ID: 914669794

View in Genome Browser
Species Human (GRCh38)
Location 1:149860986-149861008
Sequence GGCGGCGTTAAGCGGATCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 2, 1: 0, 2: 4, 3: 4, 4: 20}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914669794_914669798 0 Left 914669794 1:149860986-149861008 CCAGAGATCCGCTTAACGCCGCC 0: 2
1: 0
2: 4
3: 4
4: 20
Right 914669798 1:149861009-149861031 ACGCCGAGCTAGACGCCGAATGG 0: 2
1: 0
2: 0
3: 2
4: 13
914669794_914669801 9 Left 914669794 1:149860986-149861008 CCAGAGATCCGCTTAACGCCGCC 0: 2
1: 0
2: 4
3: 4
4: 20
Right 914669801 1:149861018-149861040 TAGACGCCGAATGGCAGGCTTGG 0: 2
1: 0
2: 0
3: 5
4: 53
914669794_914669800 4 Left 914669794 1:149860986-149861008 CCAGAGATCCGCTTAACGCCGCC 0: 2
1: 0
2: 4
3: 4
4: 20
Right 914669800 1:149861013-149861035 CGAGCTAGACGCCGAATGGCAGG 0: 2
1: 0
2: 1
3: 5
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914669794 Original CRISPR GGCGGCGTTAAGCGGATCTC TGG (reversed) Exonic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
915474012 1:156141915-156141937 GGCTGAGGTAGGCGGATCTCAGG + Intergenic
1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG + Intronic
1083726283 11:64630281-64630303 GGCGGGGCTAAGCGGCTCTGGGG - Intronic
1083726290 11:64630302-64630324 GGCGGGGCTAAGCGGCTCTGGGG - Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1103392526 12:120584775-120584797 GTCGCCGTCCAGCGGATCTCCGG - Intergenic
1133878468 16:9757904-9757926 GGCAGCCTTATGGGGATCTCTGG + Intronic
1149626387 17:58083474-58083496 GGCGGCGTGAGGCGGAGCGCGGG + Exonic
1168223191 19:54975849-54975871 GGCTGAGGTAAGAGGATCTCTGG - Intronic
1168344475 19:55643685-55643707 GGCGGCGAGAAGGGGACCTCTGG - Intronic
1169131594 20:3168652-3168674 GGCTGCATTATGCAGATCTCTGG - Intronic
1179825850 21:43966116-43966138 GGCAGCCTTCAGCGGATCTCAGG - Intronic
966696315 3:182793638-182793660 GGCGGCGGTAAGCGGAACTTCGG + Exonic
977803491 4:101267583-101267605 GGAGGGGATAAGCGGATCTGAGG + Intronic
990465525 5:56067873-56067895 GGCTGAGGTAAGCGGATCACTGG - Intergenic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1022706909 7:32810396-32810418 GGCTGTGTTAGGAGGATCTCTGG + Intergenic
1049211587 8:141389069-141389091 GTCAGCGTTAAGTGGATTTCTGG - Intergenic