ID: 914667870

View in Genome Browser
Species Human (GRCh38)
Location 1:149847083-149847105
Sequence CTGCTTGCTTTGAAGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 2, 2: 19, 3: 101, 4: 439}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914667870 Original CRISPR CTGCTTGCTTTGAAGACAGA GGG (reversed) Intronic
900809493 1:4790624-4790646 TTGCTTCCTCTGAAGCCAGAGGG + Exonic
900868702 1:5286780-5286802 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
901862859 1:12085995-12086017 CTTCTTGCTTTGAGGACAGCAGG + Intronic
903168999 1:21540627-21540649 CGGCTTGCATTCAGGACAGAGGG - Intronic
904219130 1:28950623-28950645 CTTCTTGCTTAGAACACAGATGG + Intronic
904937595 1:34142485-34142507 CTGCCTGCCTTGAACAGAGATGG - Intronic
906389331 1:45400230-45400252 TTGCTGGGTTTGAAGACGGAAGG + Intronic
907664620 1:56423978-56424000 ATTCATGCTTTGAAGAGAGAGGG - Intergenic
907748569 1:57239597-57239619 CTTATTGTTTTGAGGACAGATGG - Intronic
907827031 1:58027926-58027948 CTGCATGCTTTGAGGACTGCTGG + Intronic
909690094 1:78397768-78397790 CTGCTGGCTCTGAAGAGAGAAGG - Intronic
910766784 1:90790077-90790099 CTGCTGGCTTTGAGGATGGAAGG + Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
911949582 1:104155095-104155117 CTGTTAGTTTTGAAGACACACGG - Intergenic
912061805 1:105682285-105682307 CTGATTGACTTGAAGACAGAAGG - Intergenic
912637514 1:111311792-111311814 CTGTTTGCTTCACAGACAGATGG + Intronic
912694751 1:111832840-111832862 ATGGTTGCTGTGAAGACTGATGG + Intronic
912765077 1:112401604-112401626 CTCCTTACTTTGAGGACAGTGGG - Intronic
914667870 1:149847083-149847105 CTGCTTGCTTTGAAGACAGAGGG - Intronic
915579932 1:156807524-156807546 CTGGGTGCTTTGGAAACAGATGG + Intronic
916373911 1:164130569-164130591 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
916671205 1:167022464-167022486 CTGCTTGCTTTGCAGTCCAATGG - Intergenic
917107227 1:171504669-171504691 CTACTTGCTTTCAAGACTTAAGG - Intronic
917629185 1:176876462-176876484 CCACTTGCTATGAGGACAGAAGG - Intronic
918333799 1:183487270-183487292 CTACTGGCTTTGAAGATGGAAGG - Intronic
918684280 1:187396427-187396449 CTGGTGGCTTTGAAGATGGAAGG - Intergenic
918727510 1:187944236-187944258 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
919449089 1:197748613-197748635 TTGTGGGCTTTGAAGACAGAAGG + Intronic
919601840 1:199632830-199632852 CTGCAGGTTTTGAAGACAGTGGG - Intergenic
920086956 1:203424416-203424438 ATGCTGGCCTGGAAGACAGAAGG - Intergenic
920270572 1:204760289-204760311 CATCTAGCTTGGAAGACAGATGG + Intergenic
920332793 1:205222957-205222979 ATGCTTGCTTTAGAGTCAGACGG + Intergenic
921732295 1:218591838-218591860 CTGCTGGCTTTGATGAGGGAAGG + Intergenic
921761431 1:218919579-218919601 CTTCTTTTTTTCAAGACAGATGG - Intergenic
922084419 1:222332462-222332484 CTTCTTCCTTTGAAGAGGGAGGG - Intergenic
923625900 1:235613562-235613584 CTGCTGGCTTTGAAGGTGGAAGG + Intronic
923626106 1:235615273-235615295 CTGCTGGCTTTGAAGGTGGAAGG + Intronic
923690850 1:236191868-236191890 CTGATGGCTCTGAAGAGAGAAGG - Intronic
924563859 1:245179824-245179846 GTGTTTGCTTTGGAGACAGAGGG + Intronic
1063171079 10:3510539-3510561 CTGCTAGCTCTGAAGATGGAAGG + Intergenic
1063673491 10:8118660-8118682 GTGTTTTCTTTGGAGACAGATGG + Intergenic
1064057861 10:12112983-12113005 CCACTTGCTTAGGAGACAGATGG + Exonic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064532216 10:16322154-16322176 TTGCTGGCTTTGAAGACAAAAGG + Intergenic
1064598505 10:16970174-16970196 GTCCTTGCTTTGAAGTCAGGAGG - Intronic
1065120563 10:22526071-22526093 CTGCTGGCTCTGAAGAGAGCAGG - Intergenic
1066193545 10:33077518-33077540 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1067787994 10:49264919-49264941 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1068517602 10:58043813-58043835 CTGCTGGCTCTGAAGATGGAAGG - Intergenic
1068895330 10:62192668-62192690 TTGCTGACTTTGAAGACCGAAGG + Intronic
1070762035 10:79029909-79029931 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
1071366066 10:84901622-84901644 TTGCTTGCTATGTGGACAGATGG - Intergenic
1072753782 10:98003488-98003510 ATTCTGGCTTTGAAGACGGAGGG - Intronic
1072952251 10:99858006-99858028 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
1073055696 10:100699544-100699566 TTGCTGGCTTGGAAGACAGAGGG + Intergenic
1073598567 10:104823963-104823985 TTGTTGGCTTTGAAGACTGAAGG + Intronic
1073612526 10:104958585-104958607 CTGCTGGCTTTGAAGATGGAAGG + Intronic
1074604471 10:114947110-114947132 TTGCTGGCTTTGAAGAGTGAAGG + Intronic
1074845125 10:117391009-117391031 CTGCTGGCTTTGAAGATGGAAGG + Intergenic
1075125540 10:119696158-119696180 CTGATTAATTTGAAGAAAGATGG - Intergenic
1075175353 10:120155587-120155609 CTGCTGTCTTTGGAGTCAGATGG + Intergenic
1075485078 10:122815247-122815269 CTGGGTACTTTGAAGACATATGG + Intergenic
1075961125 10:126568441-126568463 GTGCTGGCTTTGAAGACGGAGGG - Intronic
1075972644 10:126667721-126667743 CTGCTTGCCATGCGGACAGAAGG + Intronic
1076045500 10:127291317-127291339 CTGCCTGCTTTGAGGATAAAGGG - Intronic
