ID: 914675413

View in Genome Browser
Species Human (GRCh38)
Location 1:149904186-149904208
Sequence GGAGGAGCCCTAGGCCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1138
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 1085}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675413_914675425 21 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675413_914675422 10 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661
914675413_914675420 8 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675413_914675421 9 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
914675413_914675429 30 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675429 1:149904239-149904261 GGGAGGAACTGTGGGAGGCAGGG 0: 1
1: 0
2: 14
3: 124
4: 1798
914675413_914675423 13 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675423 1:149904222-149904244 CACAGAAACCAGATTAGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 197
914675413_914675426 22 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675413_914675427 25 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675413_914675428 29 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675413 Original CRISPR GGAGGAGCCCTAGGCCAGCC TGG (reversed) Exonic
900001148 1:15599-15621 GAAGGAGCCATAGCCCAGGCAGG + Intergenic
900012833 1:131462-131484 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
900020863 1:186120-186142 GAAGGAGCCATAGCCCAGGCAGG + Intergenic
900042898 1:487449-487471 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
900064335 1:722446-722468 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
900142954 1:1146143-1146165 GGGGGAGCCCTGGGCCCGGCCGG + Intergenic
900231387 1:1560353-1560375 CCAGGAGCCGGAGGCCAGCCTGG - Intronic
900402777 1:2479427-2479449 CGTGGAGCCCCGGGCCAGCCGGG + Intronic
900802736 1:4747411-4747433 GGAGGAGGCCCTGGCCAACCCGG - Intronic
901058968 1:6462929-6462951 GGGGGACCACAAGGCCAGCCAGG + Exonic
901296539 1:8165410-8165432 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
901406377 1:9049513-9049535 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
901520386 1:9779361-9779383 TGAGGAGCTCAAGACCAGCCTGG + Intronic
901732643 1:11291396-11291418 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
901777264 1:11568723-11568745 TCAGGAGTCCGAGGCCAGCCTGG - Intergenic
902465683 1:16616738-16616760 GAAGGAGTCCAAGTCCAGCCTGG - Intergenic
902548401 1:17204977-17204999 GGAGGTGCCCAAGGCCTGTCTGG - Intergenic
902741643 1:18442603-18442625 GGAGGAGCTCAAGACCAGTCTGG + Intergenic
902780468 1:18701703-18701725 TGAACAGCCCTAGGCCAGGCTGG + Intronic
902871711 1:19317646-19317668 GGAGGGGCCCCCGGCCAGGCAGG - Exonic
902921532 1:19668641-19668663 GTGGGAGCTCGAGGCCAGCCTGG - Intronic
903114361 1:21166513-21166535 TCAGGAGTCCGAGGCCAGCCTGG + Intronic
903183068 1:21614797-21614819 GGAGGAGCCCGGGGCCAGGCTGG - Intronic
903240579 1:21980268-21980290 TGAGGAGCTCGAGACCAGCCTGG + Intronic
903244321 1:22004888-22004910 TGAGGAGCTCGAGACCAGCCTGG + Intronic
903255170 1:22092674-22092696 TGAGGAACCCTAGAGCAGCCAGG + Exonic
903628703 1:24749746-24749768 GCAGGAGTTCTAGACCAGCCTGG + Intronic
903814303 1:26053461-26053483 TGGGGAGGCCAAGGCCAGCCTGG - Intronic
903978752 1:27169946-27169968 TCAGGAGCTCAAGGCCAGCCTGG - Intergenic
904024673 1:27494971-27494993 CCAGGAGTCCTAGACCAGCCTGG - Intergenic
904134176 1:28298276-28298298 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
