ID: 914661603

View in Genome Browser
Species Human (GRCh38)
Location 1:149794531-149794553
Sequence GGGGAAGTACAGATAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 3, 1: 0, 2: 3, 3: 83, 4: 450}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914661603 Original CRISPR GGGGAAGTACAGATAGAAAA AGG Intronic
901004628 1:6165842-6165864 GGGGAAGTGGAGATAGGACAGGG - Intronic
901902266 1:12375493-12375515 AGGGAAGTACAAATAGGGAAAGG - Intronic
901914101 1:12484729-12484751 GGGAAAGTACAGATAAAAGCTGG + Intronic
902420360 1:16274397-16274419 GGGGTTGTACAGACAGGAAAGGG + Intronic
903495069 1:23760435-23760457 GGGGAAGGAAAGATAGGGAAGGG - Exonic
903801149 1:25969306-25969328 GAGGAAGAACAGCTAGGAAAGGG - Intronic
905383412 1:37581067-37581089 GGGGAAGTACATACAGAGAGAGG + Intronic
905765180 1:40594768-40594790 GGGGAAGGACAGGGAGAAACAGG - Intergenic
907229564 1:52983509-52983531 TGTGAAGAACAGAGAGAAAAGGG - Intronic
909544085 1:76824605-76824627 GAGGAGCTACAGAAAGAAAAAGG - Intergenic
910313103 1:85850026-85850048 AAGGAAATACAGAGAGAAAAAGG + Intronic
910599640 1:89017432-89017454 GGGGAAAAACAGACAGTAAAAGG + Intronic
910749535 1:90613745-90613767 AGGGAAGTTGAGATAGAGAAGGG + Intergenic
911225917 1:95305502-95305524 GGAGGAGTACAGAAAGAAAACGG + Intergenic
911232302 1:95374093-95374115 GGGAAAGTACTGAAAGAAAGTGG + Intergenic
911263430 1:95714998-95715020 ATGGAACTGCAGATAGAAAAAGG + Intergenic
911523769 1:98960125-98960147 GGGGAAGTTAAGAGAGAATATGG - Intronic
913671348 1:121099169-121099191 GGGGAAGTACAGATAGAAAAAGG + Intergenic
913943449 1:125133073-125133095 TGGGAAGTATAGATAAGAAATGG + Intergenic
913955769 1:143290671-143290693 TGGGAAGTATAGATAGGAAATGG - Intergenic
913981663 1:143524770-143524792 TGGGAAGTATAGATAGGAAATGG + Intergenic
914023117 1:143886589-143886611 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914076036 1:144351426-144351448 TGGGAAGTATAGATAGGAAATGG + Intergenic
914103142 1:144615070-144615092 TGGGAAGTATAGATAGGAAATGG - Intergenic
914661603 1:149794531-149794553 GGGGAAGTACAGATAGAAAAAGG + Intronic
914808967 1:151012649-151012671 GGAGAAGTAAAGAAAGAAGATGG + Intronic
915108282 1:153547583-153547605 GGGCAAGTCCAGATTGAAAGGGG + Exonic
916843178 1:168621348-168621370 GTGGAAGTTCAGAGAGGAAAGGG + Intergenic
917355484 1:174122736-174122758 GGGGAAGTAGAGATGGTTAATGG + Intergenic
917840970 1:178977492-178977514 GAGGGAGTAGAGACAGAAAAAGG + Intergenic
918444166 1:184600007-184600029 GGGGAAGTCCAAATAAAGAAAGG - Intronic
918616876 1:186554158-186554180 ATTGAAGAACAGATAGAAAAAGG + Intergenic
918703541 1:187635094-187635116 GGGAAATTACAGAGAGAAAGAGG + Intergenic
919392911 1:197010057-197010079 GGTGATGTACATATACAAAAAGG + Intergenic
919516542 1:198532530-198532552 GGGGAGATAAAAATAGAAAATGG + Intronic
920314688 1:205069280-205069302 AGGGAAGCACAGCTAGTAAATGG + Intronic
921099870 1:211919649-211919671 GGGGAAGTAAAGATCTGAAAAGG - Intergenic
921906179 1:220497630-220497652 GGGGAAGTACAGAGCGAAATGGG - Intergenic
922310341 1:224382785-224382807 GAGGAAGAACAGAAAGAAAAAGG + Intergenic
923102997 1:230832012-230832034 GGAGAAGTACAGATAGAGCCTGG - Intergenic
923488920 1:234465501-234465523 GAAGAATAACAGATAGAAAAAGG + Intronic
924076033 1:240338142-240338164 GAGGAAGAACAGAAAGAAAGAGG - Intronic
1063240933 10:4168567-4168589 GGGGAACTACAGGAAGAAACTGG - Intergenic
1063515851 10:6694545-6694567 GAGGAAGGACAGGTAGAAAAGGG - Intergenic
1064725800 10:18278627-18278649 AGGGAAATGGAGATAGAAAACGG + Intronic
1064845129 10:19643759-19643781 GGGAGAGAATAGATAGAAAACGG - Intronic
1065044765 10:21737289-21737311 GAGGAAGTAAAGATAGCATATGG + Intronic
1066778988 10:38922058-38922080 TGGGAAGTATAGATAGGAAATGG + Intergenic
1066952245 10:42131564-42131586 TGGAAAGTATAGATAGGAAATGG - Intergenic
1067257878 10:44661828-44661850 GGGGAAGTGGGGATGGAAAAGGG - Intergenic
1068137674 10:52966176-52966198 GGGGATTTCCAGGTAGAAAAGGG - Intergenic
1068255535 10:54504814-54504836 GAGAGAGTACAGAGAGAAAATGG - Intronic
1069046921 10:63752652-63752674 GCGGAAGTACAATTACAAAATGG - Intergenic
1071125843 10:82333879-82333901 GGAGAAGGAAAGAGAGAAAAAGG + Intronic
1072359620 10:94647024-94647046 TGGGGAGTACAGATAGAATTTGG + Intergenic
1073095164 10:100975068-100975090 GGTGCAGCACAGGTAGAAAATGG + Intronic
1075149354 10:119913059-119913081 GGGGAAGTGAAGATAAAAAGGGG - Intronic
1075292022 10:121238843-121238865 GGGTAAGCAGAGATAGACAAGGG + Intergenic
1075806574 10:125193444-125193466 GGGGAAGCACAGTGAGAAACAGG - Intergenic
1077605828 11:3611303-3611325 GGGGAAGGACAGCTGCAAAAGGG - Intergenic
1077701921 11:4450175-4450197 TGGGAAGAGCAGATAGAAATTGG - Exonic
1077704923 11:4475640-4475662 TGGGAAGAGCAGATAGAAATTGG - Intergenic
1078950022 11:16120119-16120141 GGGGAAGGAGAGAGAGAGAAAGG - Intronic
