ID: 914665971

View in Genome Browser
Species Human (GRCh38)
Location 1:149832808-149832830
Sequence GGCGGCGTTAAGCGGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914665967_914665971 0 Left 914665967 1:149832785-149832807 CCATTCGGCGTCTAGCTCGGCGT No data
Right 914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG No data
914665965_914665971 4 Left 914665965 1:149832781-149832803 CCTGCCATTCGGCGTCTAGCTCG No data
Right 914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG No data
914665964_914665971 9 Left 914665964 1:149832776-149832798 CCAAGCCTGCCATTCGGCGTCTA No data
Right 914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914665971 Original CRISPR GGCGGCGTTAAGCGGATCTC TGG Intergenic
No off target data available for this crispr