGG + Intergenic
1134958581 16:18393246-18393268 GAGGCGCCGGGCCAGGGCCCAGG + Intergenic
1137926611 16:52547007-52547029 GGGGCGCGGCGCTGGGGCCCGGG + Exonic
1138179876 16:54933694-54933716 GTGGGGCCTGGCCCGGGCCCCGG - Exonic
1138478375 16:57285017-57285039 GAGTCGCTGCGCCGGGGCCTAGG - Intergenic
1139805918 16:69565735-69565757 GTGGCCGCGCGCTGGGGCCCCGG - Intronic
1139974786 16:70800944-70800966 CCGGGGCCGCGCCGGGGCCAGGG + Exonic
1140091934 16:71846010-71846032 GTGGGGCGGCTCCGGGGCCGGGG + Exonic
1141754834 16:85984023-85984045 GTGGCCCCGAGCCCGGGTCCTGG + Intergenic
1142018022 16:87762076-87762098 GTGGCTCCGCGGCGGGTCCTGGG - Intronic
1142239939 16:88940576-88940598 GCGGGGCAGCGCCGGGGACCCGG + Intronic
1142285862 16:89171345-89171367 GTGGGGCCGGGGCGGGGCCGAGG - Intergenic
1142646466 17:1316756-1316778 GAGCCGCCGCGCCCGGCCCCTGG + Intergenic
1142715959 17:1747113-1747135 GTCGGAACGCGCCGGGGCCCAGG - Exonic
1142855105 17:2724703-2724725 CAGGCCCCGCGCCCGGGCCCCGG - Intergenic
1143411749 17:6713455-6713477 GGGGCGCCTCCCCGCGGCCCTGG + Exonic
1143411758 17:6713466-6713488 GTGGCCCCGCCCCAGGGCCGCGG - Exonic
1144763934 17:17722869-17722891 GTCGCGCTGCGCCGCGACCCCGG + Intronic
1144764206 17:17724116-17724138 GACGCGCAGCGCCGGCGCCCGGG + Exonic
1146173206 17:30648505-30648527 GTGGGGGCGGGCAGGGGCCCTGG + Intergenic
1146346668 17:32064537-32064559 GTGGGGGCGGGCAGGGGCCCTGG + Intergenic
1146787360 17:35731798-35731820 GGGGGGCAGCGCCGGAGCCCGGG + Exonic
1146846100 17:36183029-36183051 CGGGCGCCGCGCCGGCTCCCCGG - Intronic
1147139625 17:38453879-38453901 CGCGCGCCGCGCGGGGGCCCGGG - Intronic
1147183962 17:38703964-38703986 GGGGGGCCGCGGCGGGCCCCAGG + Intergenic
1147629244 17:41919182-41919204 GCGGGGCCGGGGCGGGGCCCCGG + Intronic
1147788206 17:42995692-42995714 GAGGCACCGCGCCTGGCCCCCGG - Intergenic
1148060127 17:44830318-44830340 GGGGCGTCCCGCCGCGGCCCGGG + Intronic
1148323707 17:46771707-46771729 GCGGCCCGGCGCCGGGGCCGGGG - Intronic
1148462547 17:47846919-47846941 GTGGGGCCGGCCCGGGGCGCTGG - Exonic
1150225701 17:63523384-63523406 GTGGCTCCGGGCAGGGGCCGCGG + Exonic
1151708357 17:75784790-75784812 GTGGCGCGGCGCAGGCGCACTGG + Exonic
1151801642 17:76382946-76382968 GGGGCTCCGCGCGGGAGCCCAGG - Intronic
1151854398 17:76710773-76710795 GCGGGACGGCGCCGGGGCCCCGG + Exonic
1152573645 17:81131014-81131036 GTGGCCTCCCTCCGGGGCCCAGG - Intronic
1152758918 17:82098348-82098370 GCGGCGGCGCGCCGGGTCCCGGG - Intergenic
1153480471 18:5543064-5543086 GTCGCGCCGCCCCGAGCCCCCGG + Intronic
1153900530 18:9614308-9614330 GGGGCGTCGCGCCGGGCCCCGGG - Intronic
1156171715 18:34493912-34493934 GAGGCGCCGCGCCGCAGTCCTGG - Intronic