904160278 1:28518094-28518116 GGGGGAGCCCTTGGCCAGGCTGG - Intronic
904160287 1:28518115-28518137 GGGGGAGCCCTTGGCCGGGCTGG - Intronic
904242543 1:29157961-29157983 GGAGGAGCTCGAGACCAGCCTGG + Intronic
904338872 1:29819605-29819627 GTAGGAGCTCAAGACCAGCCTGG - Intergenic
904530072 1:31162587-31162609 GCAGGAGTTCGAGGCCAGCCTGG + Intergenic
904692336 1:32302960-32302982 CTAGGAGTTCTAGGCCAGCCTGG + Intronic
905046179 1:35004398-35004420 CCAGGAGCTCTAGACCAGCCTGG + Intronic
905186835 1:36203190-36203212 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
905362727 1:37431439-37431461 GGAGGAGCCCTGGGGAGGCCTGG + Intergenic
905388415 1:37620419-37620441 TGAGGAGTTCGAGGCCAGCCTGG + Intronic
905460530 1:38119891-38119913 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
905906010 1:41618988-41619010 GCAGCAGCCCGAGGCCAGCTAGG - Intronic
906222279 1:44090258-44090280 TGAGGAGTTCTAGACCAGCCTGG + Intergenic
906494588 1:46295268-46295290 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
906504061 1:46364468-46364490 GGAGGAGTTCAAGACCAGCCTGG + Intronic
906623072 1:47300676-47300698 GGAGGAGTTCAAGACCAGCCTGG - Intronic
907337334 1:53708704-53708726 GGAGAAGCCAGAGGTCAGCCTGG - Intronic
907436747 1:54454556-54454578 AGAGGAGTTCTAGACCAGCCTGG - Intergenic
907466975 1:54644709-54644731 CCAGGAGCTCTAGACCAGCCTGG - Intronic
907756383 1:57314706-57314728 TCAGGAGTCCCAGGCCAGCCTGG + Intronic
909646372 1:77921698-77921720 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
909647750 1:77936375-77936397 CCAGGAGTCCTAGGCTAGCCTGG + Intronic
910449102 1:87328930-87328952 GCAGGAGCCCTCGGCCCGCGCGG - Exonic
910933443 1:92465219-92465241 CCAGGAGCTCCAGGCCAGCCTGG + Intergenic
912262517 1:108123264-108123286 TCAGGAGTCCAAGGCCAGCCTGG - Intergenic
912499008 1:110109627-110109649 TGAGGAGTCCAAGACCAGCCTGG - Intergenic
912689393 1:111793072-111793094 GCAGGAGTTCTAGACCAGCCTGG - Intronic
912801587 1:112722932-112722954 GGAGGGGCTGGAGGCCAGCCCGG + Intronic
913089823 1:115469019-115469041 GCAGGAGTTCTAGACCAGCCTGG - Intergenic
913114919 1:115687833-115687855 TGAGGAGTTCTAGACCAGCCTGG - Intronic
914675413 1:149904186-149904208 GGAGGAGCCCTAGGCCAGCCTGG - Exonic
914710404 1:150208044-150208066 GCAGGAGCTCAAGACCAGCCTGG + Intergenic
914807175 1:151000153-151000175 GGAGGAGTTCGAGGCCAGTCTGG - Intronic
914991323 1:152501843-152501865 GGAGGCCCACAAGGCCAGCCTGG - Intergenic
915207196 1:154278871-154278893 TGAGGAGTTCGAGGCCAGCCTGG + Intergenic
915220539 1:154371003-154371025 GGAGGAGCTCGAGACCAGCCTGG + Intergenic
915292861 1:154897933-154897955 CCAGGAGCTCGAGGCCAGCCTGG + Intergenic
915343459 1:155188598-155188620 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343494 1:155188676-155188698 GGTGGAGCCCGGGGCCCGCCTGG + Intronic
915343519 1:155188736-155188758 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343545 1:155188796-155188818 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343594 1:155188916-155188938 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343658 1:155189097-155189119 GGTGGAGCCCGAGGCCGGCCTGG + Intronic