1077928100 11:6702543-6702565 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1077929600 11:6717246-6717268 GTGCTTGCTGTGGACACAGAAGG - Intergenic
1077945583 11:6894181-6894203 CTGCTCACTTTGCAGGCAGAAGG + Intergenic
1078105206 11:8354061-8354083 CTGCTTGCTTTGCAGAGCCACGG + Intergenic
1078715929 11:13838945-13838967 CTGCTGGTTTTGAAGACACAAGG - Intergenic
1079091369 11:17482636-17482658 CTACCTGCTTTAAAGAGAGATGG - Intergenic
1079618112 11:22520005-22520027 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1079722578 11:23836902-23836924 GTGCTAGCTTTGGAGATAGAGGG - Intergenic
1080191997 11:29562054-29562076 GTTTTTTCTTTGAAGACAGATGG + Intergenic
1080323648 11:31044523-31044545 CTGCTAGCTCTGAAGATGGAAGG + Intronic
1080700989 11:34643851-34643873 CTGCTTGCTCTGGAGAAAGCTGG + Intronic
1080960480 11:37152366-37152388 CTGCTTGCCCTAAAGACAGAGGG - Intergenic
1081240169 11:40695713-40695735 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1081759027 11:45564215-45564237 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1083580415 11:63821238-63821260 CTGCTGGCTTTGAAGATGGAAGG - Intronic
1083707325 11:64525502-64525524 CTGCTGGATTTGAAGATGGAGGG - Intergenic
1085669234 11:78446410-78446432 CTCCTTGCTCTGAGGACAGAAGG - Intronic
1086201329 11:84205943-84205965 CTGATTTTTTTAAAGACAGATGG + Intronic
1086762936 11:90656342-90656364 CTGCTAGCTTTGAATGCGGAAGG - Intergenic
1088037243 11:105332900-105332922 CTTCTGGCTTGGAAGATAGAAGG - Intergenic
1088716568 11:112554573-112554595 CCGCCTGCTTTGGAGACTGAGGG + Intergenic
1088908678 11:114173901-114173923 TTGCTTGCTTAGAAGTCAAAAGG + Intronic
1089327701 11:117668675-117668697 CAGGTTGCTTTGCAGTCAGATGG - Intronic
1089661495 11:119989021-119989043 TTGCTTGCTTGGGAGGCAGAGGG - Intergenic
1090880815 11:130830279-130830301 GTGGGTGCTTTGAAGAGAGAGGG - Intergenic
1091116259 11:133016413-133016435 TTGCTGGCTTTGAAGACGAAGGG - Intronic
1092087565 12:5776051-5776073 CTGATTGGTTTGGAGATAGAGGG - Intronic
1093323227 12:17739894-17739916 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1093719684 12:22425315-22425337 CTTCTGGTTTTGAAGACGGAGGG + Intronic
1093888301 12:24488994-24489016 TTGCTTGCCTAGAAGACAAATGG - Intergenic
1094394625 12:29992460-29992482 CTGCTGGCTTTGAAGACCAAGGG - Intergenic
1095425895 12:42074494-42074516 CTGCTTGGTTTGAAGAGAAAGGG + Intergenic
1095651200 12:44611507-44611529 CTGCTTTCTTTGCAGAGTGAGGG - Intronic
1096281062 12:50254180-50254202 CTGCTGGATTGGAAGACAGTTGG + Intronic
1096483474 12:51959315-51959337 CTGCTTGCTTCCAAGCCAGCTGG - Intronic
1096510661 12:52126194-52126216 CTGGTTGCTCTGAAGGCTGATGG + Intergenic
1097201638 12:57283907-57283929 CTGCTAGCTTTGGTGACAGGGGG + Exonic
1097610568 12:61814830-61814852 CTGCTGGCTTTGAAGATGAAGGG + Intronic
1098611086 12:72459117-72459139 TTGCTGGCTTTGAAGATAGAAGG - Intronic
1098831995 12:75374721-75374743 CTGCTTGCTTTGCCAACTGAAGG + Intronic
1099084124 12:78223932-78223954 TTGCTGGCTTTGAAGATACAGGG - Intergenic
1099362986 12:81729790-81729812 ATTGTTGGTTTGAAGACAGATGG + Intronic
1099419857 12:82443684-82443706 CTGCTTTCATTCATGACAGAAGG + Intronic
1099923004 12:88982478-88982500 TTACTGGCTTTGAAGACAGAGGG - Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1100667698 12:96772421-96772443 CTGCTGGCTTGGAAGATAAAGGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102713290 12:114947592-114947614 CTCCTAGCTCTGAAGAGAGAAGG + Intergenic
1103379099 12:120480063-120480085 ATGCTTGTTTGGAAGACAGAAGG + Intronic
1104222272 12:126796539-126796561 CTGCTGGCTTTGAAAATAGAGGG - Intergenic
1104927937 12:132323331-132323353 CTGCTGCGTTTGCAGACAGAAGG + Intronic
1106485104 13:30165397-30165419 CTGGTTGCTGTGAAGATTGAAGG + Intergenic
1106875399 13:34066563-34066585 CTGCCTGCTTTGAAGCCAGCAGG + Intergenic
1107340032 13:39396010-39396032 CTGCCTGCTATGAAGGCATAGGG + Intronic
1107539144 13:41369729-41369751 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1107619105 13:42206684-42206706 TTGCTGGCTTTGAAGATGGAGGG - Intronic
1108317833 13:49255170-49255192 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1109147320 13:58795860-58795882 ATGCTGGCTTTGAAGACAGAGGG + Intergenic
1109723932 13:66315055-66315077 TTGCTGGCTTTGAAGACAAAGGG + Intronic
1110100387 13:71593546-71593568 ATGCTTGCTTTGAATACATCTGG - Intronic
1110404393 13:75133658-75133680 CTGCTAGCTTTGAAGATAGAGGG - Intergenic
1110442683 13:75542836-75542858 TTGCTGATTTTGAAGACAGATGG + Intronic
1110799331 13:79676629-79676651 CTGCTTGTTATTAAGGCAGATGG + Intergenic
1111889113 13:94059698-94059720 CTGCTTGCTTTATATAAAGATGG + Intronic
1112115076 13:96343394-96343416 TTACTTGCTTTGAAGATAAAAGG - Intronic
1114345914 14:21794902-21794924 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1114688544 14:24558529-24558551 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1115272286 14:31566822-31566844 TTGCTGGCCTTGAAGACAGAAGG + Intronic
1115383939 14:32773679-32773701 TTGCTTGATTTCACGACAGAGGG - Exonic
1115460481 14:33654643-33654665 ATACATGCTTTGAAGGCAGATGG - Intronic
1116597778 14:46874008-46874030 CTGATTGCTATGAACACAAAAGG + Intronic