1079961244 11:26926890-26926912 GAGGAAGTACAGAAAGAGATAGG - Intergenic
1080382061 11:31782301-31782323 GGGGAAAAACAGATGAAAAAGGG - Intronic
1080891096 11:36409816-36409838 GAGGAAGTACAGATACAGAGAGG + Intronic
1081415223 11:42806845-42806867 GAGGAAGAAAATATAGAAAATGG + Intergenic
1081825733 11:46049550-46049572 GGGGAAGGAGGGATAGAAAGAGG + Intronic
1082067389 11:47911685-47911707 GGGAAAGTACAGGGAGAAGAGGG + Intergenic
1082089789 11:48079901-48079923 GAGGAAGCACAGAGTGAAAAGGG + Intronic
1083040670 11:59682251-59682273 GGGGAAGTAGAGAAAGATAAAGG + Intergenic
1083189532 11:61039939-61039961 GGTGATCTTCAGATAGAAAAGGG - Intergenic
1084423765 11:69073275-69073297 GAGGAAGGACAGACAGGAAAAGG - Intronic
1085857563 11:80192759-80192781 AGGTGAGTACAGAGAGAAAAAGG + Intergenic
1086358600 11:86033352-86033374 GGGGAAGAACAGATCACAAAGGG - Intronic
1086557222 11:88125356-88125378 GGGGATCTACAGATAGAGATGGG - Intronic
1086596494 11:88577998-88578020 GGGGAAGTGTATATACAAAACGG + Intronic
1086670822 11:89545119-89545141 TGGTAAGTACAGACAGAAATGGG - Intergenic
1087089679 11:94255712-94255734 TGGGAAGTACAGGGAGACAAAGG + Intergenic
1087882981 11:103440859-103440881 GTGGTAGTACGGATAGTAAAAGG - Intronic
1089402890 11:118174762-118174784 GGCTAAGTAAAGATAGAAAGGGG - Intronic
1090497111 11:127223986-127224008 GGGGAAGTTCAGATCTAAAAGGG + Intergenic
1091473287 12:749351-749373 TGGGAATTTCATATAGAAAATGG - Intergenic
1091530093 12:1346361-1346383 GGAGAAAAACAGATGGAAAAGGG - Intronic
1091888933 12:4037576-4037598 GGAGAAGTAGAGGCAGAAAATGG - Intergenic
1092022122 12:5211357-5211379 GGGAAAGAATAGAAAGAAAAGGG - Intergenic
1092069538 12:5621535-5621557 GGGGAAGGGCAGAGAGGAAATGG + Intronic
1092324203 12:7511886-7511908 TGTGAAGTACAGCTAAAAAATGG + Intergenic
1092943445 12:13431650-13431672 AGGGAAGTACAGAGAGATTAAGG - Intergenic
1093225199 12:16474636-16474658 GGGGAAGGACAGAGGGAGAAAGG - Intronic
1093712350 12:22341401-22341423 GGGGAAAAAAAGAAAGAAAAAGG + Intronic
1094350876 12:29523307-29523329 GAGGATTTACAGACAGAAAAAGG + Intronic
1094463971 12:30730742-30730764 GGGGAAATAAACATGGAAAATGG + Intronic
1095514869 12:42994613-42994635 TGGGAAGTGGGGATAGAAAAGGG + Intergenic
1095535257 12:43238421-43238443 TGGTAACTACAGATAGAAATTGG + Intergenic
1096430590 12:51539753-51539775 AGGCAGGTACAGAGAGAAAATGG - Intergenic
1096693660 12:53335709-53335731 GGGGGGGTAGAGAGAGAAAAGGG + Intronic
1097322208 12:58238351-58238373 GGGGGAGTGAAGAGAGAAAATGG + Intergenic
1098345343 12:69496979-69497001 GAGGAAGCAAAGATATAAAATGG + Intronic
1098745316 12:74230600-74230622 TGGGTAGAACAGAAAGAAAAAGG + Intergenic
1098899232 12:76095750-76095772 AGTGAAGTACAGAAATAAAAGGG + Intergenic
1099276291 12:80580490-80580512 ATTGAATTACAGATAGAAAAAGG - Intronic
1100875897 12:98961060-98961082 GAGGAAGTACAAAGAGAAATAGG + Intronic
1101227250 12:102701616-102701638 GGGGAAGGACAAATAGCAGAAGG + Intergenic
1101503426 12:105325496-105325518 GGGGAAGTAAAGGAAGATAATGG + Intronic
1101599908 12:106200265-106200287 GGGGAAGGACAGCCAGCAAAAGG - Intergenic
1103431558 12:120892047-120892069 AAGGAAGTACAGAAATAAAATGG - Intronic
1105232700 13:18513618-18513640 TGGGAAGTAAAGATAGGAAATGG + Intergenic
1105400986 13:20095885-20095907 AGGGAAGTAGAGTTAAAAAAGGG - Intergenic
1105636811 13:22223608-22223630 GGAGATTTACAGACAGAAAAAGG - Intergenic
1106743000 13:32667150-32667172 AAGGAAGTAAAGATAAAAAATGG - Intronic
1107265352 13:38546639-38546661 GGGGAAATACAAATATAGAAAGG + Intergenic
1107573267 13:41686631-41686653 GGGGAATTACAGATACTGAAAGG - Intronic
1107899838 13:45001197-45001219 GGAGAAGTGCAGAGAGAAAGGGG - Intronic
1108586381 13:51873778-51873800 GGGGAAGTACAGGTAGAAGAGGG - Intergenic
1109530424 13:63636414-63636436 GGGGAGGTACAGACAGAAGACGG + Intergenic
1109627162 13:64990985-64991007 GTGGAAATACAGACAGATAAAGG - Intergenic
1110620904 13:77594365-77594387 TGGAAACTACAGAGAGAAAATGG - Intronic
1111189002 13:84783879-84783901 GGGGAAGGAGAGAGAAAAAAGGG + Intergenic
1111582346 13:90239021-90239043 GGGGAAATACAGGAAAAAAAGGG + Intergenic
1111646352 13:91036590-91036612 GGGTAAGGACAGCTAGATAATGG + Intergenic
1112965246 13:105183393-105183415 GGGAAAGTGAAGAAAGAAAAAGG + Intergenic
1114063906 14:19043876-19043898 GGGGAACTAAAGATGGAGAAGGG + Intergenic
1114098352 14:19356120-19356142 GGGGAACTAAAGATGGAGAAGGG - Intergenic
1114683865 14:24509189-24509211 GGGGAAGTAAAGATGTAGAAGGG + Intergenic
1114683967 14:24510273-24510295 GGGGAAGAAGAAAGAGAAAAAGG - Intergenic
1114935371 14:27529872-27529894 GGGGAACTACATTCAGAAAAAGG + Intergenic
1115119612 14:29925415-29925437 AGGGAAGTACAGTTATGAAAAGG - Intronic
1115250642 14:31343052-31343074 AGGCAAGTCCAGATAGAAACTGG + Intronic
1117494192 14:56285526-56285548 GGGAGAGAACAGAAAGAAAAGGG + Intronic