915343719 1:155189281-155189303 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343745 1:155189341-155189363 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343771 1:155189401-155189423 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343797 1:155189461-155189483 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343867 1:155189641-155189663 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343893 1:155189701-155189723 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343919 1:155189761-155189783 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915343944 1:155189821-155189843 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344015 1:155190001-155190023 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344083 1:155190181-155190203 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344172 1:155190418-155190440 GGGGGAGCCCGGGGCCGGCCTGG + Intronic
915344224 1:155190539-155190561 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344249 1:155190599-155190621 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344323 1:155190779-155190801 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344347 1:155190839-155190861 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344414 1:155190988-155191010 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344439 1:155191048-155191070 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344513 1:155191228-155191250 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344538 1:155191288-155191310 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344595 1:155191469-155191491 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344645 1:155191589-155191611 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344741 1:155191829-155191851 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915344766 1:155191889-155191911 GGTGGAGCCCGGGGCCGGCCTGG + Intronic
915473993 1:156141793-156141815 TCAGGAGTTCTAGGCCAGCCTGG + Intergenic
915546726 1:156603254-156603276 CCAGGAGTCCAAGGCCAGCCTGG - Intergenic
916195693 1:162220139-162220161 CCAGGAGCTCGAGGCCAGCCTGG - Intronic
916309261 1:163376312-163376334 GCAGGAGCTCAAGACCAGCCTGG - Intergenic
916742491 1:167658638-167658660 TCAGGAGTTCTAGGCCAGCCTGG - Intronic
917209212 1:172614474-172614496 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
917745659 1:178004388-178004410 TCAGGAGTCCAAGGCCAGCCTGG + Intergenic
917967254 1:180186543-180186565 GCAGGACCCCTAGGACACCCTGG + Intronic
919337957 1:196264838-196264860 TCAGGAGTTCTAGGCCAGCCAGG - Intronic
919531047 1:198720537-198720559 TCAGGAGTTCTAGGCCAGCCTGG - Intronic
919632347 1:199971568-199971590 TTAGGAGTCCGAGGCCAGCCCGG + Intergenic
919751233 1:201039555-201039577 GGAGTGGCCCTAGGCCAGACAGG + Exonic
919872608 1:201833994-201834016 GCAGGAGTTCAAGGCCAGCCTGG - Intronic
920155437 1:203946204-203946226 GCAGGAGTTCTAGACCAGCCTGG + Intergenic
920226912 1:204445963-204445985 GCAGGAGCCCCAGGGCATCCTGG + Exonic
920532722 1:206715835-206715857 GGAGGAGTTCAAGACCAGCCTGG - Intronic
920759495 1:208768797-208768819 GCAGGAGTTCGAGGCCAGCCTGG - Intergenic
920841062 1:209554196-209554218 GGAGGAGCACCAGGACAGACAGG - Intergenic
921191629 1:212714093-212714115 TCAGGAGCTCTAGACCAGCCTGG + Intergenic
921667482 1:217890010-217890032 GCAGGAGTCCAAGACCAGCCTGG - Intergenic
921870681 1:220136339-220136361 CCAGGAGCTCGAGGCCAGCCTGG - Intronic
922099234 1:222468458-222468480 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
922261272 1:223947952-223947974 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
922313878 1:224423537-224423559 GGAGGAGTTCAAGGCCAGCCTGG + Intronic
922999010 1:229990471-229990493 GCAGGAGTTCAAGGCCAGCCTGG - Intergenic
