ID: 914662676

View in Genome Browser
Species Human (GRCh38)
Location 1:149805545-149805567
Sequence TTGTGCTGTCCCTAATTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 3, 1: 0, 2: 0, 3: 11, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914662672_914662676 16 Left 914662672 1:149805506-149805528 CCTCGGTGGTTGCAACTTCACCC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 914662676 1:149805545-149805567 TTGTGCTGTCCCTAATTTAGAGG 0: 3
1: 0
2: 0
3: 11
4: 104
914662673_914662676 -4 Left 914662673 1:149805526-149805548 CCCAAATCCTCATTCTGTGTTGT 0: 3
1: 0
2: 1
3: 24
4: 346
Right 914662676 1:149805545-149805567 TTGTGCTGTCCCTAATTTAGAGG 0: 3
1: 0
2: 0
3: 11
4: 104
914662674_914662676 -5 Left 914662674 1:149805527-149805549 CCAAATCCTCATTCTGTGTTGTG No data
Right 914662676 1:149805545-149805567 TTGTGCTGTCCCTAATTTAGAGG 0: 3
1: 0
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914662676 Original CRISPR TTGTGCTGTCCCTAATTTAG AGG Intronic
908842190 1:68291246-68291268 TAATTCTATCCCTAATTTAGAGG + Intergenic
909822333 1:80081741-80081763 AAGTGCAGTCCCTAAATTAGAGG - Intergenic
910011527 1:82469528-82469550 TTGTGCTGTGCCTAAAATATAGG + Intergenic
911075710 1:93872418-93872440 TAATCCTGTCCCTAATTTAGCGG - Intronic
911184823 1:94892928-94892950 GTGTGCTCTCCCTAATATAGTGG - Intronic
913672420 1:121110154-121110176 TTGTGCTGTCCCTAATTTAGAGG + Intergenic
914024187 1:143897518-143897540 TTGTGCTGTCCCTAATTTAGAGG + Intergenic
914662676 1:149805545-149805567 TTGTGCTGTCCCTAATTTAGAGG + Intronic
917740681 1:177959345-177959367 TTTTACTGTCCCTATTTTAGGGG - Intronic
919315181 1:195963156-195963178 TTGGGGAGTCCCTAGTTTAGTGG - Intergenic
921708557 1:218350710-218350732 TTTTGATGTCTCTAATTTAGGGG - Intronic
923199638 1:231698800-231698822 TTCTTCTGTCCCTAATATATAGG + Intronic
1064346029 10:14533636-14533658 TTATGCTGTCTCTAGTTGAGGGG - Intronic
1067362162 10:45592744-45592766 TTGAGCTGGCACTAATTTAAAGG + Intronic
1070188443 10:74089058-74089080 TTGTGCTGTCCCAGATTTACTGG + Intronic
1071698853 10:87907210-87907232 TTGTGATGTTGCTATTTTAGGGG + Intronic
1075014721 10:118902304-118902326 TCGTGCTGCCCACAATTTAGTGG + Intergenic
1080053617 11:27882753-27882775 TGGTGCTATCTCTAATTTACAGG + Intergenic
1091982935 12:4881208-4881230 CTGTGCTGTCCTAAATCTAGAGG - Intergenic
1100114875 12:91292348-91292370 TTGTGTTGTCTCTAATTTCTTGG + Intergenic
1104197804 12:126557916-126557938 TTGTTATGACCCTAATTTTGTGG - Intergenic
1105887765 13:24656876-24656898 TTGTCCTCTTCCTAATTTATAGG - Intergenic
1109331158 13:60932491-60932513 TTGTCCTCTCCTTAATTTAATGG - Intergenic
1112968441 13:105228566-105228588 TTGTGCTGTCCTTTTTTTTGGGG + Intergenic
1114952792 14:27778028-27778050 TTGTGCTGTCTCTTCTATAGTGG + Intergenic
1120130730 14:80803743-80803765 TTGTCCTGTCCCTTATCTTGGGG - Intronic
1121158465 14:91710461-91710483 TGGTGCTGTCTCTTATTTAAAGG + Intronic
1123004722 14:105315560-105315582 TGGCGCTGTCTCTCATTTAGAGG + Exonic
1123667448 15:22618978-22619000 TTTTGCTTTTCCTAGTTTAGTGG - Intergenic
1124522393 15:30415379-30415401 TTTTGCTTTTCCTAGTTTAGTGG - Intergenic