1157279108 18:46334203-46334225 GTGGCGCGGCTCCGGGGCGCGGG - Exonic
1157495049 18:48150964-48150986 GTGGCTCTGAGCTGGGGCCCAGG - Intronic
1158137563 18:54224143-54224165 GGAGCGCGGGGCCGGGGCCCAGG - Exonic
1159586571 18:70288776-70288798 GGGGCGCCGGGCCGGGGTCGTGG - Intergenic
1159586785 18:70289369-70289391 GGGCCGCCGCGCCCCGGCCCCGG - Intronic
1159770810 18:72543690-72543712 TAGGCGCCGCGCCCGGGACCGGG + Intronic
1160378369 18:78430622-78430644 GTGGCGCGGCGCCCGCGCTCCGG - Intergenic
1160425885 18:78778850-78778872 GTGGCGCTGTGCCGGGCCCAGGG - Intergenic
1160680381 19:409296-409318 GAGGAGCCTCGCCAGGGCCCGGG + Intergenic
1160719197 19:590077-590099 GGGGCGCGGGCCCGGGGCCCGGG - Exonic
1160861228 19:1237961-1237983 GGGGCGGCGGGCCGGGGACCGGG - Exonic
1160911093 19:1474123-1474145 GCGGCTCCGTCCCGGGGCCCCGG - Exonic
1160930324 19:1567176-1567198 GGGGAGCCGCGCCGCAGCCCAGG - Intronic
1160972826 19:1776961-1776983 GGGGCCCCGAGCCGGGTCCCAGG - Exonic
1160991816 19:1863269-1863291 GGGGCGCCGCGGCGGCGCCGGGG + Exonic
1161264831 19:3359442-3359464 GCTGCTCCGCGCCGCGGCCCCGG - Intergenic
1161349905 19:3785815-3785837 GTGGCCCGGCGCTGGCGCCCAGG - Intronic
1161400256 19:4064166-4064188 GTGGCTGCCCGCCCGGGCCCAGG + Intronic
1162079329 19:8209238-8209260 CTGGCGCGGGGCTGGGGCCCTGG - Intronic
1162426875 19:10602422-10602444 GAGGGGCGGGGCCGGGGCCCGGG + Intergenic
1162490067 19:10986550-10986572 GAGGTGCCGGGCCGGGACCCGGG - Exonic
1162802325 19:13118382-13118404 CTGGGGCCGGGCCTGGGCCCGGG - Exonic
1162861172 19:13506504-13506526 GGGGCGGGGCGCGGGGGCCCGGG + Intronic
1162975875 19:14206740-14206762 GGGGCGCCGGGCCGGGCCCGTGG + Intergenic
1162989213 19:14291556-14291578 GTGGGGGCGGGCAGGGGCCCTGG - Intergenic
1163368422 19:16888940-16888962 GTGGCGCCTCCCAGGGACCCAGG - Exonic
1163427004 19:17245504-17245526 GTCCCGCCGCCCTGGGGCCCCGG + Exonic
1163586917 19:18169261-18169283 CAGGCGGCGGGCCGGGGCCCGGG - Exonic
1163715138 19:18868954-18868976 GTCGCGCCGCGGCCGGGCCAGGG + Exonic
1163725161 19:18919200-18919222 GTGCGGCCGCGCAGGGGCGCGGG - Intronic
1163824537 19:19515644-19515666 GTGGCCCCGGGGCGGGGTCCCGG - Exonic
1164977093 19:32581415-32581437 TGGGCGCCTCCCCGGGGCCCCGG + Intronic
1165349734 19:35269184-35269206 GTGCCCCCGCGCCCCGGCCCCGG + Intronic
1165454023 19:35900480-35900502 CTGGCGCAGCGCCGAGGCCGCGG - Exonic
1165838529 19:38773455-38773477 TTGGCCCCGCCCCGGGCCCCTGG + Intronic
1165841030 19:38789242-38789264 TTGGCCCCGCCCCGGGCCCCTGG - Intronic
1166694417 19:44844675-44844697 GTGAGGCCGCGCCGGGGGGCGGG - Intergenic
1166994005 19:46710703-46710725 GTGGGGCTGGGCCGGGGCTCAGG - Intronic