923355248 1:233148609-233148631 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
923485026 1:234421296-234421318 TCAGGAGCTCGAGGCCAGCCTGG - Intronic
923610475 1:235487993-235488015 GGAGGAGCACAAAACCAGCCTGG - Intronic
923677191 1:236090231-236090253 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
923847529 1:237752357-237752379 CCAGGAGCTCTAGACCAGCCTGG - Intronic
924236564 1:242004026-242004048 TCAGGAGTCCAAGGCCAGCCTGG + Intergenic
924236592 1:242004160-242004182 TCAGGAGTCCAAGGCCAGCCTGG + Intergenic
924342435 1:243050132-243050154 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
924534401 1:244921991-244922013 GCAGGAGTTCCAGGCCAGCCTGG + Intergenic
924713451 1:246550672-246550694 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
1062877426 10:954314-954336 GCAGGAGCCCTTCCCCAGCCGGG - Intergenic
1063261522 10:4394423-4394445 CCAGGAGTTCTAGGCCAGCCTGG + Intergenic
1063420060 10:5905307-5905329 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
1063710585 10:8473955-8473977 CCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1064046372 10:12019932-12019954 TCAGGAGCCTGAGGCCAGCCTGG - Intronic
1064060414 10:12131904-12131926 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
1064150820 10:12863120-12863142 GCAGGAGTTCTAGACCAGCCTGG + Intergenic
1064218862 10:13422428-13422450 CCAGGAGCCCAAGACCAGCCTGG - Intergenic
1064223353 10:13460472-13460494 CCAGGAGTCCAAGGCCAGCCTGG - Intronic
1064864245 10:19861242-19861264 TCAGGAGTCCTAGACCAGCCTGG - Intronic
1064992863 10:21271733-21271755 CGAGGAGCTCAAGACCAGCCTGG - Intergenic
1065192183 10:23222873-23222895 CCAGGAGCTCTAGACCAGCCTGG - Intronic
1065292737 10:24247334-24247356 GGAGGAGTTCGAGACCAGCCTGG - Intronic
1065517045 10:26534249-26534271 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1065605590 10:27414220-27414242 GGTGGAGCCCAAGCCCAGGCCGG - Exonic
1065711467 10:28522192-28522214 TCAGGAGCCCAAGACCAGCCCGG + Intergenic
1065919521 10:30380062-30380084 CCAGGAGTCCTAGACCAGCCTGG + Intergenic
1065922245 10:30403025-30403047 CGAGGAGTTCAAGGCCAGCCTGG - Intergenic
1066327436 10:34377378-34377400 GCAGGAGTTCAAGGCCAGCCTGG + Intronic
1066734038 10:38455423-38455445 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1067012758 10:42729856-42729878 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1067567724 10:47350481-47350503 GTAGGCGCCCTGGGCCAGCTTGG - Exonic
1067568014 10:47351994-47352016 GGTGGAGCTCTCGGCCAGCGTGG - Intronic
1067703955 10:48593125-48593147 AGAGGAACCCTAGGGCATCCGGG - Intronic
1067927845 10:50528687-50528709 CCAGGAGCCCTAGAACAGCCTGG + Intronic
1068672782 10:59741005-59741027 GGAGGAGCTCAAGACCAGCCTGG - Intergenic
1068693843 10:59944795-59944817 GGACAAGCCTGAGGCCAGCCAGG - Intergenic
1069160211 10:65083839-65083861 CCAGGAGCCATAGGCCAGACTGG - Intergenic
1069495112 10:68896800-68896822 GCAGGAGTTCTAGACCAGCCTGG - Intergenic
1069827935 10:71265703-71265725 GGAGAGGCTCTGGGCCAGCCGGG + Intronic
1069974926 10:72205419-72205441 TGAGGAGATCGAGGCCAGCCTGG + Intronic
1070124661 10:73611437-73611459 GAAGGAGTTCCAGGCCAGCCTGG + Intronic
1070194061 10:74140145-74140167 GGAGGAGCCCTCGGTCCCCCGGG + Intronic
1070330064 10:75409973-75409995 TGAGGACCCCTGGGCCAGGCAGG - Intergenic
1070711817 10:78688668-78688690 GGAGGAGGACTTGGCCAGACTGG + Intergenic
1070749586 10:78956002-78956024 GCAGGACCCCAAGGCCAGGCAGG + Intergenic
1070909933 10:80109152-80109174 GGAGGAGTTCGAGACCAGCCTGG - Intergenic