1124536271 15:30550839-30550861 TTTTGCTTTTCCTAGTTTAGTGG + Intergenic
1124762380 15:32456753-32456775 TTTTGCTTTTCCTAGTTTAGTGG - Intergenic
1124776252 15:32592325-32592347 TTTTGCTTTTCCTAGTTTAGTGG + Intergenic
1125774446 15:42198864-42198886 GTTTGCTGACCCTGATTTAGAGG + Intronic
1134843604 16:17421758-17421780 TTGTTTTGTTCCTAATTTTGTGG - Intronic
1139407783 16:66733069-66733091 TTGTGCTGTCCATGATAGAGAGG - Intronic
1142758655 17:2030280-2030302 TGGTCCTGTCCCTAACTTGGGGG - Intronic
1154094689 18:11401696-11401718 TTGTGATGTCACTAATGCAGCGG - Intergenic
1155206264 18:23560892-23560914 TCCTGCTGTGGCTAATTTAGGGG - Intronic
1158680561 18:59562761-59562783 CTCAGCTGTCCCTAATTCAGTGG + Intronic
1159278657 18:66254436-66254458 TTGCTCAGTCCCTAATTAAGAGG - Intergenic
1160472565 18:79150552-79150574 TTGTGGTGCCCCTAGTTTTGAGG + Intronic
1164657264 19:29932120-29932142 TTGTCTTGTTCCCAATTTAGAGG + Intronic
1168576533 19:57516228-57516250 TTGAGCTGTCCCCATTTTATGGG - Intronic
925904144 2:8529327-8529349 TTCTGCTGTCCCAAAGCTAGTGG - Intergenic
927344334 2:22019943-22019965 TTGTGCTGTTCCTGATATATGGG - Intergenic
930932517 2:56904303-56904325 TTGTGTTGTTCCTTATTTTGGGG + Intergenic
934484476 2:94690952-94690974 TTGTGCTGTCTCTTCTATAGTGG - Intergenic
935859631 2:107314667-107314689 TTCTGATGTCACTATTTTAGGGG + Intergenic
936760392 2:115772265-115772287 TTGTTCTGTGTTTAATTTAGTGG + Intronic
1168881963 20:1214214-1214236 TGTTGCTGTCCCTATTGTAGGGG + Intergenic
1170957073 20:20991312-20991334 TTGTGCTCTCCCAAATTCATAGG - Intergenic
1173306017 20:41850574-41850596 TTGTCCTGTCTCTAACTTAGTGG + Intergenic
1178377362 21:32077656-32077678 TTATGCTCTACCTAATTGAGTGG + Intergenic
1178986427 21:37307966-37307988 TTGTGTTGTTCCTTATCTAGGGG + Intergenic
1179269454 21:39839501-39839523 TTCTACTGTCCCTAATTTGTGGG + Intergenic
1179320670 21:40288055-40288077 TAATGCTGTTCTTAATTTAGAGG - Intronic
1179793545 21:43769254-43769276 TTATTCTGTCTCTAATCTAGTGG + Intergenic
951969493 3:28428365-28428387 CTGTGCTTTCCCTAACTCAGAGG + Intronic
956089260 3:65647872-65647894 TTGTGCTGTCCCAATCTGAGGGG - Intronic
956146495 3:66195653-66195675 TTGTGTGGTCCGTATTTTAGGGG + Intronic
956469779 3:69554674-69554696 CTGTGCTGTCCCTAAATGTGTGG + Intergenic
961044376 3:123698770-123698792 GTGTGCTGTCCCAGATGTAGAGG + Intronic
963107251 3:141657876-141657898 TGGTCATGTCCCTAATCTAGGGG + Intergenic
965032842 3:163395602-163395624 TTGTCTTGTTCCTACTTTAGAGG - Intergenic
968351771 3:198062652-198062674 TTTTGCTATCCCTAAGTTACTGG + Intergenic
971755186 4:30698718-30698740 TTGTGCTGGCCCATATATAGTGG - Intergenic
973843900 4:54891392-54891414 TTGTGTTGTCCTTAATTTCAAGG - Intergenic
978580370 4:110226082-110226104 TTTTGCTGTCCCCATTTTAATGG + Intergenic
978671976 4:111260114-111260136 TTGTGTTGTTCCCAATGTAGGGG - Intergenic
979155004 4:117374427-117374449 TCTTGCTGTCTCCAATTTAGAGG + Intergenic
981583766 4:146276964-146276986 TTCTGCTGTCCCTTTTTCAGTGG - Intronic
982951834 4:161708125-161708147 GTGTCCTGTCCCTAAATAAGAGG + Intronic
983967710 4:173833282-173833304 TTCTGCTGTCCCCAAATTGGAGG - Intergenic
