ID: 914663047

View in Genome Browser
Species Human (GRCh38)
Location 1:149809085-149809107
Sequence CTGGGTCAGGGCATTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 3, 1: 0, 2: 2, 3: 14, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914663047_914663056 12 Left 914663047 1:149809085-149809107 CCAATCTCAATGCCCTGACCCAG 0: 3
1: 0
2: 2
3: 14
4: 214
Right 914663056 1:149809120-149809142 TCTACATGTGCAGTGTTCTCTGG 0: 3
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914663047 Original CRISPR CTGGGTCAGGGCATTGAGAT TGG (reversed) Intronic
901135417 1:6989911-6989933 CTGGGTCAGAGCAAGGAGAATGG + Intronic
904042109 1:27591068-27591090 ATGGGTTAGGGCTTTGACATTGG - Intronic
904314467 1:29651345-29651367 CTGGGTCATGCTATTGAGGTGGG - Intergenic
904856204 1:33499936-33499958 TTGGGGCAGGGGCTTGAGATTGG - Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905386180 1:37605892-37605914 CTGGAGCAGGACACTGAGATGGG - Intergenic
906609266 1:47190667-47190689 CTGGGTCAGGGCCTGGGCATGGG - Intronic
906779327 1:48558416-48558438 CTGAGTCATGGAATTGAGACTGG - Intronic
907200919 1:52726380-52726402 CTGAGTCTGCGCATTGAGAGCGG + Intergenic
908006583 1:59734690-59734712 CTGCTTCAGGGCACTGAGAGGGG - Intronic
908070011 1:60449974-60449996 CTAGCTCAGGGACTTGAGATTGG + Intergenic
908134426 1:61115557-61115579 CAGGGACAGAGCATGGAGATGGG + Intronic
909143673 1:71899882-71899904 CAGGGCCAGGGCATTTAGAGTGG - Intronic
913231635 1:116744972-116744994 CTAGGACAGGGCATTCAGACTGG - Intergenic
913672786 1:121113690-121113712 CTGGGTCAGGGCATTGAGATTGG - Intergenic
914024562 1:143901064-143901086 CTGGGTCAGGGCATTGAGATTGG - Intergenic
914255846 1:145960920-145960942 CAGGGTCAGGCCATTGAATTCGG + Exonic
914663047 1:149809085-149809107 CTGGGTCAGGGCATTGAGATTGG - Intronic
914852103 1:151322500-151322522 CTGGGTGAGGGGATTGATTTGGG - Intronic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
918157374 1:181862169-181862191 CTGGATCAGGAAAATGAGATAGG + Intergenic
920097265 1:203494277-203494299 CTGGGGCAGGGGATTGGGAAGGG + Intronic
920903934 1:210141509-210141531 CTTTGTCAAGGCATTCAGATTGG - Intronic
921077637 1:211712623-211712645 CTGGGTGGGGGCCATGAGATGGG - Intergenic
923280108 1:232435707-232435729 CGAGGGCAGGGCATTTAGATAGG - Intronic
924946883 1:248852494-248852516 TGGGCTCAGGGCATGGAGATGGG - Intronic
1064013955 10:11758681-11758703 CTGTGTCCGGCCAGTGAGATGGG + Intronic
1064727431 10:18294985-18295007 CTGTGTCAGGGTGATGAGATGGG - Intronic
1065505881 10:26429681-26429703 CTGGGTCTGGGCAGTGAAAATGG + Intergenic
1069540822 10:69292636-69292658 CTGGGTCTGGGCACTAAGATAGG + Intronic
1070440003 10:76433814-76433836 CTGAGTCAGAGCATTTGGATGGG - Intronic
1071520813 10:86330528-86330550 CTTGGTCAGGGCTTGGAAATGGG - Intronic
1071903161 10:90142362-90142384 CTGGGTCAGGGGATTCACATTGG + Intergenic