1117410188 14:55443392-55443414 TTGCTGGCTTTGAAGATAAATGG + Intronic
1117471108 14:56045946-56045968 TTGCTTGGTTGGAAGGCAGATGG - Intergenic
1117792245 14:59353333-59353355 GTGCTCACTATGAAGACAGAGGG + Intronic
1118862710 14:69677167-69677189 CAGCTTGATTTGAAGGCAGGTGG + Intronic
1119687618 14:76645140-76645162 CTCCTTGCTGTTCAGACAGAAGG + Intergenic
1119868187 14:77991511-77991533 CTTCTTGATGTGAAGTCAGAGGG + Intergenic
1120023183 14:79553117-79553139 CTGATTGCTTTGAACAAAGAAGG - Intronic
1120378777 14:83746558-83746580 CAGCTTACTTTTAAAACAGATGG - Intergenic
1120511901 14:85425431-85425453 CTGATGGCTTTGAAGAGATAAGG - Intergenic
1121035404 14:90699220-90699242 CTCCTTGGTTTGATCACAGAGGG - Intronic
1121794879 14:96726479-96726501 CTGCTGGCTTTGAAGGTGGAGGG + Intergenic
1122613853 14:103003405-103003427 GGGCTTGCTTTCAGGACAGATGG - Intronic
1124033810 15:26034916-26034938 TTGCTTGTTTTGAAAACAGATGG - Intergenic
1124154537 15:27214161-27214183 AGGGTTGCTGTGAAGACAGAAGG + Intronic
1124627925 15:31319947-31319969 TTGCTGGCTTTAAAGACAAAGGG - Intergenic
1125287585 15:38110454-38110476 TTGCTGGCTTGGAAGATAGAGGG + Intergenic
1125832210 15:42725071-42725093 TTGCTTCCTTTCAGGACAGATGG + Intronic
1126522959 15:49617969-49617991 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1126669491 15:51103150-51103172 CAGATTGCTTTGAACACCGAAGG - Intronic
1129100296 15:73255833-73255855 CTGTTTGCTTGCAAAACAGATGG - Intronic
1130959673 15:88651518-88651540 TTGCTGGCTTTGAAGATGGAGGG - Intronic
1131119987 15:89815976-89815998 CTGCTGGCTTTGAAGATGGATGG - Intergenic
1133050989 16:3117293-3117315 CTGCTTGCCCTGGAGAGAGATGG + Intronic
1133290032 16:4714248-4714270 CTGCTGGCTGGGAAGACAGAAGG + Intronic
1133657850 16:7883703-7883725 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1134073989 16:11277744-11277766 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1134387950 16:13791907-13791929 CTACTGGCTTTGAAGATAGAAGG - Intergenic
1134807265 16:17136793-17136815 CTGCTTGCTGTGAACACATGAGG + Intronic
1135420200 16:22300649-22300671 CTGTCTGCTGTGCAGACAGAGGG - Intronic
1135806343 16:25546166-25546188 CTGCTGGCTTTAAAGATGGAAGG - Intergenic
1135807610 16:25556739-25556761 CTGCTGGCTCTGAAGAGAGCAGG + Intergenic
1135828332 16:25750391-25750413 CTTCTTGCCTTGAACACAGTTGG - Intronic
1136012160 16:27370858-27370880 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
1137517441 16:49159547-49159569 TTGCTTGCTTTGAAAACATTTGG + Intergenic
1138135791 16:54521377-54521399 AGGCTGGCTTTGAACACAGATGG + Intergenic
1138620040 16:58203752-58203774 TTGCTGGCTTTGAAGACGGAAGG + Intergenic
1138767223 16:59618718-59618740 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
1140743734 16:77963340-77963362 CTGCTGGCTTTGAAGACGGTGGG + Intronic
1140758280 16:78088577-78088599 TTGCTGGCCTTGAAGACAGAAGG - Intergenic
1140986891 16:80166376-80166398 ATGCTGGCTTTGAAGATGGAGGG + Intergenic
1141084371 16:81081172-81081194 CTGTCTGCTTTGAAAATAGATGG - Intergenic
1141757019 16:85998010-85998032 CTTTTTGCTTTGAAGTGAGAAGG - Intergenic
1142066373 16:88065303-88065325 CTGCTGGCTTTGAAGACGGATGG - Exonic
1143304525 17:5935615-5935637 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1143809246 17:9457368-9457390 TTGCTGGCTTAGAAGATAGAAGG - Intronic
1143901621 17:10178752-10178774 CTTCTTGCTTTGAAAAGAGGAGG - Intronic
1144080272 17:11758002-11758024 CTGCTTGCCCTGTACACAGAAGG - Intronic
1145768815 17:27478046-27478068 CTCCTTCCTTTGAAGCTAGAGGG - Intronic
1146414734 17:32621530-32621552 CTCCTAGCTTAGAAGACTGATGG + Intronic
1146424350 17:32722473-32722495 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1146909135 17:36637014-36637036 CTGCTTCCTCTGCATACAGATGG - Intergenic
1146913486 17:36663367-36663389 CTTCTTTCTTTCAAGATAGATGG + Intergenic
1147034525 17:37670443-37670465 CTGCTGGCTTTGAAGTCACAGGG + Intergenic
1148625354 17:49065183-49065205 CGGCTGGCTTTGGAGATAGAAGG - Intergenic
1149068989 17:52517449-52517471 TTGCTGGCTTTGAAGAGGGAGGG + Intergenic
1152375391 17:79916100-79916122 CTGCTTGCTTTGAGGGGAGCCGG + Intergenic
1152575040 17:81136296-81136318 CTGCTGGCTCTGAGGACAGGAGG - Intronic
1153312124 18:3687013-3687035 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1153545982 18:6205215-6205237 CTGCTGGCTTTGAATATGGATGG + Intronic
1154055834 18:11013296-11013318 TTGCTGGCTTTGAAGACAGAAGG + Intronic
1154248888 18:12726191-12726213 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1155339181 18:24796827-24796849 ATGCTTGCTTCTATGACAGATGG + Intergenic
1155444925 18:25901067-25901089 CTGCTGGCTTTGAATACAGAGGG + Intergenic
1156293470 18:35770278-35770300 CTGCTGCCTCTGAAAACAGATGG + Intergenic
1156485918 18:37465561-37465583 CTGCTTTGCTTGAAGACAGTGGG + Intronic
1158753896 18:60299520-60299542 TTGCTTGTTGTGAAGATAGAAGG + Intergenic
1159333687 18:67035359-67035381 CTCGTGGCTTTGAAAACAGAAGG + Intergenic
1159346556 18:67214220-67214242 TTGTTTGCTTTGAAGACTGAAGG - Intergenic
1160124052 18:76154428-76154450 CTGCTTTCTTCTAAGACAAACGG + Intergenic