1167145738 19:47680154-47680176 GTGGCGACGAGCCGAGGCCTGGG - Exonic
1167229347 19:48271858-48271880 GCGGGACCGGGCCGGGGCCCAGG + Intronic
1168721775 19:58558401-58558423 CTGCCGCCGCCGCGGGGCCCGGG + Exonic
927542742 2:23927212-23927234 CTGACGCCGCGCCGGGGGCGGGG - Intergenic
927667450 2:25042326-25042348 AGGGCTCCGCGCCCGGGCCCGGG + Intronic
930700864 2:54456818-54456840 GCCGCGCCGCGCCGGGGCTGGGG - Intronic
933858546 2:86441817-86441839 GTCACGCGGCGCTGGGGCCCGGG + Intronic
934816171 2:97328199-97328221 GTGGCTCCTCCCCGGTGCCCAGG + Intergenic
934821525 2:97380285-97380307 GTGGCTCCTCCCCGGTGCCCAGG - Intergenic
934993155 2:98935780-98935802 GTGGCGCCTCTCCGGGTCCGAGG + Intronic
935361709 2:102251124-102251146 GTGGCGCCGAGCGGGCGCCGGGG + Intergenic
936512127 2:113157242-113157264 GTGGCGCCGGGCTGGGCCGCCGG - Intergenic
937957224 2:127428189-127428211 GTGGCTCCGCGCCAGTGCCTGGG + Intronic
938053953 2:128199409-128199431 GAGGCACCGCGCCTGGCCCCAGG - Intergenic
938406324 2:131035104-131035126 GCGGGGCCGCGCCGGGGCTGCGG - Intronic
939629830 2:144517487-144517509 GGGGAGCCGGGCCAGGGCCCCGG + Intronic
940316833 2:152335580-152335602 TCGGCGGCGCGCCGGGGCCGGGG - Exonic
941104906 2:161341153-161341175 GCGGGACGGCGCCGGGGCCCCGG + Intronic
942044855 2:172094533-172094555 GTGCAGCCGGGCCGGGCCCCGGG + Intergenic
944413587 2:199463526-199463548 GGGGCTCCGGGCCGGGACCCGGG - Intronic
947549648 2:231037424-231037446 GAGGCCCCGCCCGGGGGCCCGGG + Intergenic
947800881 2:232928034-232928056 CGGGGGCCACGCCGGGGCCCTGG + Intronic
948801506 2:240435528-240435550 GGGGCGCGGCGCGGGGGCGCGGG - Intergenic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948953975 2:241272832-241272854 GAGGCGCGGCGCCCGGGCCCCGG + Exonic
949040511 2:241846501-241846523 GTGGCGCCTCTTCGGGGCCCGGG + Intergenic
1168795905 20:610083-610105 GAGGCGGCGCGGCGCGGCCCGGG - Exonic
1169488420 20:6052444-6052466 GCCGCGCTGCGCTGGGGCCCGGG - Exonic
1171430729 20:25081897-25081919 GTCGCGCCGTGCCCGGGCCCGGG - Exonic
1172640226 20:36436275-36436297 CTGGCGCCGCGCCGCGGTCTTGG - Exonic
1172892715 20:38278293-38278315 GTGGCGCCACGGAGGGGGCCGGG + Intronic
1173660119 20:44727352-44727374 GTGGCCCTGTGCCTGGGCCCTGG + Exonic
1173725408 20:45293725-45293747 GTGGTGCCGCGCCCCAGCCCGGG + Exonic
1174126669 20:48311627-48311649 GTTGGGCCGCTCAGGGGCCCTGG + Intergenic
1175913119 20:62413991-62414013 GTGGGGCCGGGCCCGGGGCCAGG - Exonic
1176016906 20:62938425-62938447 GCCGCCCCGCGCCGGTGCCCAGG + Intronic
1176380801 21:6111332-6111354 CGGGCGCCGGGCCGGGGCTCGGG + Intronic
1176547582 21:8208378-8208400 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1176547941 21:8209436-8209458 GTGGGGCCGGGGCGGGGCGCGGG - Intergenic