1071142209 10:82522252-82522274 TCAGGAGCCCAAGACCAGCCTGG - Intronic
1071143429 10:82539841-82539863 GCAGGAGCTCAAGACCAGCCTGG - Intronic
1071167632 10:82824919-82824941 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1071385838 10:85120466-85120488 GCAGGAGGTCGAGGCCAGCCTGG - Intergenic
1071462872 10:85915019-85915041 GGAGGAGGCCAGGGCCAGACAGG + Intronic
1071580750 10:86767467-86767489 CTAGGAGCTCTAGACCAGCCTGG + Intronic
1071598248 10:86943217-86943239 GGAGGAGACCCAGGTGAGCCTGG - Exonic
1072066678 10:91878227-91878249 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
1072597297 10:96886085-96886107 CGAGGAGCTCGAGACCAGCCTGG - Intronic
1072748196 10:97957023-97957045 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1072969079 10:100001018-100001040 GGAGGAGTTCAAGACCAGCCTGG + Intronic
1073274038 10:102292576-102292598 GCAGGAGTTCAAGGCCAGCCTGG - Intronic
1073451582 10:103612890-103612912 TGGAGAGCCCTGGGCCAGCCTGG + Exonic
1074039868 10:109777699-109777721 TCAGGAGCTCCAGGCCAGCCTGG - Intergenic
1074530987 10:114298637-114298659 TCAGGAGCTCTAGACCAGCCTGG + Intronic
1074659257 10:115633118-115633140 TGAGGAGTTCGAGGCCAGCCTGG - Intronic
1074846546 10:117403956-117403978 TCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1075401481 10:122164094-122164116 CGAAGAACCCCAGGCCAGCCTGG - Intronic
1076026236 10:127116188-127116210 GGAGGAGCCCCAGGAGAGCCAGG - Intronic
1076221783 10:128739607-128739629 GGAGGACCCCAAGCTCAGCCAGG - Intergenic
1076225783 10:128774078-128774100 GGAGGAATCCTAGGCCAACGAGG - Intergenic
1076747749 10:132522923-132522945 GGGGTGGCCCTCGGCCAGCCAGG - Intergenic
1076762548 10:132612554-132612576 GGAGCAGCCCTAGGAGTGCCAGG - Intronic
1076846132 10:133070348-133070370 CCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1076894439 10:133303095-133303117 GGAGGGGCCCTAGGCCAGGCAGG - Intronic
1076969171 11:123666-123688 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
1076996172 11:298543-298565 GGCAGAGTCCTTGGCCAGCCGGG + Exonic
1077112767 11:869188-869210 GCACGACCCCCAGGCCAGCCTGG - Exonic
1077178328 11:1200627-1200649 GGCGGAACCCGAGCCCAGCCAGG + Intronic
1077241377 11:1512292-1512314 GGAAGAGCCCTGGGCCTCCCCGG + Intergenic
1077301419 11:1848897-1848919 GGAGGAGCTCTGTGCCAGGCGGG - Intergenic
1077302986 11:1855666-1855688 GGAGGAACCGCAGTCCAGCCTGG - Intronic
1077310876 11:1888586-1888608 GGGGGAGCCCTCAGCCAGCGTGG - Intronic
1077351283 11:2094371-2094393 AGTGGTGCCCCAGGCCAGCCTGG + Intergenic
1077406318 11:2383986-2384008 GGAGCTGACCTAGGCCTGCCCGG + Intronic
1077415854 11:2423976-2423998 GCAGGTGCCCTCGGCCTGCCAGG - Intergenic
1077571042 11:3338905-3338927 GGAGGGGCCAGAGGCCACCCAGG + Intergenic
1078004987 11:7525878-7525900 GGAGGGGCCCAAGGACAGTCAGG + Intronic
1078065252 11:8074525-8074547 TGAGGAGTCCAAGACCAGCCTGG + Intronic
1078509851 11:11977091-11977113 GGAGCAGCCCCAGGCGAGCCAGG - Intronic
1078788070 11:14515998-14516020 TCAGGAGCTCTAGACCAGCCTGG + Intronic
1079803096 11:24896140-24896162 GGAGGAACCGAAGGCCAGCCAGG - Intronic
1080537037 11:33231682-33231704 TCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1081713867 11:45234712-45234734 AGAGGTGCCCGAGGGCAGCCTGG - Intronic
1081915441 11:46727566-46727588 GCAGGAGTTCGAGGCCAGCCTGG + Intronic
1082005366 11:47416074-47416096 GGAGCAGCCCCAGGCCAGAGAGG + Exonic
1083605667 11:63977197-63977219 GGAGGAGTTCGAGACCAGCCTGG - Intronic