1160166984 18:76522415-76522437 TTGCTTGCTTTCAAAACAAACGG - Intergenic
1160312196 18:77805659-77805681 ATGCTTACATTAAAGACAGAGGG - Intergenic
1160351224 18:78181093-78181115 CTGGCTGCTTTGAAAACAGGTGG - Intergenic
1160681938 19:415849-415871 CTGCTTTCTCTGCAGACAGCAGG - Intergenic
1162737344 19:12753925-12753947 TTGCTTGCTGTGAAGGCATAGGG - Intronic
1164047483 19:21555201-21555223 CTGCTGGCTCTGAAGAGAGCAGG - Intronic
1164682818 19:30146882-30146904 CAGCTTGCTTCGAATGCAGAGGG + Intergenic
1165155570 19:33785145-33785167 TTGCTGGCTTTGAAGACAGTGGG + Intergenic
1166387298 19:42389400-42389422 ACCCTTGCTTCGAAGACAGACGG - Intronic
1166398398 19:42459547-42459569 CTGCTGGCTTTGAAGATGGAAGG + Intergenic
1166785016 19:45362517-45362539 CAGCTGGCTTTGAAGCCAGGTGG + Intronic
1167767415 19:51492687-51492709 CTGCTTGACTTGCAGACAGAGGG + Intronic
925683893 2:6452055-6452077 AAGCTTGCTTTGAAGGGAGAAGG - Intergenic
925811357 2:7703866-7703888 CTGCTTGCTTTAAATAGAGAGGG - Intergenic
925929724 2:8697317-8697339 CTGCTGGCTTTGTAGATAGAGGG + Intergenic
926559035 2:14394947-14394969 CTGCTGATGTTGAAGACAGAGGG + Intergenic
926591067 2:14740867-14740889 CTGCTGGCTTTGAAGATGGGAGG + Intergenic
926665068 2:15512660-15512682 CCGCTGGCTTTGAAGGTAGAAGG + Intronic
926938013 2:18105394-18105416 CTGATTCCTTTAAAAACAGAAGG - Intronic
927758885 2:25732306-25732328 TTGCTTCCTTCGAAGACAGATGG + Intergenic
927911978 2:26906089-26906111 TTGCTGGCTTTGAAGATGGAAGG - Intronic
927928536 2:27029270-27029292 TTGTTGGCTTTGAAGACAGAAGG + Intergenic
928140164 2:28721604-28721626 CTTTTTGTTTTGAAGACATAGGG - Intergenic
930501077 2:52218322-52218344 CTTCCAGCTCTGAAGACAGAGGG + Intergenic
932049986 2:68388846-68388868 CTGGTTGCTTTGAAGGGAGGAGG - Intronic
932829472 2:74975110-74975132 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
932837642 2:75051974-75051996 CTGCTTGGTTTTGAGACTGAAGG + Intronic
933221521 2:79695599-79695621 CTTCATGTTTTGAAGACAGAGGG - Intronic
933362218 2:81302704-81302726 TTGCTGGCTTTGAAGACGGAGGG - Intergenic
933616941 2:84491816-84491838 CTGCCTATTTTTAAGACAGAGGG + Intergenic
933647991 2:84827813-84827835 TTGCTGGCTTTGAAGATGGAAGG + Intronic
934890165 2:98060705-98060727 ATGGTTGCTGTGAAGACAAATGG - Intergenic
935029750 2:99310713-99310735 TTGCTGCCTTTGAAGATAGAGGG + Intronic
935050932 2:99524484-99524506 TTGCTGGCTTTGAAGATAGAGGG + Intergenic
935261689 2:101361478-101361500 TGGCTGGCTTTGAATACAGAAGG + Intronic
935961547 2:108430043-108430065 CTGCTGGCTCTGAAGAGAGCAGG + Intergenic
936704823 2:115059481-115059503 ATGCTAGCTTTGTAGACACATGG + Intronic
936902139 2:117493469-117493491 TTGCTGGCTTTGAAGACACAGGG + Intergenic
937269154 2:120636803-120636825 TTGCTGGCTTTGAAGATAGAAGG + Intergenic
937470609 2:122171025-122171047 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
938707073 2:133941430-133941452 ATGCTTGATAGGAAGACAGATGG - Intergenic
938883163 2:135613339-135613361 TTGATGGCTTTGAAGATAGAGGG - Intronic
939059863 2:137408777-137408799 TTGCTGGCTTTGAAGACGGAGGG - Intronic
939408979 2:141799406-141799428 CTGCTTGGTTTGAAAATGGAGGG + Intronic
939805174 2:146766881-146766903 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
940240910 2:151562303-151562325 CTTATTGCTTAGAAGACATAGGG + Intronic
940583101 2:155606735-155606757 CTGCTTGGTTTTAACAAAGATGG - Intergenic
941114100 2:161451745-161451767 TTGCTGGCTTTGAAGATGGAAGG + Intronic
941320828 2:164052136-164052158 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
941680306 2:168391121-168391143 GTGTTTTCTTTGAAGAAAGAAGG + Intergenic
941857846 2:170248630-170248652 CTGGTGGCTTTTAAGATAGAAGG - Intronic
941940844 2:171035801-171035823 CTGCTGGCTATGAAGACGGAAGG + Intronic
942003201 2:171671393-171671415 TTGCTGACTTTGAAGATAGAAGG + Intergenic
942303709 2:174586434-174586456 GTGCTTGCTCTGAAAACAAAGGG + Intronic
943169697 2:184382395-184382417 CATCTGGCTTTGAAGATAGAGGG + Intergenic
943206663 2:184906905-184906927 GTGCTGGCTTTGAAGATGGAAGG + Intronic
943322184 2:186458136-186458158 ATGCTGGCTTTGAATATAGAGGG + Intergenic
944618641 2:201488689-201488711 CTGCTTGATTTGAACACAGGTGG + Intronic
944997127 2:205306104-205306126 CTGCTGGCTTTCAAGATGGAGGG + Intronic
946125024 2:217555178-217555200 CTGCCTGCCTTGCAGAGAGATGG - Intronic
946561159 2:220915465-220915487 CTGCTTGCTGAGAAGATACAGGG - Intergenic
947094332 2:226548982-226549004 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
947968194 2:234299991-234300013 ATGCTGGCTTTGGAGACTGAGGG - Intergenic
948015451 2:234686598-234686620 CTGCTGGCTTTGAAGGTGGAGGG + Intergenic
1169499492 20:6145760-6145782 TTGCTGGCTTTGAAGACAGAAGG + Intergenic
1169510251 20:6256031-6256053 CAACTTGCTTTGGAGACAGTGGG + Intergenic
1169524912 20:6413774-6413796 TTGCTGGCTTTGAAGATAGAAGG + Intergenic
1169744372 20:8928579-8928601 CTGGTTACTTGGAAGAAAGAGGG - Intronic
1169744669 20:8931599-8931621 GTGCTAGCTTTGAAGACAAAGGG - Intronic
1169750310 20:8985697-8985719 CAGAGTACTTTGAAGACAGAGGG + Intergenic
1169844460 20:9974555-9974577 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