1117871000 14:60199993-60200015 GGGGAGGTAGAGAGAGAGAAAGG + Intergenic
1118465311 14:66025156-66025178 AGGGACGTACAGAGAGAAACTGG + Intergenic
1118875317 14:69779420-69779442 GGGGAAGCACAGGTAGAAATTGG + Intronic
1119892553 14:78193903-78193925 GGTGAGGTACAGAGAGAGAAAGG - Intergenic
1119975418 14:79019477-79019499 GGGTAAGGAGAGAAAGAAAAGGG + Intronic
1119998861 14:79280493-79280515 GGGGAACGATAGATAGAAATAGG - Intronic
1120220438 14:81726086-81726108 GGGAAATAACAGAAAGAAAAGGG - Intergenic
1120232838 14:81858258-81858280 GGAGAAGTACACATATAAATAGG + Intergenic
1120792755 14:88600191-88600213 AGGGCAGTACAGATGGTAAAGGG - Intronic
1121926985 14:97936316-97936338 GGGGAAGGAAACAAAGAAAAGGG - Intronic
1122062502 14:99145893-99145915 AGGGCATTACAGCTAGAAAAGGG + Intergenic
1122752779 14:103951029-103951051 AGGGAAGTAAAGAAAGACAAAGG - Intronic
1202938272 14_KI270725v1_random:114194-114216 TGGGAAGTATAGATAGGAATTGG - Intergenic
1123394923 15:19923698-19923720 TGGGAAGTATAGATAGGAAATGG + Intergenic
1124160324 15:27262415-27262437 AGGGAAGTAGAGATGGAGAAAGG - Intronic
1125086897 15:35740485-35740507 GGGGAAAGACAGGTAGAAAAGGG + Intergenic
1126629122 15:50715613-50715635 GGGGAAGAATGGTTAGAAAAAGG + Intronic
1128440638 15:67705367-67705389 GGGGAAGGACAGAGAACAAAGGG + Intronic
1129584263 15:76847213-76847235 GGGGAAGTGGAGATAGTTAATGG + Intronic
1130389026 15:83438616-83438638 GTAGAAGAACACATAGAAAATGG - Intergenic
1130433137 15:83869257-83869279 GGGGAACTAGAGATAGTAAATGG - Intronic
1131130499 15:89896747-89896769 GGAGAAATACAGCTAGGAAAAGG + Exonic
1131804066 15:96103712-96103734 GGGGAAATGCAGACAGCAAAAGG + Intergenic
1131940618 15:97560841-97560863 GGGGAAGAATAGAGAGAAAGAGG + Intergenic
1132412316 15:101591903-101591925 GGGAAATTACAGTTATAAAAGGG - Intergenic
1133151883 16:3839678-3839700 GGGGAAAGAAAGAAAGAAAAAGG + Intronic
1133797791 16:9060230-9060252 GAGGAAGGAAAGAAAGAAAAAGG + Intergenic
1134691149 16:16191745-16191767 AGGGAAGGAAAGATAGGAAAGGG - Intronic
1135898691 16:26434544-26434566 GGAGAAGTGCATTTAGAAAAAGG - Intergenic
1136459208 16:30399219-30399241 GAGGAAGAATAGATAGAAATAGG + Exonic
1136701020 16:32142117-32142139 TGGGAAGTATAGATAGGAAATGG + Intergenic
1136766638 16:32785341-32785363 TGGGAAGTATAGATAGGAAATGG - Intergenic
1136770335 16:32833030-32833052 TGGGAAGTATAGATAGGAAATGG - Intergenic
1136801459 16:33085037-33085059 TGGGAAGTATAGATAGGAAATGG + Intergenic
1136900258 16:34028959-34028981 TGAGAAGTATAGATAGGAAATGG + Intergenic
1136936457 16:34470925-34470947 TGGGAAGTATAGATAGGAAAAGG - Intergenic
1136945272 16:34643018-34643040 TGGGAAGTATGGATAGGAAATGG + Intergenic
1136948210 16:34682165-34682187 TGGGAAGTATAGATAGGAAATGG + Intergenic
1136955599 16:34782040-34782062 TGGGAAGTATAGATAGGAAATGG + Intergenic
1136963362 16:34877645-34877667 TGGGAAGTATAGATAGGAAAAGG + Intergenic
1136967512 16:34932167-34932189 TGGGAAGTATAGATAGGAAAAGG + Intergenic
1137092508 16:36212122-36212144 TGGGAAGTATAGATAGGAAATGG + Intergenic
1137220694 16:46447440-46447462 TGGGAAGTATCGATAGGAAATGG - Intergenic
1137881616 16:52054829-52054851 GGGGAGGGAGAGAGAGAAAAAGG + Intronic
1139799023 16:69506156-69506178 CTGGAATTACAGATAAAAAATGG + Intergenic
1140837793 16:78811514-78811536 GGGGAAAGAGAGAGAGAAAAAGG - Intronic
1140962258 16:79927651-79927673 GGGGCAGTAGAGACAGAAATGGG - Intergenic
1141352960 16:83316091-83316113 AGAGAAGTGCAGAGAGAAAAGGG + Intronic
1203069030 16_KI270728v1_random:1047594-1047616 TGGGAAGTATAGATAGGAAATGG - Intergenic
1203072756 16_KI270728v1_random:1095137-1095159 TGGGAAGTATAGATAGGAAATGG - Intergenic
1142846880 17:2685667-2685689 GGGGAAATGCTGATAGAAAGTGG + Intergenic
1143166896 17:4901306-4901328 GGGCAATTACGGACAGAAAAGGG + Exonic
1144116644 17:12099989-12100011 GTGGAAGTAAGGATAAAAAAGGG - Intronic
1144223018 17:13116855-13116877 GGGGAAGTGGAGAGAGAATAGGG - Intergenic
1144315989 17:14062048-14062070 TGGGGAGTAAAGATGGAAAAGGG + Intergenic
1145691536 17:26746097-26746119 TGGGAAGTATAGATAGGAAATGG + Intergenic
1145708287 17:26942734-26942756 TGGGAAGTATAGATAGGAAATGG + Intergenic
1147463986 17:40596431-40596453 GGAGATTTACAGACAGAAAAAGG - Intergenic
1148946981 17:51271547-51271569 ACTGAAGTACAGAAAGAAAAAGG - Intronic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1150032418 17:61753549-61753571 GGGAGAGTACAGATTTAAAAGGG + Intronic
1150176005 17:63056786-63056808 GGAGAAATACAGATAAGAAATGG - Intronic
1150307812 17:64101091-64101113 GGAAAAATGCAGATAGAAAAAGG + Intronic
1151929844 17:77225455-77225477 GGAGAAGTACAGAATGAAAGTGG + Intergenic
1203183059 17_KI270729v1_random:83649-83671 TGGGAAGTATAGATAGGAAATGG + Intergenic
1153553089 18:6282916-6282938 AGGGAAGTAAAAAAAGAAAAAGG + Intronic
1154520611 18:15224835-15224857 TGGGAAGTAAAGATAGGAAATGG - Intergenic
