ID: 914662696

View in Genome Browser
Species Human (GRCh38)
Location 1:149805767-149805789
Sequence AGAATAAGTCCTATGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914662696_914662701 -9 Left 914662696 1:149805767-149805789 CCTACCTTCATAGGACTTATTCT No data
Right 914662701 1:149805781-149805803 ACTTATTCTGAGGAGGTAGGAGG No data
914662696_914662702 -8 Left 914662696 1:149805767-149805789 CCTACCTTCATAGGACTTATTCT No data
Right 914662702 1:149805782-149805804 CTTATTCTGAGGAGGTAGGAGGG 0: 3
1: 0
2: 0
3: 12
4: 238
914662696_914662703 -7 Left 914662696 1:149805767-149805789 CCTACCTTCATAGGACTTATTCT No data
Right 914662703 1:149805783-149805805 TTATTCTGAGGAGGTAGGAGGGG 0: 3
1: 0
2: 0
3: 22
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914662696 Original CRISPR AGAATAAGTCCTATGAAGGT AGG (reversed) Intronic