1072638850 10:97196066-97196088 CTGGGTCAGGGAGCTGAGGTAGG + Intronic
1074682239 10:115919017-115919039 CTGAGTCAGGGCTTTGAGATGGG - Intronic
1075103796 10:119524041-119524063 CTGAGACTTGGCATTGAGATTGG - Intronic
1076384361 10:130046078-130046100 GTGGCTCAGGGCATGGGGATGGG + Intergenic
1077670728 11:4154807-4154829 CAGGAGCAGGGCCTTGAGATGGG + Intergenic
1079035617 11:17016925-17016947 CTAGGTCAAGACATTGAGGTTGG - Intergenic
1080355339 11:31437752-31437774 CTGGGTCTAGGCATGGCGATAGG - Intronic
1081846318 11:46243155-46243177 CTGGGTCAGGGCGTGGAGTGAGG + Intergenic
1085341508 11:75734497-75734519 CTGGCTCAAGCCACTGAGATAGG + Intergenic
1087373047 11:97308758-97308780 CTGGGTCAGTGAATAGAGTTAGG + Intergenic
1087398201 11:97630160-97630182 CTGTTTCAAGGCATTGTGATGGG + Intergenic
1089649859 11:119905727-119905749 CAGGGTCAGGGCAGGGAGAAAGG - Intergenic
1091846237 12:3658214-3658236 CTGGGCCAGGGCATGGGGAATGG - Intronic
1094284065 12:28772634-28772656 CTGGGTCATGGCAGTTTGATTGG + Intergenic
1095473852 12:42565433-42565455 TTGGGGCAGGGGATTGGGATAGG - Intronic
1096069595 12:48767617-48767639 AAGGGTCAGGGCATGGAGAAAGG - Exonic
1096255851 12:50062020-50062042 CAGGGTCAGGTCTTTGACATGGG - Intronic
1097264756 12:57738531-57738553 CTGGGTGGGGGCGCTGAGATGGG + Intronic
1099144588 12:79024229-79024251 CTGGGTAATGGGATTGAGAGAGG + Intronic
1101969782 12:109304909-109304931 ATGGGTCAAGGCATTCAGAGGGG - Intronic
1102024950 12:109709232-109709254 TTGGGTCAAGGCCTTGAGGTGGG + Intergenic
1102923077 12:116807603-116807625 CTGGGTCAGGGGAGTGCGAGTGG - Intronic
1107617597 13:42187356-42187378 CTGGGACAGGGATTTGAGTTAGG - Intronic
1108136674 13:47370858-47370880 CTGCTTCAGGACATTGAGCTGGG + Intergenic
1110476589 13:75922144-75922166 CTGGGTTAGGGCACTAATATGGG + Intergenic
1113115242 13:106868261-106868283 TTTGGTGAGGGCATTGAGCTGGG + Intergenic
1114614301 14:24060116-24060138 GTGGGTCAGGGCCTGGGGATGGG - Intronic
1118781698 14:69012932-69012954 CTGGGACAGGGCATGGACTTGGG - Intergenic
1118820697 14:69343765-69343787 CTGTGGCAGGGCACTGAGGTTGG - Intronic
1119793581 14:77376504-77376526 CTGGGGCAGGGGACTGAGATGGG + Intronic
1121338868 14:93093300-93093322 CTGGGGCAGGGCAGAGAGCTGGG - Intronic
1121347394 14:93146183-93146205 AGGGGCCAGGGCATGGAGATGGG + Intergenic
1122406654 14:101504852-101504874 CTGGGAGGGGGCATTGAGAGAGG + Intergenic
1124243806 15:28053369-28053391 CTTGGTCAGGCTATTGAGGTTGG - Intronic
1125555306 15:40579840-40579862 CTGGCTCATGGAATGGAGATAGG - Intergenic
1126456857 15:48872328-48872350 GTGGGCAAGGGCAGTGAGATGGG - Intronic
1127974451 15:63986792-63986814 CTGGGTCTGGGCCTGAAGATGGG + Intronic
1128819983 15:70643077-70643099 CCGGATCAGGGCAATGAAATGGG + Intergenic
1129682318 15:77664739-77664761 CAGGGGGAGGGCCTTGAGATGGG + Intronic