1155383738 18:25253767-25253789 GGAGAAATACAGATATAAATTGG + Intronic
1155906455 18:31458050-31458072 GGGGAAGTGGAGAGACAAAAAGG - Intronic
1156266104 18:35489874-35489896 GGGGCAGTCCAGACAGAAGAGGG - Intronic
1156470979 18:37377108-37377130 GGAGAAGGAGAGAGAGAAAAAGG + Intronic
1156675167 18:39519402-39519424 GGGGAAGTACAGAAACAGAAAGG + Intergenic
1157471082 18:47989479-47989501 GGGGAAGTACAGAGAGAGGGAGG + Intergenic
1157938643 18:51901248-51901270 GGAGAAGAAGAGAAAGAAAATGG - Intergenic
1158743200 18:60167221-60167243 GGGGAAGTACAGATGTGAAAGGG - Intergenic
1159185388 18:64965413-64965435 GAGGAAGTAGAGAGAGAGAAAGG - Intergenic
1159461012 18:68722806-68722828 GGGGAATTTCAGATAGAGAAAGG + Intronic
1160493377 18:79356054-79356076 GGGGCAGTCCAGTTAGGAAAAGG + Intronic
1162225476 19:9217855-9217877 GGGGAAGTAAGGAAAGGAAAGGG + Intergenic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1163206845 19:15809618-15809640 AGGGAGGTACAGAGAGATAAAGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164716444 19:30394057-30394079 GGGCACGTGCAGATGGAAAAAGG + Intronic
1165983371 19:39745897-39745919 GCGTAAGTACAGCTAAAAAAAGG - Intergenic
1167110640 19:47458605-47458627 GGGGAAGGAGAGAGAGAAATGGG - Intronic
1167172761 19:47844171-47844193 AGGGAAGGAAAGAAAGAAAAAGG - Intergenic
1167609133 19:50497978-50498000 GGGGAGAGACAGATAGAAATGGG + Intergenic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167811017 19:51830391-51830413 GAGGAAGTAGAGAAAGAAACTGG - Intergenic
1167819274 19:51911210-51911232 GGGGAAAAAAAGAGAGAAAATGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168173526 19:54607075-54607097 GGGGAAATACAGGGAGACAAGGG - Intronic
1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG + Intronic
1202671175 1_KI270709v1_random:54189-54211 TGGGAAGTATAGATAGGAAATGG + Intergenic
1202681531 1_KI270712v1_random:8949-8971 TGGGAAGTATAGATAGGAAATGG + Intergenic
925826867 2:7857915-7857937 GGGGAACTAAACATAGAAAAAGG + Intergenic
926818253 2:16822957-16822979 TGGGAAATACATAAAGAAAAAGG - Intergenic
926848069 2:17163919-17163941 GGGGAAGTAGAGTTAGATCAGGG - Intergenic
927091219 2:19714176-19714198 GGAGAAATACAGATGAAAAACGG + Intergenic
927424613 2:22968259-22968281 GGAGAAGTGCAGATTGAACATGG + Intergenic
929322290 2:40558835-40558857 GGAAAAGTGGAGATAGAAAATGG - Intronic
930294482 2:49537376-49537398 GAGGAAGTACAGAAAGAGATAGG + Intergenic
930878145 2:56243227-56243249 GAGGAGGTACAGAAAGAAACAGG - Intronic
930972271 2:57410031-57410053 GAGGAGGTACAGAAAGAGAAAGG + Intergenic
931601893 2:64012637-64012659 GGGGAATAACTAATAGAAAAAGG - Intronic
933266613 2:80187691-80187713 GAGGAAGAACAGAGAGAAAGAGG + Intronic
933402292 2:81813773-81813795 GGGGATTTATAGAAAGAAAATGG - Intergenic
933573223 2:84037961-84037983 GGGGAAGTAAACATAGAGACCGG + Intergenic
933580972 2:84126439-84126461 GGAGAAGCAAAGATAGGAAAAGG - Intergenic
933942855 2:87259621-87259643 GGGGAAGCACAGAGGGAAAGGGG + Intergenic
934061178 2:88295730-88295752 GAGGATGTACAGTTTGAAAAGGG + Intergenic
934250234 2:90346057-90346079 TGGGAAGTATAGATAGGAAATGG - Intergenic
934259331 2:91457359-91457381 TGGGAAGTATAGATAGGAAATGG + Intergenic
934302624 2:91789241-91789263 TGGGAAGTATAGATAGGAAATGG + Intergenic
934330631 2:92063525-92063547 TGGGAAGTATAGATAGGAAATGG - Intergenic
936337364 2:111601941-111601963 GGGGAAGCACAGAGGGAAAGGGG - Intergenic
936618076 2:114068610-114068632 GGGGAAGTAGTGAGAGAGAAAGG + Intergenic
937637335 2:124170817-124170839 GGGGAAGAACAAATAGACAGAGG + Intronic
938519962 2:132058613-132058635 TGGGAAGTAAAGATAGGAAATGG - Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939139618 2:138338301-138338323 GGGAAAGTACACTTAGAAATGGG - Intergenic
940711622 2:157169425-157169447 TGAAAAGTACAGATAGGAAAAGG - Intergenic
941479243 2:165985339-165985361 GGGGAGGTAAAGTAAGAAAAAGG + Intergenic
941521453 2:166549854-166549876 GGGGAAGTAAGGATGGTAAATGG - Intergenic
942095855 2:172535904-172535926 AGAGAAGTACAGACTGAAAATGG - Intergenic
942726092 2:179009457-179009479 GGGGAAGAATACATAGGAAAAGG - Intronic
943327933 2:186524082-186524104 GGGGAAAAAAAGAAAGAAAAAGG - Intergenic
943387709 2:187223247-187223269 GGAGAAGTACAGAGTGAAATGGG - Intergenic
943666868 2:190618255-190618277 GGGGAAGAACTGATTGACAAAGG - Intergenic
943683382 2:190791487-190791509 GGGGAAAAACAGATTCAAAATGG - Intergenic
945188091 2:207160025-207160047 GGGGAATTTTAGATAGAATAAGG + Intronic
945323208 2:208451253-208451275 GGGGAACTACAGACAGAATCTGG + Intronic
946120443 2:217508215-217508237 GGAGAAGTACAGAACGAAGAGGG + Intronic
946697945 2:222380164-222380186 GGAGAAGTGGAGATAGAAATGGG + Intergenic
946881609 2:224182397-224182419 GGAAGAGTACAGAGAGAAAAGGG + Intergenic
947087302 2:226467648-226467670 GGGTAAGCACTGCTAGAAAAGGG - Intergenic