1170142907 20:13142854-13142876 TTGCTGGCTTTGAAGATGGAGGG - Intronic
1171072493 20:22087763-22087785 CCCTTTGCTTTGAAGACATAAGG + Intergenic
1171233658 20:23507829-23507851 CTGCAGGCTTGAAAGACAGAAGG + Intergenic
1171438461 20:25141994-25142016 CTGGTGGCTTTGTAGAGAGATGG - Intergenic
1173134486 20:40427265-40427287 TTGCTGGCTTTGAAGACGGAAGG - Intergenic
1173327215 20:42044958-42044980 CTGCTAGCTTTGAAGGCAGAAGG - Intergenic
1173621398 20:44439626-44439648 TTGCTGGCTTTGAAGACAAGGGG + Intergenic
1173804636 20:45916190-45916212 TTCCTGGCTTTGAAGACTGAAGG + Intergenic
1174140449 20:48409610-48409632 CTGCTTAATTTGAAGAGAGGAGG - Intergenic
1174142897 20:48429024-48429046 CTGCTGGCTTTGAGGATGGAAGG - Intergenic
1174661089 20:52213826-52213848 CTGTTGGCTTTGAAGATGGAAGG - Intergenic
1174983151 20:55420047-55420069 CTACATGATTTGAAGATAGAGGG - Intergenic
1175277995 20:57784911-57784933 CTTCTTGCTTGGCAGCCAGATGG - Intergenic
1175391230 20:58628647-58628669 CAGCTTGCCTAGAAGTCAGAGGG - Intergenic
1175785860 20:61711499-61711521 CTGCTAGCTTTGAGGGTAGAAGG - Intronic
1176261817 20:64185835-64185857 CTCCTTGCCATGACGACAGAAGG + Intronic
1177282681 21:19004087-19004109 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1177714302 21:24819134-24819156 CCTCTGACTTTGAAGACAGATGG + Intergenic
1177860418 21:26446404-26446426 GTGCTGTCTTTGAAGACGGAGGG + Intergenic
1178258115 21:31073965-31073987 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
1179165901 21:38934917-38934939 GTGGTTGCTTTAAAGACGGAGGG + Intergenic
1179336528 21:40461797-40461819 TTGCTGGCTTTGCAGAGAGAAGG + Intronic
1179340374 21:40502585-40502607 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1180110743 21:45648013-45648035 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1182621769 22:31622369-31622391 CTTCTTCCTGTTAAGACAGAGGG - Intronic
1183125168 22:35771338-35771360 TTGCTGGCTCTGAAGACAGAAGG + Intronic
1184206442 22:43006953-43006975 CTGCTTCCTAGGAACACAGATGG + Intronic
1184416294 22:44353629-44353651 CTGCTTGCTGAGAATAGAGAGGG - Intergenic
1184908958 22:47513120-47513142 CTGCCTGCTTTGCAGAAAGTTGG + Intergenic
950467133 3:13162237-13162259 CTGCCTTCTTGGAAGACAGAGGG + Intergenic
950550514 3:13663374-13663396 CTGCTGGCTTTGAGGATGGAGGG - Intergenic
950822729 3:15778562-15778584 TTGCTGGCTTTGAAGATGGAGGG - Intronic
951427361 3:22563299-22563321 CTGCTGGCTTTAGAGACAGAAGG + Intergenic
952180583 3:30912523-30912545 CTGCTAGCTTTGAAGATAGAGGG - Intergenic
952853560 3:37749216-37749238 TTGCTGGCTTTGAAGATGGAAGG - Intronic
953366773 3:42351984-42352006 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
953531775 3:43746045-43746067 CTGCTGGCTTTGAAGATGGAGGG + Intergenic
956025913 3:64983107-64983129 CTGCTTGCTGTAAAGCCAGTTGG + Intergenic
956202180 3:66718020-66718042 CTGCTTCCTATTAAGACACAAGG + Intergenic
956721969 3:72125890-72125912 CTCCTGGCTTTGAAGATGGAGGG + Intergenic
957583110 3:82101920-82101942 CTACTGGCTTTGAAGACTGAAGG - Intergenic
958089902 3:88863866-88863888 TTTCCTGCTTTGAAGAAAGAAGG + Intergenic
959007164 3:101033174-101033196 ATACTTGCTCTGAAGACTGAGGG + Intergenic
959123068 3:102255934-102255956 TTGCTGGCTTTGAAGATGGAAGG + Intronic
959881148 3:111446648-111446670 CTGCTGGCTCTGAAGAGAGCAGG - Intronic
959980217 3:112507698-112507720 ATGCTGGCTTTGAAGATAAAGGG - Intergenic
960305397 3:116054157-116054179 CTGCTGGCTTTGAAGATGGAAGG - Intronic
960584486 3:119308478-119308500 TGGTTGGCTTTGAAGACAGATGG - Intronic
961319866 3:126064984-126065006 CTGCTGCCTTTGAAGATGGAAGG + Intronic
961578144 3:127855426-127855448 CTGCTGGCTCTGAAGATGGAGGG - Intergenic
961648121 3:128403459-128403481 CTGCCTGCCTTGGAGACACAGGG + Intronic
961733691 3:128986799-128986821 ATGCAGGCTTTGAAGCCAGACGG - Intronic
963008290 3:140746837-140746859 CTACTGGCTTTGAAGAAGGAGGG - Intergenic
963826337 3:149958365-149958387 CTACTGGCTTTGAAGATAGGGGG - Intronic
964285226 3:155110216-155110238 CTCCCTGCTTTGAATGCAGAAGG - Intronic
964817321 3:160730864-160730886 CTGCTGGCTTTGAAGAGGGAAGG - Intergenic
964914404 3:161822521-161822543 CAGCATGCTTTGGTGACAGATGG - Intergenic
965551502 3:169969924-169969946 TTGCTTGCCAGGAAGACAGATGG - Intronic
965721977 3:171672063-171672085 CTGCTTGCTCAGAAGACAAAAGG - Intronic
966538834 3:181066245-181066267 TTGTTTGCTCTGAAGAGAGAAGG - Intergenic
968874311 4:3257289-3257311 CTGCTCGCTTGGCAGCCAGAGGG - Intronic
969143310 4:5099136-5099158 TTGCTGGCTTTGAAGACAGGAGG - Intronic
969828911 4:9780210-9780232 CTGCCTGCTGGGAAGACAGAGGG + Intronic
970179012 4:13368647-13368669 CTGTTTTCTTTTATGACAGAGGG - Exonic
970850183 4:20592852-20592874 ATGCTTGCTTTGCAGCCAGTTGG - Intronic
971766046 4:30833367-30833389 CTGCTGACTTTGAAGATGGAAGG - Intronic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
972434115 4:39015439-39015461 TTGCTGGCTTTGAAGATGGAAGG + Intronic
972910939 4:43816262-43816284 CAGCTAGCTTTGAATGCAGAAGG + Intergenic
972957755 4:44413926-44413948 CTGCTGGCTTTGATGACAGAAGG + Intronic
973219391 4:47708311-47708333 TTACTGGCTTTGAAGACAAAGGG - Intronic