1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG + Intronic
1132738209 16:1397713-1397735 CTGGGGCAGGGCATGGACCTGGG + Intronic
1134085921 16:11357435-11357457 ATTAGTCAGGGCATTGGGATGGG - Intergenic
1134892666 16:17854735-17854757 CTAGGTCAAGGGATTGAGACCGG - Intergenic
1136130786 16:28219644-28219666 CTGGGTCAGGAGTTTGAGACCGG + Intergenic
1137769227 16:51002988-51003010 CTGGGTCACGCCTTTGAAATGGG - Intergenic
1137983724 16:53090830-53090852 CTGGGACAGGGCATGGGGGTTGG - Intronic
1143590549 17:7884170-7884192 CTGGGTAAAGGCTTGGAGATGGG + Intronic
1144728780 17:17514954-17514976 CTGGGGCAGGGCATGGAGCAGGG + Intronic
1148093786 17:45038713-45038735 CTCGGTCAAGGCACTGAGAAGGG - Intronic
1148211828 17:45813314-45813336 CTGGGTCAGGGGCTTGGGGTGGG - Intronic
1151898603 17:76996982-76997004 GTGTGTCAGGGCAAGGAGATGGG - Intergenic
1151973460 17:77471032-77471054 CTGGGGCAGGGCCTGGAGACGGG + Intronic
1152278488 17:79371846-79371868 CTGTGTCACGACACTGAGATGGG + Intronic
1152491887 17:80640601-80640623 CTGAGTCAGGGCAGGGAGAGTGG + Intronic
1153482818 18:5564665-5564687 ATGGGTCAGGAAGTTGAGATAGG + Intronic
1154002404 18:10493703-10493725 CTGGATCAAGGCACTGAGATTGG - Intergenic
1155367655 18:25064397-25064419 ATGGGTCAGGGCAATGAAACAGG + Intronic
1155444688 18:25898988-25899010 GTGGGTCAGGGTTTTGAGAAGGG + Intergenic
1156314207 18:35952103-35952125 CTGGGTCAGAGAGATGAGATGGG - Intergenic
1158010875 18:52725760-52725782 CTGGATAAGGCAATTGAGATAGG + Intronic
1158327048 18:56323746-56323768 CTGGTTCAGGGCACTGAGCTAGG - Intergenic
1158896294 18:61916771-61916793 CTGGGTCAGGGAACACAGATTGG + Intergenic
1159987997 18:74868279-74868301 TTGGGTGAGGGCATTGTTATAGG + Intronic
1160371328 18:78374063-78374085 CTGTGTCAGAGCATTGAGCTCGG + Intergenic
1161031675 19:2060636-2060658 CTGGGTTAGGATTTTGAGATGGG + Intergenic
1162640209 19:12002608-12002630 CAGGGTCAGGAGATCGAGATTGG - Intergenic
1163056545 19:14724149-14724171 CTGGGTCAGCTCATTAAGATAGG - Intronic
1163637027 19:18441729-18441751 CTGGGTCAGGGCGGAGGGATAGG - Intergenic
1164711806 19:30362196-30362218 CTTGGACAGGGCCTTGAGAGTGG - Intronic
1164870085 19:31635839-31635861 CTGGCTGAGGGCATTGCGAATGG - Intergenic
1166917708 19:46206959-46206981 GTGGGTGAGAGGATTGAGATGGG - Intergenic
1168268241 19:55234977-55234999 CTGGGTCTGGGCACTGAGGAAGG + Intronic
925222067 2:2149938-2149960 CTGGGTCAGGGCATGGAGAGTGG - Intronic
926765858 2:16322290-16322312 CTGGTTCAAGGCAATGAGATAGG - Intergenic
927273427 2:21239186-21239208 CTGTGTAAGGGAATTGAGAAGGG + Intergenic
928008385 2:27583429-27583451 CTGGGACAGGGCTTTGAGAATGG + Intronic
929585180 2:43109351-43109373 CTGGTGCAGGGGTTTGAGATGGG - Intergenic
929776488 2:44933901-44933923 CTGGGTAGGGACATGGAGATGGG + Intergenic
932289553 2:70565160-70565182 CTGTGTCCAGGCAGTGAGATTGG - Intergenic