947340904 2:229138339-229138361 GGTGATGGACAGATAGAAGAGGG - Intronic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
948306370 2:236949974-236949996 GAATAAGTTCAGATAGAAAAAGG + Intergenic
1169104651 20:2984321-2984343 AGTGAAATAAAGATAGAAAAAGG - Intronic
1169779131 20:9290309-9290331 GGGGAAAAAGAGAGAGAAAATGG - Intronic
1169920331 20:10728004-10728026 GGGGAAGCAAAGACAGAAGATGG - Intergenic
1170300903 20:14883488-14883510 GGGGAAGCCCAGAGGGAAAAAGG - Intronic
1170440940 20:16378223-16378245 AGGGAAGTAGAGATGGAAAGAGG + Intronic
1171771725 20:29327238-29327260 GGGGAAGTAGAGAAAGAGAGAGG + Intergenic
1172321763 20:34000372-34000394 GGGGAGGTAGGGACAGAAAAAGG + Intronic
1172899937 20:38327375-38327397 CTGGAAGTAGAGAGAGAAAATGG + Intronic
1173444923 20:43109067-43109089 GGGGAAAAAAAAATAGAAAATGG - Intronic
1173864505 20:46305699-46305721 GGGGAAGAACAGAGAGAGAGAGG + Intronic
1174087788 20:48021419-48021441 GAGGAGGTACAGAAAGAAAGAGG - Intergenic
1174317240 20:49713008-49713030 GGGGAAGTAGAGGAAGAAAGGGG + Intronic
1175696263 20:61105453-61105475 AGGGAAGGAAAGATAGACAATGG + Intergenic
1176585042 21:8574942-8574964 TGGGAAGTATAGATAGGAATTGG + Intergenic
1176776676 21:13141920-13141942 TGGGAAGTAAAGATAGGAAATGG + Intergenic
1177652391 21:23974679-23974701 GGGGAAGTGCAGTTAGTTAATGG + Intergenic
1177750403 21:25275974-25275996 GTGAAATAACAGATAGAAAATGG - Intergenic
1178495671 21:33084061-33084083 GTGGAAGTACACAAAGAAAAAGG - Intergenic
1178565564 21:33681132-33681154 GGGGATGGACAGGTAGGAAAGGG + Intronic
1179511238 21:41875186-41875208 GGGGAGGTGCAGACAGCAAAGGG - Intronic
1180267851 22:10551844-10551866 TGGGAAGTATAGATAGGAATTGG + Intergenic
1180482398 22:15766509-15766531 GGGGAACTAAAGATGGAGAAGGG + Intergenic
1180524642 22:16245240-16245262 TGGGAAGTAAAGATAGGAAATGG + Intergenic
1181671197 22:24426327-24426349 GAGGAAGGACAGACAGAAGATGG + Intronic
1182236879 22:28883400-28883422 GGCGGAGCACAGATAGAAACAGG + Intergenic
1185290028 22:50019269-50019291 AGGCAAGAACAGAGAGAAAAAGG + Intronic
1203236880 22_KI270732v1_random:12135-12157 TGGGAAGTATAGATAGGAAATGG + Intergenic
1203323719 22_KI270737v1_random:95610-95632 TGGGAAGTATAGATAGGAAATGG - Intergenic
949652110 3:6171644-6171666 AGGGAAGAAAAGAAAGAAAAAGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
950890847 3:16402398-16402420 GGGGAAGTAAAGGCAGAAAATGG - Intronic
951363853 3:21756594-21756616 TAGGAAGTATAGATTGAAAAAGG + Intronic
951414518 3:22407813-22407835 GGGGAATGCCAGAGAGAAAAAGG - Intergenic
951496880 3:23338617-23338639 GGGGAAGTACAGGATGAAAGTGG + Intronic
951797719 3:26559625-26559647 TGAAAAGTACAGATATAAAAAGG + Intergenic
952536521 3:34316200-34316222 TGGGAATTACAGTTAGAAAAAGG - Intergenic
952777523 3:37060602-37060624 GTGGAAGTACAAAAAAAAAAAGG - Intronic
953467148 3:43132169-43132191 GTGGAAGAAGAGATAGAAAATGG + Intergenic
953962144 3:47274361-47274383 GGGGAAGAACAGATAGGAGCCGG - Intronic
954728017 3:52632591-52632613 TGGGAGGTATGGATAGAAAATGG + Intronic
955060175 3:55486938-55486960 GGGGAAGTAAAGAAAAAAAGTGG + Intronic
955331943 3:58054576-58054598 GGAGAAGTGCAGAGAGAAGAGGG + Intronic
957033045 3:75265261-75265283 GGGTAAGTATAGATAATAAAGGG + Intergenic
957084469 3:75667750-75667772 AGGGAAGGACAGAGAGAGAAAGG + Intergenic
957380033 3:79415849-79415871 GGTGAATTACACATAGAAAGTGG + Intronic
958684356 3:97374074-97374096 TAGGAAGTACTGATAGAAACAGG - Intronic
959239799 3:103775724-103775746 GGAGAAGTATACATAAAAAAAGG + Intergenic
959685832 3:109145178-109145200 GTGTAAGGACAGATAGTAAAAGG - Intergenic
959795644 3:110425211-110425233 GGGGAAATATAGAAAGAATAAGG - Intergenic
959827588 3:110817657-110817679 GGGGAAGTAGAGATAGTTAATGG - Intergenic
960016802 3:112900191-112900213 TGGGAAGTATCCATAGAAAAAGG + Intergenic
960127468 3:114015991-114016013 TGGGAAGAACAGAAAGAAAAGGG + Intronic
960529134 3:118743679-118743701 AGGAGAGTACAGATAGAACATGG + Intergenic
960668782 3:120136626-120136648 GGGGAGGTAGAGATGGATAATGG + Intergenic
960959533 3:123060258-123060280 GAGGAAGGAGAGAAAGAAAAGGG - Intergenic
961018904 3:123487641-123487663 GAGGAAGTACAGAGAGAGAGAGG + Intergenic
961643460 3:128379719-128379741 AAGGAAGTACAGAAACAAAAGGG + Intronic
962393979 3:134998856-134998878 GAGAAAGTAGAGAGAGAAAAAGG + Intronic
962418153 3:135202444-135202466 GGGGCAGTAGAGATGGAAAGAGG - Intronic
962887605 3:139642056-139642078 GGGAAAGAAGAGACAGAAAAGGG - Intronic
962964950 3:140344921-140344943 GGAGAAGCACAGAAAGAAATGGG + Intronic
963595437 3:147318996-147319018 GGGGAAGTTGAGAGAGGAAAAGG - Intergenic
963611136 3:147470552-147470574 GGTGAATTCCAGATAGAAACTGG - Intronic
964405366 3:156343071-156343093 TGGGAAGTAGAGATTGAATAAGG - Intronic
965403215 3:168238386-168238408 GGAGTAGCACAGATAGAAATGGG + Intergenic