1176566533 21:8391425-8391447 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1176574409 21:8435612-8435634 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1176611021 21:8986904-8986926 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1178916739 21:36709190-36709212 GCCGAGCCGCGCCGGGCCCCTGG + Exonic
1179742671 21:43426908-43426930 CGGGCGCCGGGCCGGGGCTCGGG - Intronic
1180096032 21:45555573-45555595 GTGGCCCCGCGCGGGGGCTAAGG + Intergenic
1180235928 21:46459291-46459313 GAGGGGCCGCGCGGGGGTCCCGG - Intronic
1180260034 21:46662445-46662467 GTGGCCCCGCGAGGGGACCCCGG + Intronic
1180871412 22:19149224-19149246 GTGGCGCGCAGCCGCGGCCCGGG - Intronic
1181082836 22:20425738-20425760 GCGGCCCCGCGCTCGGGCCCTGG + Exonic
1181083626 22:20429368-20429390 GCGGGGCCGGGGCGGGGCCCAGG + Intronic
1181175515 22:21032615-21032637 GTGGGGCCGCGCGGGGGGCCTGG - Intronic
1182903848 22:33920440-33920462 CCGCCGCCGCGCCGGAGCCCGGG - Intronic
1183429665 22:37757935-37757957 GAGGGGCCGCGCCGGGGCCTGGG + Exonic
1183605967 22:38866863-38866885 GGGGCGCCGGGCAGGGGGCCGGG - Exonic
1183702251 22:39457320-39457342 GAGCGGCCGCGCCGGGTCCCCGG + Intergenic
1184046769 22:41976901-41976923 GGGGCGGCGCGGCGGGGCCGCGG + Exonic
1185037930 22:48489457-48489479 CCGCCGCCGCGCCCGGGCCCCGG - Exonic
1185122761 22:48982396-48982418 GTCGGGCCTCGCCGGGGCACTGG - Intergenic
1185259605 22:49854078-49854100 TCTGCGCCGCGCCGGGGCCAGGG + Intronic
1185385637 22:50530282-50530304 GCGGCGCAGCGCTGGGGTCCCGG + Intronic
1203252455 22_KI270733v1_random:124663-124685 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1203260512 22_KI270733v1_random:169749-169771 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
949993782 3:9600849-9600871 GTGGCGCCACGGCGGGCCCGGGG + Intergenic
952816450 3:37451971-37451993 GGGGCGCCCCGGCGGGTCCCAGG + Intergenic
952883138 3:37997894-37997916 GTGGCGCCCTGCCAGGGCCAGGG + Intronic
952942410 3:38454463-38454485 GTGGTGCGGCGACGAGGCCCCGG - Intronic
953909236 3:46883397-46883419 TGGGCCCCGCGCCGGGCCCCGGG + Exonic
960884989 3:122384374-122384396 ATGGAGCCACTCCGGGGCCCAGG - Intronic
961222710 3:125212737-125212759 GTGGCGGCGGGGCGGGGACCGGG - Intronic
961259798 3:125593138-125593160 GTGGGGCGCCGCCGCGGCCCTGG - Intronic
961585117 3:127915661-127915683 GTGGCCCCGGGTCGGCGCCCAGG - Intronic
966181902 3:177196555-177196577 GGGTCGCCGCGCCCGGGCCGGGG + Intronic
966874520 3:184314761-184314783 GCGCCGCCGCCCCGGCGCCCTGG + Intronic
967685356 3:192410155-192410177 GTGGGGCCGAGCTGGGGGCCGGG + Intronic
967924141 3:194633231-194633253 GCGGCGCGGGGCCGGGGACCTGG + Exonic
