ID: 914667002

View in Genome Browser
Species Human (GRCh38)
Location 1:149840498-149840520
Sequence CGGGCTGCGGACGCTTTCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 2, 1: 1, 2: 0, 3: 3, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914667002_914667007 -8 Left 914667002 1:149840498-149840520 CCCAGGAAAGCGTCCGCAGCCCG 0: 2
1: 1
2: 0
3: 3
4: 61
Right 914667007 1:149840513-149840535 GCAGCCCGGCCAGTGCGGATAGG 0: 2
1: 0
2: 0
3: 12
4: 79
914667002_914667012 10 Left 914667002 1:149840498-149840520 CCCAGGAAAGCGTCCGCAGCCCG 0: 2
1: 1
2: 0
3: 3
4: 61
Right 914667012 1:149840531-149840553 ATAGGCCAATTGGCCGAAGTCGG 0: 2
1: 0
2: 0
3: 3
4: 64
914667002_914667015 25 Left 914667002 1:149840498-149840520 CCCAGGAAAGCGTCCGCAGCCCG 0: 2
1: 1
2: 0
3: 3
4: 61
Right 914667015 1:149840546-149840568 GAAGTCGGCAAAGCTCAAGACGG 0: 2
1: 0
2: 0
3: 5
4: 82
914667002_914667010 0 Left 914667002 1:149840498-149840520 CCCAGGAAAGCGTCCGCAGCCCG 0: 2
1: 1
2: 0
3: 3
4: 61
Right 914667010 1:149840521-149840543 GCCAGTGCGGATAGGCCAATTGG 0: 2
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914667002 Original CRISPR CGGGCTGCGGACGCTTTCCT GGG (reversed) Exonic
900033629 1:389218-389240 TGTGCTGCGGACTCTTCCCTCGG + Intergenic
902840351 1:19070330-19070352 CTGGCTGCTGACGCTTACCTGGG - Intergenic
913449382 1:118982991-118983013 TGGGCAGCGAAGGCTTTCCTAGG - Intronic
914386092 1:147171971-147171993 CGGGCATGGGACGCTTACCTTGG + Exonic
914667002 1:149840498-149840520 CGGGCTGCGGACGCTTTCCTGGG - Exonic
914668765 1:149853292-149853314 CGGGCTGCGGACGCTTTCCTGGG + Exonic
915605162 1:156945775-156945797 TGGGCACCGGATGCTTTCCTTGG + Intronic
1063636708 10:7788779-7788801 CGTGTTGCAGACGCTTTGCTGGG + Intronic
1065782357 10:29181823-29181845 AGGGCTGTGGATGCTTTCCCTGG - Intergenic
1077107338 11:847920-847942 CTGGCGGCGGATGCTCTCCTTGG + Intronic
1083627163 11:64077747-64077769 CGGGCTGGGGACTCCTCCCTCGG - Intronic
1096417247 12:51424933-51424955 CGGGCTGCTGATGCTTGGCTTGG + Exonic
1113784424 13:112994959-112994981 CGGGCTGCGGAGACTTCCCCAGG + Intronic
1118455611 14:65943589-65943611 GGGGCTGTGGACTCTGTCCTTGG + Intergenic
1129741334 15:77991082-77991104 CTGGCTGAGGACTCTTTTCTAGG - Intronic
1129844329 15:78761317-78761339 CTGGCTGAGGACTCTGTCCTAGG + Intronic
1132352449 15:101148517-101148539 AGGGTTCCGGACGCTTTCCTGGG - Intergenic
1134440732 16:14298401-14298423 CCGCCTGTGGGCGCTTTCCTTGG - Intergenic
1142499149 17:322686-322708 AGGGAGGCGGACCCTTTCCTGGG + Intronic
1142580392 17:938378-938400 CGGGCTGGGGACCTTTTCTTTGG - Intronic
1145200172 17:20937933-20937955 CTGGCTGTGGAGGCTTCCCTGGG - Intergenic
1146770956 17:35568264-35568286 CGGGCTGCAGATTCCTTCCTGGG + Intergenic
1152195899 17:78918256-78918278 GGGGCTCCGGAAGCTTTCCCTGG + Intronic
1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG + Intronic
1157946666 18:51988430-51988452 GGGGCTGCGGAGGCTCTCCATGG + Intergenic