974070956 4:57123132-57123154 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
974071057 4:57123973-57123995 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
975185769 4:71400474-71400496 TTGCTGGCTTTGAAAACAAAAGG - Intronic
975751067 4:77524250-77524272 CTGCCTTCTCTGAAGAGAGAAGG - Intronic
976877408 4:89871395-89871417 TTCCTGGCTTTGAAAACAGAGGG - Intergenic
976944267 4:90745231-90745253 TTGCTGGTTTTGAAGATAGACGG - Intronic
977494752 4:97760945-97760967 CTGCTGGCTTTGAAGACTGATGG - Intronic
978094517 4:104759350-104759372 CTGCTTGGTTTGAATTCATATGG + Intergenic
978779873 4:112540530-112540552 GTGTATGCTTTGTAGACAGATGG - Intronic
978941158 4:114437310-114437332 CTGCTGGCTTTGAAGATGTAGGG + Intergenic
979022824 4:115524841-115524863 CTGCTGGCTCTGAAGAGAGCAGG - Intergenic
979164537 4:117511068-117511090 ATGCTTGCTTTAAAGATAAAGGG + Intergenic
979815663 4:125100625-125100647 TTGATGGCTTTGAAGACAGAAGG + Intergenic
979927947 4:126591147-126591169 CTGATTGATTAGATGACAGATGG - Intergenic
980074686 4:128282667-128282689 CTTCTTGCTTTGAAGCCAACTGG - Intronic
981633666 4:146850352-146850374 ATGCTGTCTTTGAAGCCAGATGG - Intronic
981671590 4:147293059-147293081 CTGCCAGCTCTGAAGACAGCAGG + Intergenic
981673445 4:147313793-147313815 TTGCTAACTTTGAAGAGAGAAGG - Intergenic
981941214 4:150283262-150283284 CTCCTTGCTGTGAAGGCAGCAGG - Intronic
982323930 4:154109379-154109401 CTGCTGGCTCTGAAGAGAGCAGG + Intergenic
983090619 4:163497591-163497613 CTGCTGGATTTGAAGAGGGAAGG - Intronic
983111838 4:163760165-163760187 CTGCTGGCTGTGAAGATGGAAGG - Intronic
983378628 4:166962040-166962062 CTGCCTTCTTTGAAGAAGGAAGG - Intronic
983568489 4:169179223-169179245 TTGCTGGCTTTGAAGACAAAAGG + Intronic
983608292 4:169615062-169615084 CTGCCTGCTTTCTAGAAAGAAGG - Intronic
984402311 4:179282203-179282225 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
984552691 4:181179950-181179972 ATGCTTGATTTGTAGTCAGATGG - Intergenic
984552982 4:181182712-181182734 TTGCTGGCTTTGAAGACAAAAGG + Intergenic
984855440 4:184191141-184191163 CTGCTTCCTTAGAAGTCAGAAGG + Intronic
985170166 4:187140191-187140213 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
985434354 4:189914652-189914674 TTACTGGCTTTGAAGATAGAGGG + Intergenic
985561542 5:589188-589210 ATTTTGGCTTTGAAGACAGAAGG + Intergenic
986283129 5:6339701-6339723 CTGCCAGCTCTGAAGACAGAAGG + Intergenic
986549405 5:8935879-8935901 CTGCTTGTCTTGGAGACAGCAGG + Intergenic
986796354 5:11216470-11216492 TTGCTGGCTTTGAAGAGTGAAGG + Intronic
986829182 5:11557509-11557531 GTGCTGGCTTTGAAGACGGAGGG - Intronic
987041709 5:14068961-14068983 CTGCTGGCTCTGCAGAGAGAGGG + Intergenic
988084191 5:26452884-26452906 CTGCTGCCTTTGAAAACACATGG + Intergenic
988252518 5:28778311-28778333 CTGCTGGCTTTGAAAATGGAGGG - Intergenic
988450994 5:31342999-31343021 CTCCTAGCTTTGAAGATGGAGGG - Intergenic
989516794 5:42353451-42353473 CTGCCTGTTGTGAAGACTGAGGG - Intergenic
990179791 5:53147811-53147833 CTGCCTGTTTTGCAGGCAGAGGG + Intergenic
990728773 5:58785908-58785930 TTGCTGGCTTTGAAGATAGAAGG + Intronic
991417998 5:66411366-66411388 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
992077702 5:73206395-73206417 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
993267535 5:85744947-85744969 CTTCGTGCTTGGAACACAGAGGG - Intergenic
993569042 5:89513051-89513073 TTGGTTACTTTGAAGCCAGAAGG + Intergenic
994697735 5:103093363-103093385 TTGTTGGCTTTGAAGATAGAGGG + Intronic
995215020 5:109585216-109585238 CTGCTTCCTTTGAAGAAATGTGG + Intergenic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
996151029 5:120035026-120035048 CTGCTGGATTTGAAGAGTGAAGG - Intergenic
996595980 5:125203381-125203403 CTGCTTGCTTAGAATATAGTAGG + Intergenic
996901698 5:128549712-128549734 CTGTTTTCTTTGAAAACACATGG + Intronic
997604123 5:135161818-135161840 CCAGTGGCTTTGAAGACAGAAGG - Intronic
999403501 5:151285803-151285825 CTGCTAGCTTTGAAGATGGAAGG + Intronic
999555576 5:152738783-152738805 CTGCTTGCTAAGAATCCAGAAGG + Intergenic
999811753 5:155134046-155134068 ATGTATGCTTTGAAGACTGAAGG + Intergenic
1000882443 5:166713860-166713882 CTGCTTCCTCTCAAGGCAGAAGG + Intergenic
1001176396 5:169472867-169472889 GTGCTGGCTTTGAAGATGGAAGG - Intergenic
1001430320 5:171655881-171655903 ATACCTGCTTTGCAGACAGATGG - Intergenic
1002529163 5:179833634-179833656 CCACTTCTTTTGAAGACAGATGG - Exonic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1003471400 6:6438157-6438179 CTGGTGGCTGTGAAGATAGATGG - Intergenic
1004459543 6:15822912-15822934 TGGTTGGCTTTGAAGACAGAGGG - Intergenic
1004476355 6:15976736-15976758 CTGGCTGCTTTGAAGGCAAAGGG - Intergenic
1004797124 6:19099167-19099189 CTGCTTGCTATAAAAACAGCAGG - Intergenic
1004905625 6:20234718-20234740 CTGCTGGCTTTGAAGATGGAAGG - Intergenic
1006515908 6:34545418-34545440 CTGCTTGTGTTGAGGCCAGATGG - Intronic
1006964268 6:37966107-37966129 CTGCATGGTTTGTAGACAAAGGG + Intronic
1007010762 6:38415349-38415371 TTGCTAGCTTTGAAGAGGGAAGG + Intronic
1007566310 6:42853494-42853516 CTGCTTGCTGTGAAGAAGGAGGG - Intronic