968603248 4:1520298-1520320 GTGGGGCTGCGCCACGGCCCCGG + Intergenic
968775150 4:2536080-2536102 GGGGCGGCGCGGCGCGGCCCTGG - Intronic
969053263 4:4387075-4387097 GCGGCGCCGCGCGCGGACCCGGG - Exonic
969559728 4:7939471-7939493 GTGGGCCCGCGCGGGGGTCCCGG - Exonic
970637052 4:18021447-18021469 GCGGCGCGGCGCGGCGGCCCCGG - Intronic
973613725 4:52659459-52659481 GAGGCGGCGCGGCGGGGCCCGGG - Intergenic
977960241 4:103076605-103076627 GCGGTGCCGCTCCGAGGCCCCGG - Exonic
981550545 4:145937565-145937587 GAGGGGGCGCGCCGGGGCGCGGG - Intronic
981688515 4:147481252-147481274 CCGCCGCCGCGCCGGAGCCCGGG + Exonic
982745595 4:159102630-159102652 CTGGCGCCACGCCGCCGCCCAGG - Intergenic
985273816 4:188218932-188218954 GTGGGGCCGCTCGGTGGCCCCGG + Intergenic
985573416 5:662672-662694 GTGGAGCCGCGCTGGGGCCAGGG + Exonic
985685599 5:1280029-1280051 TTGGCGCCGTGCCATGGCCCTGG + Intronic
986330816 5:6714633-6714655 GGGCCGCGGCGCCTGGGCCCCGG - Exonic
990581977 5:57174155-57174177 GTGCCGCCGCGCCTGATCCCGGG - Intronic
992627532 5:78648823-78648845 GCGGCGCGGGGCCGGGGCCTGGG - Exonic
995047919 5:107671153-107671175 GTGGCGCAGTGCGAGGGCCCCGG - Intergenic
998095821 5:139395007-139395029 CTGGCGCCGCGCGGGGGCCGTGG + Exonic
1000014580 5:157266130-157266152 AGGGCCCCGCGCCGGGGCGCAGG - Exonic
1000302927 5:159972219-159972241 GCGGTGGCGCGCCGCGGCCCAGG - Exonic
1002170328 5:177371062-177371084 GCGGGGCCGGGCCGGGGCCGGGG + Intronic
1002259186 5:177982324-177982346 GTGTCGCCAGGGCGGGGCCCTGG - Intergenic
1002524416 5:179807180-179807202 GGGGCGGCGCTCCGGGACCCCGG + Intronic
1002526145 5:179817080-179817102 CCGGAGCCGCGCCGGGGGCCGGG + Intronic
1002925809 6:1605105-1605127 GCGGCGCCGGGCCGGAGACCTGG + Intergenic
1002926775 6:1609700-1609722 CGGGCGCAGGGCCGGGGCCCGGG + Intergenic
1003049342 6:2765781-2765803 GTCGCACCGCGCCGGGGAGCGGG + Exonic
1004043953 6:12009173-12009195 CTGGCGCGGCCCCGCGGCCCCGG - Intronic
1004614882 6:17280825-17280847 GCGGCGCGGCGCTGGGGCTCGGG - Intergenic
1004614958 6:17281079-17281101 GGGGCGCGGCGGCGGGGCCAGGG - Intergenic
1006366919 6:33621418-33621440 GAGGCGGCTCGGCGGGGCCCGGG - Exonic
1006634535 6:35452533-35452555 GTGTCGCCATGCCGGGGCACGGG - Exonic
1006834130 6:36986374-36986396 GTGGCGGGCAGCCGGGGCCCCGG + Intergenic
1007154061 6:39725206-39725228 GCCCCGCCGCGCCGGCGCCCCGG + Intronic
1007473365 6:42104685-42104707 GGGGAGCCGCACCGAGGCCCAGG - Exonic
1008932518 6:56955079-56955101 GGGGCGCCGCGGCGGGGGCTCGG + Intergenic
1010244817 6:73653548-73653570 GCGGAGCCGAGCCGGGGCCTCGG - Intronic
1012410149 6:98947733-98947755 TTGGCGCCGGGGCGGGGCCGGGG - Intronic