934532875 2:95106580-95106602 CTGGGGCATGGCCTTGAGAGTGG - Intronic
935656974 2:105431547-105431569 CTGGGTCAGGGCAGTGTGACTGG + Intronic
935804014 2:106728925-106728947 CTGTGTCAGGGGATTTAGAGAGG - Intergenic
936235635 2:110740365-110740387 CTGTGTCAGGCCCTGGAGATGGG + Intronic
936522847 2:113222435-113222457 CTGGGGCAGGGGATGGAGCTCGG + Intronic
939029377 2:137053026-137053048 CTTGGTCAGGACATTTAGAAAGG - Intronic
940390437 2:153126885-153126907 CTGGCTCAGGGCAGTGGCATAGG - Intergenic
942480433 2:176381924-176381946 GTGGGGCAGGGGATGGAGATGGG + Intergenic
943480228 2:188408105-188408127 CAGGGTGAGGCCAATGAGATGGG + Intronic
944463157 2:199973467-199973489 CAGGGTTAGGGCATAGTGATGGG - Intronic
946189239 2:217999066-217999088 CAGGGTCAGGGCATGGTGTTGGG - Intronic
946372657 2:219290229-219290251 CTGGGGCAGGGCCTTGAGGATGG + Exonic
948840086 2:240644584-240644606 GTGGGGCAGGGCATTGAGCCTGG - Intergenic
1168764219 20:371095-371117 CTGAGTCAGGGCAGGGAGAGAGG - Intronic
1169066298 20:2695949-2695971 GTGGCTGAGGGCACTGAGATTGG - Intronic
1171255935 20:23689090-23689112 CAGGGGCAGGGCATGGAGGTGGG - Intergenic
1174671195 20:52309078-52309100 GTGGGTTAGGGCATTGGGAACGG + Intergenic
1174994709 20:55553009-55553031 CAGGGCCAGGGTATTGAAATAGG + Intergenic
1175498470 20:59432070-59432092 CTGTGTCAGGGTGTTGGGATTGG + Intergenic
1178823339 21:35994676-35994698 CTGGGTCAGGTCAGTGAGTCAGG - Intronic
1179115502 21:38488103-38488125 CTGGGACAGTGCATTGCGAAGGG - Intronic
1182445331 22:30386619-30386641 CTGGACCAGGGCCTTGGGATAGG + Exonic
1183371577 22:37435544-37435566 CTGGAGCAGGGCCTGGAGATGGG + Intergenic
1183428051 22:37750242-37750264 CTGGGCCAGGGCTGGGAGATTGG - Intronic
1183964741 22:41434911-41434933 TTGGGTCAGGGCAGTGAGAAGGG + Exonic
1184257559 22:43295845-43295867 CTGGGCCAGAGCACAGAGATGGG + Intronic
1184698379 22:46151727-46151749 CTGGGTCAGGGCAAGGACACGGG + Intronic
1184833856 22:47008738-47008760 CTGGGTACAGGCATTGAGAGAGG + Intronic
949421536 3:3871644-3871666 CTGGGTCAGGGGAAAGAGCTGGG - Intronic
950747550 3:15102455-15102477 CGGGTTGAGGGCATTGAGGTTGG + Intergenic
951676530 3:25247662-25247684 CTGGTTCATGTCATTGGGATTGG - Intronic
953022869 3:39127094-39127116 CAGGGTCTGGGCCTTGAGAAGGG - Intronic
953031917 3:39185147-39185169 ATGGTTGAGGGCATTGAGCTTGG + Exonic
961116522 3:124334544-124334566 CTAGGTCAGGGACTTGAGCTCGG - Intronic
963908086 3:150790694-150790716 TTGGTTAAGGGCTTTGAGATAGG + Intergenic
964415387 3:156442798-156442820 CTGGATCAGGGCAGAGAGCTGGG - Intronic
965434064 3:168625266-168625288 GTGGGTCAGGACATTGGGACAGG - Intergenic
966256551 3:177923415-177923437 GTTGGTCAGGGCACTGAGTTAGG - Intergenic
966751631 3:183327648-183327670 CAGGAACAGGGCATTGAAATGGG - Intronic
967805777 3:193713508-193713530 CTGAGCCAGTGGATTGAGATAGG - Intergenic