1007580969 6:42959978-42960000 CTGCTTCCTGTGAAAGCAGAGGG + Intergenic
1007599830 6:43074956-43074978 CTGCTGGCTTTTCAGTCAGAGGG + Exonic
1008028262 6:46663408-46663430 CTACATGCTTTGAAGGCTGAAGG - Intronic
1008045207 6:46844777-46844799 CTGCTTCCTTTGCAGGTAGATGG + Intergenic
1008375040 6:50781854-50781876 TTGCTGGCTTTGAACACAAAGGG - Intergenic
1008757514 6:54815400-54815422 TTGCTGGATTTGAAGACATAAGG - Intergenic
1009486219 6:64225535-64225557 TTGCTTTCTTTGAAAATAGATGG + Intronic
1011527493 6:88280943-88280965 CTGGTTGCTTTGAAAATGGATGG + Intergenic
1011877295 6:91976817-91976839 CTCCTGGCTTTGAAGAGAGGAGG + Intergenic
1012279584 6:97312924-97312946 GTGCTGGATTTGAAGACAGAGGG + Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1012497073 6:99845111-99845133 CAGTTTGCTTTCAAGACACATGG - Intergenic
1012557735 6:100536414-100536436 TTCCTTGCTTTGTACACAGAGGG + Intronic
1012660036 6:101876770-101876792 CTGATTGATTTGAGAACAGAAGG - Intronic
1012815749 6:104019527-104019549 CTGCTGGCTTTGGTTACAGAGGG + Intergenic
1013287325 6:108692723-108692745 CTGCCGGCCTTGAAGACGGAGGG + Intergenic
1014756317 6:125305124-125305146 TTGCTGGCTTTGAAGATAGAAGG + Intergenic
1015885346 6:137911953-137911975 CTGCTTGGCTTGAAGGGAGAAGG - Intergenic
1016347652 6:143131562-143131584 TTGCTGGCTTTGAAGATGGAAGG + Intronic
1016363460 6:143291736-143291758 CTGCTTTCCTTGAACACAGCAGG - Intronic
1016377751 6:143441004-143441026 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1016598708 6:145831289-145831311 CTGCTTTCTTTGTAAAGAGATGG + Intergenic
1016939349 6:149471654-149471676 TTGCTGGCTTTGAAGATAGAAGG + Intronic
1017685741 6:156912569-156912591 CTTTTGGGTTTGAAGACAGAGGG - Intronic
1018966318 6:168492353-168492375 GTTCTTGCTTTGAAAATAGAAGG - Intronic
1020550014 7:9592143-9592165 CTGTTTACTCTGAAGATAGATGG - Intergenic
1020659525 7:10965924-10965946 CTGCCTGCTGTGAAGACTGTGGG + Intergenic
1020791833 7:12636719-12636741 TTGCTAGCTTTGAGGATAGAAGG + Intronic
1021757931 7:23873485-23873507 CAGCTGGCTTGGAAGACAGCTGG + Intergenic
1021837690 7:24696485-24696507 CTGCTGGCTCTGAAGATGGAAGG - Intergenic
1021970365 7:25959795-25959817 GTGCTTGCTTCGAAGTCTGAAGG + Intergenic
1022114584 7:27250906-27250928 CTGTTTGCTTTGTAGACAGTAGG - Intergenic
1023047193 7:36220402-36220424 CTCCTTGCTTTGAAGACATCTGG + Intronic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024534200 7:50416616-50416638 CTGCATGCTTCGAATACTGAAGG - Intergenic
1026177505 7:68010671-68010693 CTGCTTCCCCTCAAGACAGAAGG - Intergenic
1026455229 7:70566251-70566273 CTGCTTGACTAGGAGACAGAAGG - Intronic
1026613577 7:71882210-71882232 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1027765816 7:82340029-82340051 CTGCTGGCTTTGAAGACCAAGGG + Intronic
1030022677 7:105291378-105291400 CTACTTTCTTTAAAGACAGAGGG + Intronic
1030694976 7:112575100-112575122 TTGTTGACTTTGAAGACAGAAGG - Intergenic
1030746814 7:113175722-113175744 CTGCTGGCTTTGAAGTTGGATGG - Intergenic
1030837399 7:114306835-114306857 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1030985703 7:116239176-116239198 GTGCTGGCTTTGAAGATGGAAGG - Intronic
1031331024 7:120464814-120464836 TTGCTGGCTTTGAAGATGGACGG - Intronic
1031550984 7:123111244-123111266 TTGCTGGCTTTGAAGATAAAAGG - Intergenic
1031822110 7:126515687-126515709 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1031849157 7:126842714-126842736 TTGCTGGCTTTGAAGATAGAAGG + Intronic
1031869907 7:127080217-127080239 TTGCTGGCTTTGAAGATAGAAGG + Intronic
1033068567 7:138180255-138180277 CTGCTGTCTTTGAAGATGGAAGG + Intergenic
1034242944 7:149624020-149624042 AGGCTTGCTGTGAGGACAGAAGG + Intergenic
1034853641 7:154519709-154519731 TTGTTTGCTTTTAAGTCAGAAGG + Intronic
1037743662 8:21626870-21626892 CTGCTGGCTTTGAAGTTGGAAGG - Intergenic
1037779087 8:21855546-21855568 CTGTTTGCATTGATGACAGTGGG - Intergenic
1039135374 8:34316769-34316791 TTGCTGGCTTTGAAGATGGAGGG - Intergenic
1040395097 8:46991159-46991181 CTGCTTTCTTTGAAAAAACAAGG - Intergenic
1040538630 8:48331698-48331720 CTGCCTGGTTAGAAGACTGAAGG - Intergenic
1041106184 8:54446186-54446208 GAGCCTGCTTTGGAGACAGAGGG + Intergenic
1041272637 8:56124086-56124108 TTGCTTCCTTTGAAGACTAAAGG - Intergenic
1041775619 8:61519736-61519758 CTGCTGGCTCTGAAGATGGAAGG + Intronic
1042109175 8:65361123-65361145 TTGCTAGCTTTGAAGATGGAAGG - Intergenic
1042174082 8:66021833-66021855 CTGCTTGCCATGAAGCCGGACGG + Intronic
1042355512 8:67823508-67823530 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1042820663 8:72926728-72926750 CTGCTTGCTATGGAGATAGAAGG - Intronic
1042936253 8:74061358-74061380 CTGTCTGCTTTGCAGAAAGAGGG + Intergenic
1043039884 8:75249841-75249863 ATGCTGGCTTTGAAGATAGACGG + Intergenic
1043103328 8:76075174-76075196 CTGCTAGCTTTGAAGGAGGAGGG + Intergenic
1043170474 8:76959664-76959686 ATGCTTGCCATGAAAACAGATGG + Intergenic
1043587050 8:81781620-81781642 CTGCTGGCTTTGAAGATGGGAGG - Intergenic
1043590599 8:81828788-81828810 TTGCTGGCTTTGAAGATGGAGGG + Intronic
1044000102 8:86868986-86869008 TTGCTGGCTTTGAAGATGGAGGG + Intronic