1017913931 6:158818337-158818359 GCGGGGCCGGGCCGGGCCCCCGG + Intronic
1018686275 6:166307284-166307306 GCGGGGCCGGGCGGGGGCCCTGG - Exonic
1019279277 7:192182-192204 GGAGCGCGGGGCCGGGGCCCAGG - Intergenic
1019417281 7:933572-933594 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019417334 7:933722-933744 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019417365 7:933812-933834 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019417375 7:933842-933864 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019417406 7:933932-933954 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019417438 7:934022-934044 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019417477 7:934142-934164 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019417509 7:934232-934254 GTGGTGCAGAGCCGGGGACCGGG + Intronic
1019473398 7:1232970-1232992 GTGGCGGGGCGCGGGGGCGCGGG - Exonic
1019519963 7:1456134-1456156 GAGCCGCCGCGCCTGGCCCCTGG - Intronic
1019542504 7:1557933-1557955 GTGGCTCTGGGCCCGGGCCCGGG - Intronic
1019765099 7:2844178-2844200 GCCGCGCCCCGCCGGCGCCCGGG + Exonic
1020105492 7:5420586-5420608 CTCGCGCCGAGCCGGGTCCCTGG - Intronic
1020260178 7:6526589-6526611 GGGGCGGCGCGGCGGGGCGCTGG + Exonic
1021653660 7:22854376-22854398 GCGGCGCCGAGCCGAGGCCTCGG - Intergenic
1021716942 7:23469623-23469645 CCGGCGCCCCGCCCGGGCCCAGG - Intronic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1022363440 7:29685313-29685335 GGGGCGCCGGGCGGCGGCCCTGG - Intergenic
1022697934 7:32728425-32728447 GGGGCGCCGAGCGGCGGCCCTGG + Intergenic
1023940377 7:44765503-44765525 AGGGGGCAGCGCCGGGGCCCAGG - Exonic
1024043806 7:45574426-45574448 GCGGCGAGGCGCCGGGGCGCGGG - Intronic
1024521138 7:50304770-50304792 GATGCGCCGCGCGGGGACCCAGG - Intronic
1026850368 7:73719734-73719756 GTGGGGCGGGGCCGGGGTCCCGG - Intergenic
1027421114 7:78019381-78019403 CCGCCGTCGCGCCGGGGCCCTGG - Exonic
1027592538 7:80134700-80134722 GTGGCGCGGCGCCGGGGTCCGGG + Intronic
1029495888 7:100895404-100895426 GGGGCGCTGCGCAGGGGCGCTGG + Intronic
1031008402 7:116499588-116499610 GGGGCGCCGGGGCGGGGCTCGGG + Exonic
1031966595 7:128031795-128031817 CCGGCGGCGCGCCGGGGGCCGGG - Intronic
1032174566 7:129612320-129612342 GTGGGGCCGGGCTGGGGCGCGGG + Intronic
1033477214 7:141702263-141702285 GCGCCTCCGCGGCGGGGCCCCGG - Intergenic
1034342804 7:150368948-150368970 GTGGCCCCGCGCCCCTGCCCCGG - Intronic
1034347673 7:150397258-150397280 GTGGGGCCAGCCCGGGGCCCGGG + Exonic
1034349161 7:150405328-150405350 GCGGGGCCGCGCTGGGGCCGCGG + Intronic
1034483609 7:151341980-151342002 GTGGAGCTGGGCCGGGGCCGGGG + Intronic
1035181195 7:157090672-157090694 GGGGCGCCTGGCCTGGGCCCTGG + Intergenic