967871650 3:194234789-194234811 GTGGGGCAGGGCATGGAGAGTGG - Intergenic
969457066 4:7306249-7306271 CTGGCTCAGGGCACTGTGCTGGG + Intronic
969942574 4:10749068-10749090 CTGGGTAAGGAAAATGAGATAGG + Intergenic
970487223 4:16536691-16536713 GTGGGTCAGGGGATGGAGAATGG + Intronic
971851197 4:31988087-31988109 ATGCGTAAGGGCAATGAGATTGG + Intergenic
974969049 4:68802800-68802822 CTGACTCAGATCATTGAGATTGG + Intergenic
975798204 4:78031755-78031777 CAAGGTCAGGGCCTTGAGATGGG + Intergenic
977588276 4:98799622-98799644 CTGTCTCAGGGCCTTGAGTTTGG - Intergenic
979472264 4:121113096-121113118 CTAGGTCTGGGCTTAGAGATAGG + Intergenic
981579023 4:146233726-146233748 CTGGGCCAGGGAAGTGAGGTGGG - Intergenic
984972977 4:185207090-185207112 CTGGGTCAGTGGATTGAGTAGGG - Intronic
985819656 5:2151014-2151036 CAGGGTCAGGGCAGTGGGAGGGG + Intergenic
986214889 5:5710673-5710695 CTGTGTGAGGGCAATCAGATCGG - Intergenic
987123762 5:14792223-14792245 CTGGGCAGGGGAATTGAGATTGG + Intronic
990166783 5:53003415-53003437 TTGGGTCAGGGCTTTGAGAATGG + Intronic
990748379 5:58984248-58984270 CAGGGTGAGGGCATAGAGAGTGG - Intronic
992350249 5:75921091-75921113 CTGGGTGAGGGCATTGTGCACGG + Intergenic
996020053 5:118580784-118580806 AAGGGTCAGGGCATTAAGTTTGG + Intergenic
997198387 5:131994740-131994762 CAGGGTCAGGGCCTGGAGTTGGG - Intronic
998028635 5:138843714-138843736 ATGGGTCAGGCATTTGAGATTGG + Intronic
1000399078 5:160806292-160806314 CTGGGTCAGGGGAGTGTAATTGG - Intronic
1002188414 5:177466721-177466743 CTGGGTCAGGGAAGTGAGAATGG - Intronic
1002318666 5:178362119-178362141 GTGTGGCAGGGCATTGAGGTGGG + Intronic
1005842093 6:29750249-29750271 GTGGGACAGGGCAAGGAGATTGG - Intergenic
1006618580 6:35346439-35346461 CTGGGACATGGCATTGACAATGG - Intronic
1011729619 6:90247747-90247769 TTGGGTAAAGGCATGGAGATGGG - Intronic
1016441657 6:144090179-144090201 CTGCATGAGGGCATTGAGAAAGG - Intergenic
1016935240 6:149445035-149445057 CTGTTTCTGGGCATTGGGATAGG + Intergenic
1017918937 6:158854945-158854967 TGGGGTGAGGGCACTGAGATGGG + Intergenic
1019443147 7:1057435-1057457 CTGGGCCAGGGCTTTGGGACGGG + Intronic
1019743016 7:2684487-2684509 CTGGGTCAGAGGATGGTGATGGG + Intronic
1019752351 7:2739279-2739301 CTGGGCCAGGGCAGTGGGAGTGG - Intronic
1019990860 7:4689836-4689858 CTGGGTGAGGGCAGTGACAAGGG - Intronic
1023412963 7:39905639-39905661 CTGGGTCAGGAGTTTGAGACTGG - Intergenic
1023607162 7:41941511-41941533 CAGGTGCAGGGCATTGAGAAGGG - Intergenic
1025987698 7:66469507-66469529 CTGGGCGAGGGCATAGAGAATGG - Intergenic
1026003988 7:66586397-66586419 CTGGGCGAGGGCATAGAGAATGG - Intergenic
1026027249 7:66755630-66755652 CTGGGCGAGGGCATAGAGAATGG + Intronic
1027210685 7:76145414-76145436 CTGGGCGAGGGCATAGAGAATGG - Intergenic
1028895090 7:96031986-96032008 TTTGGCCAGGGCATTGAGAAAGG - Intronic
1031102798 7:117503022-117503044 CTGGGTGGGAGCAGTGAGATTGG + Intronic