966619981 3:181953070-181953092 GGGTAAGAACAGATAGCACAGGG + Intergenic
967425238 3:189319370-189319392 GGAGAGGTACAGATTGGAAATGG - Intronic
967476581 3:189928275-189928297 GTTGAAGGACAGAAAGAAAATGG - Intergenic
969253559 4:5987696-5987718 AGAGAAATAGAGATAGAAAATGG + Intronic
971467768 4:26982866-26982888 AGTGAAGTACAAATAGAAAAAGG - Intronic
972996646 4:44887387-44887409 GGGAAAGTAGAGATAGTTAATGG - Intergenic
973103586 4:46302737-46302759 GGAGAAGAACAGGTGGAAAAAGG - Intronic
973636374 4:52865014-52865036 GGGGAAGTAAAGATAGGAGCTGG - Intronic
973758730 4:54098955-54098977 GGGGAAATGAAGAGAGAAAATGG + Intronic
974203604 4:58670856-58670878 AGAGAAGTACAGATAGAAGATGG - Intergenic
974482009 4:62457212-62457234 AGGGAAGAAAAGAAAGAAAAAGG + Intergenic
975210395 4:71692992-71693014 AGTGAAGAACAGAAAGAAAAGGG + Intergenic
976648947 4:87414924-87414946 GGGGAAGAACAGATATGAATAGG + Intergenic
976813572 4:89122131-89122153 GGGGAAGGAGAGAAAAAAAAAGG - Intergenic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977312471 4:95404640-95404662 AGGGAAATACAGATACAAGAGGG + Intronic
977748186 4:100576799-100576821 GGGGTAGTATAGACAGACAATGG + Intronic
977753530 4:100636989-100637011 GAGGAGGTACAGAAAGAAATAGG + Intronic
977822110 4:101485220-101485242 GGGAAAGAACAGAAAGAGAAAGG + Intronic
978002367 4:103572174-103572196 GGGGAAGTACAGCCAGCAAAGGG + Intergenic
980556038 4:134406873-134406895 GGGGAAGAAGAGATAGAAATAGG + Intergenic
982456467 4:155615440-155615462 GGGAAAATAAAAATAGAAAAAGG - Intergenic
982961256 4:161840244-161840266 TGGGAAGTAAAGAGTGAAAAGGG + Intronic
983455409 4:167956620-167956642 AGTGAAGTACATACAGAAAATGG - Intergenic
983548425 4:168988485-168988507 GGGGAAGTACAGGTAGCCAAAGG + Exonic
983580173 4:169301646-169301668 GGGGAAGTGGAGATAGTTAATGG + Intergenic
983664253 4:170164907-170164929 GGGGAAAAAAAAATAGAAAATGG - Intergenic
984239246 4:177197883-177197905 GGGGAGGTAGAGATAGTTAATGG - Intergenic
984450315 4:179892388-179892410 ATGGAAATACAGCTAGAAAATGG + Intergenic
986020949 5:3802083-3802105 GGGGAATGACAAATACAAAAGGG + Intergenic
986526366 5:8682637-8682659 GGGAAAGCACAGAGAGAAGATGG + Intergenic
987305218 5:16631098-16631120 TGGGAAGTAGAGACAGAGAAAGG + Intergenic
987397344 5:17437114-17437136 GGGGAAGAACAGATGAAAAGTGG + Intergenic
987497109 5:18660275-18660297 AGAGATATACAGATAGAAAATGG - Intergenic
987508831 5:18808892-18808914 GAGGAAGCAGAGATAGAAGAAGG - Intergenic
988209125 5:28179894-28179916 GGGGAAGGAAAGATAGGAAGAGG - Intergenic
988213092 5:28233757-28233779 GGTGAAGAATAGATTGAAAAGGG - Intergenic
988737490 5:34037323-34037345 AGGGAAGAAGAGAAAGAAAAAGG + Intronic
989361060 5:40601701-40601723 GAGGAACTACAGAAAGACAAAGG + Intergenic
989795618 5:45467671-45467693 GGGGAAGTAGAAAGAGAGAATGG - Intronic
990235288 5:53760648-53760670 GGGAAGTTACAGACAGAAAAGGG + Intergenic
990484799 5:56247590-56247612 GGGAAATTACAGAAACAAAATGG + Intergenic
991272548 5:64802271-64802293 GGGGAACTGCATATACAAAATGG + Intronic
991564810 5:67993896-67993918 GGAGAAGAACAGGTGGAAAAAGG - Intergenic
992750720 5:79858016-79858038 GGGGAAATAAAGTTATAAAAAGG - Intergenic
993015272 5:82528335-82528357 GGAGAAGTGCAGATTGAAGAGGG + Intergenic
993766358 5:91863595-91863617 GAGTAAGGATAGATAGAAAAGGG + Intergenic
995050347 5:107696364-107696386 GGGGGAGTGAAGAGAGAAAAAGG + Intergenic
995573514 5:113506136-113506158 TGGGAGGTACAGAAATAAAATGG - Intergenic
995974282 5:118012477-118012499 GGGGAAGGACTGACTGAAAACGG - Intergenic
996485297 5:124026684-124026706 GGGGAAGAAAAGAAAAAAAAGGG + Intergenic
996881904 5:128307555-128307577 AGAGAAGTACAAATTGAAAAAGG + Intronic
998120738 5:139574869-139574891 GGGGAAGATTAGATAGAAGAGGG + Intronic
998127013 5:139631062-139631084 AGGAAAGTAAAGAAAGAAAAAGG - Intergenic
998127666 5:139635423-139635445 GGGGAAGGACAGACAGACACTGG - Intergenic
998427383 5:142040417-142040439 GGGAAAGTACATATACTAAACGG - Intergenic
999448517 5:151660640-151660662 GGAGAAGGACAGATAGAAGGAGG + Intergenic
999560954 5:152802271-152802293 GTGGAATTATAAATAGAAAAAGG + Intergenic
999665052 5:153904273-153904295 GGGGAAGTGAAGAAAGGAAAAGG - Intergenic
999717699 5:154375102-154375124 GGGGAAACACAGCTAGAAGAAGG + Intronic
1001311140 5:170611810-170611832 TGGGAAGGACAGAGAGAGAAGGG + Intronic
1001714697 5:173805730-173805752 GAGTACGTACAGATAGAAAAGGG - Intergenic
1002715626 5:181224816-181224838 AGAGAAGTACAGAGAGAAGATGG + Intronic
1003064077 6:2887912-2887934 AGTGAAGTACACTTAGAAAAGGG - Exonic
1003342483 6:5235074-5235096 GGGGAAGTAATGATGGAAAGGGG - Intronic
1004202775 6:13564992-13565014 GGGGATGAAGAGATAGAGAATGG - Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006470092 6:34223851-34223873 GGGGAAGCACACAGAGGAAAGGG - Intergenic
1006963910 6:37962394-37962416 GGGGAGGTAGAGATAGAGATAGG + Intronic