986478026 5:8155558-8155580 GTTTGCTGGCCCTAATTTAGAGG + Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
995440656 5:112188721-112188743 CTGTCCTGCCCCTGATTTAGGGG - Intronic
995666313 5:114545963-114545985 TTGTGAAGTCCCATATTTAGTGG - Intergenic
996164433 5:120207768-120207790 TAGTCCTGTGCCTAAATTAGCGG + Intergenic
1005145594 6:22686398-22686420 TTGTCATGTACCTACTTTAGAGG + Intergenic
1007992323 6:46270016-46270038 TTCAGCTGTCCATAATTTAGAGG + Intronic
1009409046 6:63344173-63344195 AGGTGTTGTCCCTAAATTAGTGG + Intergenic
1010439295 6:75874908-75874930 TTTTGCAGTCCTTATTTTAGTGG + Intronic
1010666150 6:78632008-78632030 TTTTGTTGTCCCTAATTTATTGG + Intergenic
1011246924 6:85329255-85329277 GTGGGCTGTCCCTGGTTTAGAGG - Intergenic
1013737182 6:113241436-113241458 TTATGTTTTCCCTAATTTATTGG - Intergenic
1017141403 6:151193441-151193463 TTCTGCTTTCTCTAATTTAATGG - Intergenic
1018041685 6:159929885-159929907 TGGTGCTTTCCCTAATTCTGGGG + Intergenic
1018276625 6:162139171-162139193 TTTTGCTGTCACTATTTTAGGGG + Intronic
1019050412 6:169178913-169178935 TTGTCCTGTCCCTGCTTCAGTGG - Intergenic
1019617174 7:1969459-1969481 TTGTCTTGTTCCTGATTTAGGGG - Intronic
1020961632 7:14811735-14811757 TTGGGCTATCCCTTATTTTGAGG + Intronic
1022390817 7:29943016-29943038 GTGTGCCGTCCCTATCTTAGGGG - Intronic
1024480963 7:49862530-49862552 TTGTCTTGTTCCTATTTTAGGGG + Intronic
1026499658 7:70933384-70933406 TTGCGTTGTCCCTAATTTTAAGG + Intergenic
1031319371 7:120303793-120303815 TTGTGCTGTCATTATTTTAAAGG - Intronic
1031504138 7:122559915-122559937 TTGTGATGTACCAAATTTAAGGG + Intronic
1032247786 7:130227785-130227807 TAGTGCCTTCACTAATTTAGTGG - Intergenic
1037621363 8:20566394-20566416 CTGTGCTGTGCCTAACTTTGAGG + Intergenic
1041131098 8:54701441-54701463 TTTTTCTGTTACTAATTTAGAGG + Intergenic
1045142802 8:99305592-99305614 TTGAACTGTTCATAATTTAGTGG - Intronic
1046198354 8:110891510-110891532 CTGTGCTGTCCCTATCTTGGGGG + Intergenic
1047323771 8:123816828-123816850 TTGTGCTGTTCCTAGGTTAAGGG + Intergenic
1049187574 8:141265944-141265966 TTGTCCTGTTTCTAATTTAAGGG + Intronic
1052655162 9:31349722-31349744 TTGTGAGCTCCCTAACTTAGGGG + Intergenic
1053673320 9:40393447-40393469 TTGTGCTGTCTCTTCTATAGTGG + Intergenic
1053923126 9:43019806-43019828 TTGTGCTGTCTCTTCTATAGTGG + Intergenic
1054384424 9:64533512-64533534 TTGTGCTGTCTCTTCTATAGTGG + Intergenic
1054511307 9:65982841-65982863 TTGTGCTGTCTCTTCTATAGTGG - Intergenic
1059945463 9:119404591-119404613 TTATGCTGTCTCTTATTTATTGG - Intergenic
1061140344 9:128762520-128762542 TTGTGCTGCTTCTATTTTAGAGG - Intronic
1061276428 9:129571523-129571545 TTGTCCTGCCCCTCAGTTAGTGG + Intergenic
1187673732 X:21694705-21694727 TTGTGCTGTCCACAATTTAATGG + Intergenic
1188442812 X:30230090-30230112 TTGTGTGGTCCCTGATTTTGAGG - Intergenic
1192487257 X:71539200-71539222 TTTTGCTGTCCCTTATTTTTTGG + Intronic
1195995090 X:110723698-110723720 CTATGCTGTCCCTAATGTTGTGG + Intronic
1200849337 Y:7866568-7866590 TTGTCCTTTCTCTAATTTATTGG + Intergenic
1201715669 Y:17042396-17042418 TTGTGCTGAACCTAATTTGTAGG - Intergenic