1045757556 8:105562637-105562659 CTGGTGGCTTTGAAGATGGAAGG - Intronic
1045882386 8:107056759-107056781 TTGCTGGCTTTGAAGATCGAAGG - Intergenic
1046806649 8:118486487-118486509 TTGCTGGCTTTGAAGATAGAAGG + Intronic
1047208895 8:122824920-122824942 CTGCTGGCTTTGAAGATGGACGG - Intronic
1047215655 8:122873853-122873875 TTGCTGGCTTTGAAGATGGAAGG - Intronic
1047295863 8:123570067-123570089 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1047660233 8:127025524-127025546 TTGCTGGCTTTGGAGAGAGAAGG + Intergenic
1048331397 8:133473114-133473136 CTGTGTTCTTTGAAGACACATGG + Intronic
1048514004 8:135088678-135088700 TTGCTGGCTGTGAAGATAGAGGG + Intergenic
1048958543 8:139556779-139556801 CTGCTGGCTTCCAAAACAGATGG + Intergenic
1049953989 9:674526-674548 CTGATTGCTTTGATCACACAGGG - Intronic
1051244261 9:15093236-15093258 TTGCTGGCTTTGAAGAGGGAAGG - Intergenic
1051396183 9:16624094-16624116 CTCCTTGCTGTGAAGAAATAAGG - Intronic
1052573036 9:30253589-30253611 TCTCTGGCTTTGAAGACAGAAGG - Intergenic
1052800935 9:32967571-32967593 CTGCCTGCTTAAAAGACAGAAGG + Intergenic
1053289778 9:36872311-36872333 CTGCTTGCTTAGAACAGAGGTGG + Intronic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053652357 9:40181962-40181984 CTGCTTCCTTTGCAGGTAGATGG - Intergenic
1053902753 9:42811274-42811296 CTGCTTCCTTTGCAGGTAGATGG - Intergenic
1054532225 9:66194253-66194275 CTGCTTCCTTTGCAGGTAGATGG + Intergenic
1055307245 9:74942687-74942709 CTGCTGGCTTTGAAGATGGAAGG - Intergenic
1055732519 9:79293015-79293037 TTGCTGGCTTTGAAGATGGAGGG + Intergenic
1056788860 9:89612449-89612471 TTGCTGGCTTTGAAGAGGGAGGG + Intergenic
1057303742 9:93900868-93900890 TTGCTGGTTTTGAAGACGGAGGG - Intergenic
1057958172 9:99428858-99428880 CTGCTGGCTTTGAAGATAGAAGG + Intergenic
1058196112 9:101978542-101978564 CTGCTGGCTTTGAAGACAGAAGG - Intergenic
1059607886 9:115855887-115855909 CTGCTTGCTCTAAAGATAAAGGG + Intergenic
1059860799 9:118459211-118459233 CTGCTGGCTTTGAAGATGTAAGG + Intergenic
1060918723 9:127405987-127406009 CAGCTTGCTCTTAAGACGGATGG + Intronic
1061074647 9:128333686-128333708 CTGCTTCCCTTGGAGGCAGAGGG + Exonic
1061222360 9:129259551-129259573 TTGCTGGCTTTGAAGACGGAAGG - Intergenic
1061295928 9:129676708-129676730 CTGCGGGCTTGGAAGCCAGAGGG + Intronic
1061957472 9:133971173-133971195 CTGCAAGCTTTGGAGACTGAGGG - Intronic
1062146373 9:134992015-134992037 CTGCTTCCTTTGCCGACAGCTGG - Intergenic
1185755145 X:2647315-2647337 CTGCTGGCTTTGAAGATGGAGGG - Intergenic
1186361080 X:8842407-8842429 TTGCTGGCTTTGAAGATGGAAGG + Intergenic
1186652092 X:11571950-11571972 TTGCTGGCTTTCAAGACTGAGGG + Intronic
1186792484 X:13012477-13012499 CTGCTGGCTTTGAAGATAGAGGG + Intergenic
1186810062 X:13179390-13179412 TTGCTTGCTGGGAAGCCAGAAGG + Intergenic
1186882085 X:13876661-13876683 CTGCTGACTCTGAAGGCAGAAGG + Intronic
1187082381 X:16004938-16004960 GAGCAGGCTTTGAAGACAGAAGG - Intergenic
1188205422 X:27350625-27350647 CATCTGGCTTTGAAGATAGAGGG - Intergenic
1188316739 X:28683807-28683829 CTGCTGGCTTTGAAGACAGAAGG - Intronic
1188546835 X:31317153-31317175 CTGCTTCCTTAAATGACAGAGGG + Intronic
1188576883 X:31662380-31662402 CTACTTGCTTTGCATTCAGAAGG - Intronic
1188790674 X:34404855-34404877 GTGCTTGTTCTGAACACAGAGGG - Intergenic
1188796606 X:34474262-34474284 CAGCATGCTTTGATGAAAGAAGG - Intergenic
1189057049 X:37708325-37708347 CTGCTGGCTTTGAAGATGGAGGG + Intronic
1189483057 X:41407878-41407900 CTGCTGGCTTTGACGATGGAGGG - Intergenic
1190296401 X:49030195-49030217 CTGCTGGCCTTGGAGACAGCAGG + Exonic
1191610049 X:63102433-63102455 CTGCTTGCTGTGCACAGAGAAGG + Intergenic
1191859039 X:65650893-65650915 TTGCTGGCTTTGAAGAGAGAAGG - Intronic
1192030757 X:67509786-67509808 CTGCTGGCTCTGAAGACAGCAGG + Intergenic
1192366475 X:70477868-70477890 CTGGTTGCTTTGCAGAGGGAAGG + Intronic
1194243910 X:91486368-91486390 CTGCTAGCTTTGTAGGGAGAAGG - Intergenic
1194794599 X:98195971-98195993 ATGTTTGCTTTGAGGACATAGGG + Intergenic
1195324258 X:103745243-103745265 ATGCTTGCTGTGAAGACTGTAGG + Intergenic
1195465248 X:105172578-105172600 TTGCTAGCTTTGAAGATGGAGGG - Intronic
1196778988 X:119365483-119365505 TTGCTTACTTTGAAGATGGAGGG - Intergenic
1197183075 X:123557537-123557559 CTGCTGGCTTTGAAGATGAAGGG + Intergenic
1198665546 X:139018364-139018386 CAGCTTGCATTAAAGACAAATGG + Intronic
1198853245 X:140988089-140988111 ATGCATGATTTGGAGACAGAAGG + Intergenic
1199012130 X:142770316-142770338 CTGCTGGCTCTGAAGAGAGCAGG - Intergenic
1199311237 X:146322313-146322335 TTGCTGGCTTTGAAGATGGAAGG - Intergenic
1199372557 X:147068448-147068470 CTGCTTGCATTTATGACAGAGGG + Intergenic
1200008818 X:153106611-153106633 TTGCTGGCTTTGAAGACGGAAGG - Intergenic
1200030782 X:153293311-153293333 TTGCTGGCTTTGAAGACGGAAGG + Intergenic
1200041915 X:153376757-153376779 CTGCTGGCTTTAAAGACAGAGGG + Intergenic
1200562890 Y:4727730-4727752 CTGCTAGCTTTGTAGGGAGAAGG - Intergenic
1200922579 Y:8626560-8626582 CTGCTTGCAATAAACACAGATGG + Intergenic
1200959543 Y:8984303-8984325 CTTCTTGCTTAGAGTACAGATGG - Intergenic