ID: 914675412

View in Genome Browser
Species Human (GRCh38)
Location 1:149904185-149904207
Sequence GAGGAGCCCTAGGCCAGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4782
Summary {0: 1, 1: 0, 2: 4, 3: 255, 4: 4522}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675412_914675425 22 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675412_914675422 11 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661
914675412_914675420 9 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675412_914675426 23 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675412_914675421 10 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
914675412_914675427 26 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675412_914675423 14 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675423 1:149904222-149904244 CACAGAAACCAGATTAGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 197
914675412_914675428 30 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675412 Original CRISPR GAGGAGCCCTAGGCCAGCCT GGG (reversed) Exonic
Too many off-targets to display for this crispr