1007169665 6:39853689-39853711 GGGGAAGTAAAGGCAGAAAGAGG + Intronic
1007699654 6:43759187-43759209 AGGGAAGGACACATAGAAAAAGG + Intergenic
1007908493 6:45488713-45488735 GGAGAAGTTCAGCTAGAGAAGGG + Intronic
1007974855 6:46091012-46091034 GAGGATTTACAGACAGAAAAAGG - Intergenic
1008058198 6:46967135-46967157 GGGGAAGAACAGATACTTAAAGG + Intergenic
1009717111 6:67412109-67412131 GGGCTAATAAAGATAGAAAAAGG - Intergenic
1010289041 6:74114588-74114610 GGGCAAGTAGAAATAGAAACGGG + Intergenic
1010577532 6:77550834-77550856 GGGGAAGGAAAAATGGAAAAGGG + Intergenic
1010941069 6:81918273-81918295 GAGGGAGTAGAGATAGAAGAGGG - Intergenic
1011532163 6:88334607-88334629 GGGGAAGTAGAGATGGTTAATGG + Intergenic
1011854092 6:91666970-91666992 GGGAAAGTCTAGATAGAAAATGG + Intergenic
1012067418 6:94565612-94565634 GGTGAAGTTAACATAGAAAATGG - Intergenic
1012430877 6:99162611-99162633 ATGGAAGTACAGAAAGCAAAGGG - Intergenic
1013036551 6:106390404-106390426 GGAGAAGAAAAGAAAGAAAAGGG - Intergenic
1014575883 6:123071660-123071682 GGGGAAGAAGAGGAAGAAAAAGG + Exonic
1014687566 6:124522049-124522071 GGGGAAATACAGAGAGTAGAAGG - Intronic
1014711943 6:124816679-124816701 GGGGTGCTACAGATAGAAACTGG - Intronic
1014772603 6:125474173-125474195 AGGGAAGAAGAGAAAGAAAATGG + Intergenic
1015112447 6:129609020-129609042 AGGGAGGAAAAGATAGAAAAAGG + Intronic
1015194299 6:130508515-130508537 GGGGAAACAGAGAAAGAAAAGGG - Intergenic
1016808589 6:148237840-148237862 GGGGGAGGCCAGAGAGAAAATGG - Intergenic
1017030240 6:150214571-150214593 AGGGAAGGAAAGAGAGAAAAGGG - Intronic
1017418294 6:154245175-154245197 GGAGAAGAAAAGAGAGAAAAAGG + Intronic
1017459829 6:154638461-154638483 TTGGAAGTTCAGACAGAAAAGGG - Intergenic
1018927646 6:168217538-168217560 GGGGAAGTCCTGATGAAAAAGGG + Intergenic
1019141355 6:169946407-169946429 GGTGAAGTAAAGAAGGAAAATGG + Intergenic
1020147260 7:5654170-5654192 GGGCAAGGACAGGTAGAAAAGGG + Intronic
1020365870 7:7379853-7379875 GGGGAACAACAAAGAGAAAAAGG + Intronic
1020870626 7:13624791-13624813 GGGGAAGTAAAATAAGAAAAGGG + Intergenic
1021139884 7:17011046-17011068 GGGGAAGGATATATAGAACAGGG + Intergenic
1021938772 7:25658207-25658229 TGTGAAGTACAGATGGAGAAAGG - Intergenic
1022155016 7:27651962-27651984 GGGGAACTCCATACAGAAAAAGG + Intronic
1023028088 7:36070042-36070064 GGGGGAGTAAAGAAAGCAAAAGG + Intergenic
1023747874 7:43339274-43339296 GAGAAAGTACATAGAGAAAAAGG - Intronic
1025473836 7:60894716-60894738 TGGGAAGTATAGATAGGAAATGG + Intergenic
1025483564 7:61017819-61017841 TGGGAAGTATAGATAGGAAATGG + Intergenic
1025488927 7:61086969-61086991 TGGGAAGTATAGATAGGAAATGG - Intergenic
1025513168 7:61595158-61595180 TGGGAAGTATAGATAGGAAATGG - Intergenic
1025551972 7:62261492-62261514 TGGGAACTATAGATAGGAAATGG - Intergenic
1025557775 7:62330591-62330613 TGGGAAGTATAGATAGGAAATGG - Intergenic
1025564905 7:62422194-62422216 TGGGAAGTATAGATAGGAAATGG + Intergenic
1025809281 7:64864060-64864082 GCGGCAGTACACAGAGAAAAAGG + Intergenic
1025885986 7:65592616-65592638 TGGGAAGTATAGATAGGAAATGG - Intergenic
1026125040 7:67572024-67572046 GGTCAAGAACTGATAGAAAAGGG + Intergenic
1026421565 7:70242399-70242421 GGGGAAGTATGGATGGAAGAAGG - Intronic
1027430096 7:78103025-78103047 GAGGAATTCCAGATAGAAGAAGG - Intronic
1027894141 7:84019043-84019065 GGGGTAGTGAAGATAGAGAAAGG + Intronic
1028510355 7:91618670-91618692 GGGGAAGAATGGATACAAAAGGG + Intergenic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032293864 7:130616776-130616798 GGGCAAATAAAGAGAGAAAATGG + Intronic
1032972379 7:137179585-137179607 GGGGAAGTAAGGATAGCTAATGG + Intergenic
1032986692 7:137345268-137345290 GCTGAAGAACAGAAAGAAAATGG - Intergenic
1034199313 7:149272861-149272883 GGGGAAGTAGAGATGGTTAATGG - Intronic
1034250473 7:149686570-149686592 GTGAAAGAAAAGATAGAAAAGGG + Intergenic
1034776503 7:153832119-153832141 GAGGAAGAACAGATATAATATGG - Intergenic
1035962886 8:4157418-4157440 GGGAAAATAGAGAAAGAAAAAGG - Intronic
1037671149 8:21016377-21016399 GGGGAAGGACAGACAGAGAAAGG - Intergenic
1038961573 8:32525964-32525986 GGGTAAGTAAAGAAATAAAATGG - Intronic
1040284329 8:46092231-46092253 GGGGAGGTTCAGATAGGCAAAGG + Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1041572384 8:59352172-59352194 GGGGAAGTATTTATTGAAAAGGG - Intergenic
1042660193 8:71146022-71146044 TGGGAAGACCAGTTAGAAAAAGG + Intergenic
1042673349 8:71288127-71288149 GGGGAAGCACAGGTGGAAAGTGG + Intronic
1043099986 8:76031820-76031842 GGGGAAATGCAGTTAGACAAGGG - Intergenic
1043856002 8:85265596-85265618 GGGGAAAAAGAGGTAGAAAATGG - Intronic
1044188265 8:89282362-89282384 AAGGAAGTACTGACAGAAAAAGG - Intergenic
1044555924 8:93561995-93562017 TGGGAAGTTCAGATAGAATGTGG - Intergenic
1044663483 8:94613485-94613507 AAGCAAGTACAGACAGAAAATGG + Intergenic