1031862213 7:126993813-126993835 CAGGTTCAGACCATTGAGATGGG - Intronic
1031913041 7:127537396-127537418 TTGGATCAGGGTATTCAGATTGG - Intergenic
1039393475 8:37202201-37202223 CTGGGTCTGTGCATTGACTTAGG + Intergenic
1039695312 8:39904410-39904432 CTGGGTCAGGAGTTTGAGACCGG - Intronic
1043495378 8:80795090-80795112 TTGTGTGAGGGCATTGGGATGGG - Intronic
1044139634 8:88634804-88634826 CTGGTTCAGGGCTTTGTGCTGGG - Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1046225788 8:111278869-111278891 CTTGGTCAAGTCATTGAAATTGG + Intergenic
1048031358 8:130636320-130636342 CTTGTTCAGGGCCCTGAGATAGG - Intergenic
1049149858 8:141027513-141027535 CTAGGTTAGGGCATTGTGCTAGG + Intergenic
1049320373 8:141993037-141993059 CTCGGGCAGGGTATTGAGAGAGG - Intergenic
1049444540 8:142623992-142624014 CTGGGTCAGGGCACCGAGCCGGG + Intergenic
1049967731 9:794526-794548 CAGGGACAGAGCATTGACATAGG - Intergenic
1050114777 9:2252582-2252604 CTGGGTCAGTGCTTTGGGCTAGG + Intergenic
1050931300 9:11330640-11330662 ATGGGTCAGAGCAGTGTGATGGG - Intergenic
1051141166 9:13980341-13980363 CTGATTCAAGGAATTGAGATAGG - Intergenic
1051444772 9:17128490-17128512 CTGTGTTAGGGCACTGTGATAGG + Intergenic
1051570642 9:18554810-18554832 CTGGGACAGGACATTGATAGTGG - Intronic
1053575970 9:39357720-39357742 CTGGGTTAGGGCAGTGAGGGAGG - Intronic
1053840485 9:42185657-42185679 CTGGGTTAGGGCAGTGAGGGAGG - Intronic
1054097539 9:60916411-60916433 CTGGGTTAGGGCAGTGAGGGAGG - Intergenic
1054118941 9:61192041-61192063 CTGGGTTAGGGCAGTGAGGGAGG - Intronic
1054588810 9:66990521-66990543 CTGGGTTAGGGCAGTGAGGGAGG + Intergenic
1055072575 9:72182148-72182170 CTGGGTCAGGAAATTAACATAGG + Intronic
1055355707 9:75435129-75435151 CTGAGTCAGGATATTGAGAGTGG + Intergenic
1057720176 9:97525983-97526005 ATGGGTCAGGGAATCAAGATTGG - Intronic
1057969524 9:99540779-99540801 TAGGGTCAGGACAATGAGATGGG + Intergenic
1058644323 9:107116478-107116500 CTGGGTAAGCTCATTTAGATAGG - Intergenic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1060445649 9:123684903-123684925 CTGGGTCAGTGCTTTGATAGAGG + Intronic
1061057575 9:128232628-128232650 CTGGGTCAGGCCCTTCAGGTGGG - Intronic
1061067643 9:128288559-128288581 GTGGGTCAGGGCAGTGACACTGG + Intronic
1061785779 9:133027386-133027408 CCGGGTCAGGGCATGGTCATAGG - Intergenic
1187612086 X:20954029-20954051 CTGGCTCATGGCGCTGAGATTGG - Intergenic
1190738120 X:53269177-53269199 CTGGGTCAGGAAATTCAGAAAGG - Intronic
1191079644 X:56495467-56495489 CTGGTTCAGTTCATTGAGACTGG - Intergenic
1192069688 X:67923721-67923743 CAGAGCCAGGGCCTTGAGATGGG - Intergenic
1195650011 X:107274394-107274416 CTGAGTCACAGCATTGAGAGTGG - Intergenic
1198074323 X:133180212-133180234 CTGGGGCAAGGCATAGAGAGGGG - Intergenic
1199987073 X:152960175-152960197 CTGGGTCAGGGGAGGGATATAGG + Intronic