1035637361 8:1156629-1156651 GGGGCGCTGAGCCGGGGCGCTGG - Intergenic
1035664850 8:1373335-1373357 GAGGCGCCGCGCCTGGACCGTGG + Intergenic
1036938853 8:13031999-13032021 GTGGCGCCGAGCCTGAGCACTGG + Intergenic
1039212688 8:35235335-35235357 GCGGCGCTGGGCTGGGGCCCGGG - Intergenic
1043401817 8:79891809-79891831 GTGGCTGCGAGCCGGGGCGCAGG + Intergenic
1046131577 8:109974145-109974167 CTACCGCCGCCCCGGGGCCCTGG - Exonic
1049109749 8:140635508-140635530 GTGGCGCCGCCGAGGGGCTCCGG + Exonic
1049419567 8:142510812-142510834 GGGGCGGCGGGCCGGGGCCGGGG + Intronic
1049419573 8:142510829-142510851 GCGGCTCCGCGCCCCGGCCCCGG - Intronic
1049419663 8:142511100-142511122 GGGGCGCCGGGCAGGGGCGCGGG + Intronic
1049419821 8:142511558-142511580 GTGGCCCCAGGCAGGGGCCCTGG + Intronic
1049423917 8:142528872-142528894 GTGGGGCCGGGCCTGGGCACAGG + Intronic
1049585278 8:143430102-143430124 GGGCCGCCGAGCGGGGGCCCCGG - Exonic
1051096977 9:13477435-13477457 GTGGAGCCAGGCTGGGGCCCTGG + Intergenic
1052821076 9:33138239-33138261 GTGGAGCTGGACCGGGGCCCAGG - Intronic
1053306209 9:36986345-36986367 GCGCGGCCGCGGCGGGGCCCGGG - Intronic
1054905911 9:70413590-70413612 GCGGCGGCGCGGCGGAGCCCGGG - Exonic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1060478056 9:124000010-124000032 GGGGAGGGGCGCCGGGGCCCGGG - Intergenic
1060544758 9:124453381-124453403 GAGGCGGCGCGCTGGGGCGCGGG + Exonic
1060643964 9:125262158-125262180 GTGGCGGCGCGCAGGAGCCAGGG + Intronic
1060897128 9:127225179-127225201 GCGGCGCCGGGGCGGGGCCTGGG + Intronic
1061304956 9:129726791-129726813 GTGGGGCCGCTGCAGGGCCCTGG + Intergenic
1061610075 9:131740131-131740153 GTGGCGGCGCGGCGGGCGCCCGG - Intergenic
1061725615 9:132580541-132580563 GTGGCCCCGCGCCCGGCTCCCGG - Intergenic
1061727394 9:132589348-132589370 AGAGCGCCGCGCCGGGGTCCAGG - Exonic
1061727400 9:132589378-132589400 GCGGCGGCGCGCTGGGGCCGCGG - Exonic
1062230515 9:135479574-135479596 CTGCCGCCGCGCCCGCGCCCCGG - Intronic
1062653491 9:137590305-137590327 GAGGCGCCGAGCGGGGGCCGGGG + Exonic
1062729442 9:138100950-138100972 GTGGCACCTCGCCGGGGTACTGG - Intronic
1203759079 EBV:2700-2722 TTGGCGCCGGGCCGCCGCCCTGG - Intergenic
1203468860 Un_GL000220v1:107814-107836 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1203476681 Un_GL000220v1:151786-151808 GTGGCGCCCCGCGTGGGGCCCGG + Intergenic
1186496550 X:10015905-10015927 GTGGCGCCGGCCGGCGGCCCGGG - Intronic
1195278912 X:103310726-103310748 GCGGTCCCGCGGCGGGGCCCCGG + Exonic
1200115353 X:153767568-153767590 GTTCCGCCGCCGCGGGGCCCGGG + Exonic
1200157045 X:153982383-153982405 GTGGCGCCGTGCCGCGGTGCTGG + Exonic