1044927247 8:97219850-97219872 GGAGAAGCACAGAAAGCAAATGG + Intergenic
1044948399 8:97413020-97413042 TGAGAAGAAAAGATAGAAAAGGG - Intergenic
1045325520 8:101114901-101114923 GGGACAGTATAGCTAGAAAAGGG + Intergenic
1045363521 8:101454480-101454502 GGGGATGCATAGATAGACAATGG - Intergenic
1045703535 8:104894513-104894535 TAGGAAGGACAGAAAGAAAAAGG - Intronic
1046134440 8:110008719-110008741 GGGGAGGTAGAGAAAGAAAAAGG - Intergenic
1046174583 8:110558849-110558871 GGGATAGTACAGATGGAAATGGG - Intergenic
1046231291 8:111361851-111361873 GGGGAAGTATAAATATAAATAGG + Intergenic
1046360155 8:113142616-113142638 GGGGAAGTAGAGATGGTTAATGG + Intronic
1047801101 8:128311195-128311217 GGGGAAGTTAAGATAGATGATGG - Intergenic
1047904125 8:129454579-129454601 GGGGAGGAACAGAGAGATAAGGG + Intergenic
1047990392 8:130280225-130280247 TGAGAAGTAAAGGTAGAAAAGGG - Intronic
1048176340 8:132155829-132155851 GGGGAAGGACAGATAAAGCAAGG + Intronic
1048413718 8:134203052-134203074 GGTGAAGAACAGACAGAGAAAGG + Intergenic
1048506001 8:135022245-135022267 CGGGAAGTACAGTTAGAAACCGG + Intergenic
1050003690 9:1105182-1105204 GGGGAAGTATATATATATAAAGG - Intergenic
1050069237 9:1792975-1792997 GAGGAAGAAAAGAGAGAAAAAGG - Intergenic
1050592577 9:7175258-7175280 AGGGAAATACAGATAGCACACGG - Intergenic
1051580290 9:18665663-18665685 GGGAAAGTAAAGAAAGAAGATGG - Intronic
1051894421 9:21973399-21973421 GGAGAAGAACATGTAGAAAAGGG - Intronic
1052479358 9:29003045-29003067 GTGAAAATACGGATAGAAAATGG + Intergenic
1052680985 9:31692271-31692293 GGGAAAGTTAATATAGAAAAAGG + Intergenic
1053699245 9:40671446-40671468 TGGGAAGTATAGATAGGAAATGG - Intergenic
1053945254 9:43301682-43301704 TGGGAAGTATAGATAGGAAATGG - Intergenic
1054310534 9:63470847-63470869 TGGGAAGTATAGATAGGAAATGG - Intergenic
1054409321 9:64794997-64795019 TGGGAAGTATAGATAGGAAATGG - Intergenic
1054442487 9:65278813-65278835 TGGGAAGTATAGATAGGAAATGG - Intergenic
1054487794 9:65742683-65742705 TGGGAAGTATAGATAGGAAATGG + Intergenic
1054984857 9:71250140-71250162 GGGGAAGTACATTTAGAATTTGG + Intronic
1055077460 9:72230648-72230670 AGGGGAGTACAACTAGAAAAAGG - Intronic
1055122916 9:72683569-72683591 GGGGAAAAAAAGAGAGAAAAGGG - Intronic
1056175522 9:84031196-84031218 GGGGAAGTAGAGCTAGAAAATGG + Intergenic
1056303799 9:85269615-85269637 GGGGTTGTACAGATTCAAAAGGG + Intergenic
1057499197 9:95583478-95583500 GGGCACTTGCAGATAGAAAATGG + Intergenic
1058125792 9:101193271-101193293 GGGGAATTACAGAAAGACAGGGG - Intronic
1058952269 9:109915025-109915047 GGTGGAGTACAGATACAAAGAGG - Intronic
1059721628 9:116965521-116965543 TGGGGAGTACAGAAAGAAAGTGG + Intronic
1059756552 9:117299074-117299096 GGGGAAGTTCATATAGAAAATGG + Intronic
1059775083 9:117466129-117466151 AGGGAGGGACAGAGAGAAAAAGG + Intergenic
1059812715 9:117873906-117873928 GGGGAAGTACAGGAAGATATAGG + Intergenic
1060244200 9:121930408-121930430 GGGAAAGTATAGATACAAATTGG + Intronic
1060856673 9:126919415-126919437 GGCGGAGTACAGAAAGAGAAAGG + Intronic
1203580908 Un_KI270746v1:3464-3486 TGGGAAGTATAGATAGGAAATGG + Intergenic
1203588389 Un_KI270747v1:30260-30282 TGGGAAGTATAGATAGGAAATGG - Intergenic
1203614948 Un_KI270749v1:52460-52482 TGGGAAGTATAGATAGGAATTGG + Intergenic
1185992085 X:4902546-4902568 GGGGAAGGAGACATGGAAAAAGG - Intergenic
1186122409 X:6377932-6377954 GGGGAAGTAGAGATGGTTAATGG + Intergenic
1186630932 X:11348340-11348362 TGGGAAGTACAAATGTAAAAGGG + Intronic
1187489715 X:19739612-19739634 GGGGTATCACAGATAGAACAAGG + Intronic
1188714627 X:33446768-33446790 AGGGAAGTAAAGAAAGCAAAAGG - Intergenic
1188980829 X:36725472-36725494 GGAGAAGCAGAGAGAGAAAAAGG - Intergenic
1189195271 X:39147338-39147360 GGGGAAGTAGGGAAAGAGAAAGG + Intergenic
1189399446 X:40652929-40652951 GAGAAGGTACAGAAAGAAAAAGG + Intronic
1192577140 X:72252094-72252116 GAGGGAGAACAGAGAGAAAAAGG + Intronic
1192835869 X:74798873-74798895 GGGGAAGTAGAGAAGAAAAAAGG + Intronic
1192858326 X:75038497-75038519 GAGGAAGTAGAGATAGAAATAGG - Intergenic
1193122307 X:77836259-77836281 GGGGAAGTACGGATGGCTAATGG + Intronic
1193752064 X:85357923-85357945 GGAGAAGTAGATTTAGAAAAGGG - Intronic
1193781700 X:85710886-85710908 GGGGAGGTAGAGATAGTTAACGG + Intergenic
1195118437 X:101723776-101723798 GAGGGAGGACAGAAAGAAAAAGG - Intergenic
1195427096 X:104746771-104746793 GGGGAAGGACAGAGTGAGAAAGG + Intronic
1196062898 X:111430535-111430557 GGGGAAGTGCAGAGCAAAAAGGG - Intergenic
1198334166 X:135650944-135650966 GGGGAAGTCCAAATGGAGAAGGG + Intergenic
1198664567 X:139005979-139006001 GAGGAAGTAGAGAAAGAAATAGG + Intronic
1200019773 X:153192825-153192847 GGGGAAGGACAAAGAGAAATGGG - Intergenic
1201336908 Y:12891452-12891474 GGGGAAATGCAAATATAAAAGGG + Intergenic
1201540339 Y:15099294-15099316 GGGGTGGTACAGAGAGATAATGG + Intergenic