1162689043 19:12413833-12413855 CGGTCTGCGGACCCTTCCCCTGG - Intronic
1162760493 19:12885781-12885803 CGGGCTCCCGACGCCTTCGTGGG - Exonic
1164703250 19:30301140-30301162 CTGGCTGTGGACGTTTTCATAGG + Intronic
1167342661 19:48925026-48925048 TGGGATGGGGATGCTTTCCTTGG + Intergenic
926121213 2:10242133-10242155 CTGGCTGGGGACGCTAGCCTGGG - Intergenic
927935102 2:27071838-27071860 GGGGCTGCGGACGCGCGCCTGGG + Intergenic
938168570 2:129055371-129055393 TGGGCTGCGGTCTCTTTCCTGGG + Intergenic
938318489 2:130346132-130346154 CAGGGTGGGGATGCTTTCCTGGG - Intronic
1175276235 20:57772774-57772796 CAGGCTGAGGACCTTTTCCTTGG + Intergenic
1178670111 21:34582643-34582665 CGGGCTCCAGATGCTTGCCTGGG - Intronic
1179012060 21:37563811-37563833 GGGGCTGCGGACGCTTCCGAGGG + Intergenic
1181335398 22:22124821-22124843 CTGGCTGGGGACGCTGTCATAGG + Intergenic
950193159 3:10992087-10992109 CGGGCAGCAGACGCTGCCCTAGG + Intergenic
951217601 3:20040118-20040140 CTGGCTGCGGACATGTTCCTCGG - Exonic
956016587 3:64890194-64890216 AGGGCTGAGGACGCATTCCCCGG - Intergenic
958730891 3:97959072-97959094 CGGCCTGCCGATCCTTTCCTCGG + Exonic
960747696 3:120908254-120908276 CGGGCTCCGGCCGCTTCTCTGGG - Exonic
982257575 4:153466048-153466070 CGGGGCCCGGGCGCTTTCCTCGG - Intergenic
984667934 4:182448630-182448652 CGGGCAGCGGCCGTGTTCCTCGG - Intronic
984847777 4:184122316-184122338 CTAGCTGGGGACCCTTTCCTGGG + Intronic
985673117 5:1216478-1216500 CGGGATGCGGATGCTGCCCTGGG + Intronic
999325836 5:150642775-150642797 CGGGCTGCAGGAGCTTGCCTTGG + Intronic
1001616258 5:173045770-173045792 GGGGCTGCAGAAGCTTTACTGGG + Intergenic
1002740191 5:181429650-181429672 TGTGCTGCGGACTCTTCCCTCGG - Intergenic
1004017180 6:11743030-11743052 AGGGCTGGGGATGGTTTCCTTGG - Intronic
1010124148 6:72412949-72412971 GGGGCTGCGCACTCTTTCCGGGG + Intergenic
1014882555 6:126741640-126741662 CAGGCTGGCAACGCTTTCCTGGG + Intergenic
1019245304 6:170705250-170705272 TGTGCTGCGGACTCTTCCCTCGG - Intergenic
1024043640 7:45573797-45573819 CGGGCTGCGGGAGCTGTGCTGGG - Intergenic
1026931013 7:74223008-74223030 CAGGCTGAGGATGCTTTGCTCGG - Intronic
1030598002 7:111562344-111562366 TGGGCTGGGGACCCTTCCCTGGG - Intronic
1035502824 8:102952-102974 TGTGCTGCGGACTCTTCCCTCGG + Intergenic
1037401218 8:18496995-18497017 GGGGCTGGGGAAGTTTTCCTAGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1060485037 9:124041279-124041301 CGGGCTCCGGACGCTTTCCTGGG + Intergenic
1061664607 9:132153200-132153222 CAGGCTGGGGACACTTTCCAGGG + Intergenic
1062568283 9:137172877-137172899 CGGCCTGCGGTCGACTTCCTTGG - Intergenic
1203605499 Un_KI270748v1:54458-54480 TGTGCTGCGGACTCTTCCCTCGG - Intergenic
1186001040 X:5010883-5010905 CCTACTGCGGACTCTTTCCTTGG + Intergenic
1190266771 X:48831576-48831598 TGGGCTGAGGACGCCTTCTTGGG - Intronic
1199872646 X:151912833-151912855 CGGGCAGCTGGGGCTTTCCTTGG - Intronic
1201543333 Y:15133079-15133101 TGGGTTGGGGAAGCTTTCCTGGG - Intergenic