1083626652 11:64075272-64075294 GGAGGGGCCAAGGGCCAGCCAGG - Intronic
1083694585 11:64434186-64434208 GGAGGAGTCCTACTCCAGGCTGG + Intergenic
1083804640 11:65066610-65066632 GGAGGAGGCCCAGGCCATCCAGG - Intronic
1083838419 11:65288094-65288116 GCAGGAGTTCTAAGCCAGCCTGG + Intronic
1084055983 11:66633427-66633449 GGTGGAGTTCGAGGCCAGCCTGG - Intronic
1084402027 11:68950051-68950073 CCAGGAGTCCCAGGCCAGCCTGG + Intergenic
1085110772 11:73885630-73885652 GGAGGAGCTCAAGACCAGCCTGG + Intronic
1085173515 11:74467638-74467660 GGAGGCACTCCAGGCCAGCCCGG - Intronic
1085184087 11:74560541-74560563 TGAGGAGCTCAAGACCAGCCTGG + Intronic
1085296659 11:75435275-75435297 GAAGGAGCCCCAGGCCTGCAGGG + Exonic
1085411701 11:76295084-76295106 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1085442741 11:76578767-76578789 GGAGGGGACAGAGGCCAGCCTGG + Intergenic
1085467519 11:76734325-76734347 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1085819415 11:79776421-79776443 GGAAGAGGCCTATGCCAGCTTGG - Intergenic
1086183226 11:83980962-83980984 GGAGGAATCCTAGGTGAGCCAGG + Intronic
1086436112 11:86782464-86782486 TGAGGAGCGCGAGACCAGCCTGG + Intergenic
1086818143 11:91399745-91399767 TCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1087200826 11:95342742-95342764 CCAGGAGATCTAGGCCAGCCTGG - Intergenic
1088867309 11:113860905-113860927 TCAGGAGCCCGAGGCCATCCTGG + Intronic
1089034554 11:115373373-115373395 TCAGGAGCTCTAGACCAGCCTGG + Intronic
1089131881 11:116218848-116218870 CCAGGAGTCCTAGGTCAGCCTGG - Intergenic
1089274484 11:117325292-117325314 TGAGGAGCTCAAGACCAGCCTGG - Intronic
1089487406 11:118857620-118857642 TCAGGAGTCCCAGGCCAGCCTGG - Intergenic
1090018620 11:123107579-123107601 TCAGGAGCCTGAGGCCAGCCTGG - Intronic
1090060994 11:123464091-123464113 CGAGGAGCTCAAGACCAGCCTGG + Intergenic
1090201364 11:124860027-124860049 TGAGGAGCTCAAGACCAGCCTGG + Intergenic
1090795386 11:130131306-130131328 CCAGGAGCCCAAGACCAGCCTGG - Intronic
1091091568 11:132776136-132776158 ACAGGAGTTCTAGGCCAGCCTGG - Intronic
1091119303 11:133043385-133043407 AGTGGAGCCCTTGGTCAGCCTGG - Intronic
1091374237 12:15716-15738 GAAGGAGCCATAGCCCAGGCAGG + Intergenic
1091475504 12:768343-768365 TCAGGAGTTCTAGGCCAGCCTGG - Intronic
1091481654 12:838623-838645 TGAGGAGTTCTAGACCAGCCTGG - Intronic
1091500988 12:1017706-1017728 CCAGGAGCTCGAGGCCAGCCTGG - Intronic
1091552090 12:1543781-1543803 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
1091705603 12:2691157-2691179 GGAGGAGCTCCAGGACAGCAGGG + Exonic
1091749976 12:3016235-3016257 CCAGGAGTTCTAGGCCAGCCTGG - Intronic
1091902153 12:4153087-4153109 TGAGGAGTCCAAGACCAGCCTGG - Intergenic
1092164093 12:6332228-6332250 CCAGGAGTCCGAGGCCAGCCTGG + Intronic
1092356598 12:7800678-7800700 GGAGGAGTTCCAGACCAGCCTGG - Intergenic
1092451698 12:8608135-8608157 TCAGGAGTCCAAGGCCAGCCTGG - Intronic
1093013669 12:14134737-14134759 CCAGGAGTCCAAGGCCAGCCTGG + Intergenic
1093737615 12:22639465-22639487 TCAGGAGCTCTAGACCAGCCTGG + Intronic
1093919487 12:24843983-24844005 GGGAGAGCCCTAGGCCAACATGG + Intronic
1094207870 12:27859722-27859744 GGAGCAGCCCTTGGGCAGGCAGG + Intergenic
1094484259 12:30911868-30911890 GGCAGAGCCCCAGGCCTGCCTGG - Intergenic
1094564918 12:31590788-31590810 GGAGGAGCCCGAGCCCGGGCCGG + Exonic
1095428185 12:42101779-42101801 TCAGGAGTCCTAGACCAGCCTGG - Intronic
1096107619 12:49006326-49006348 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
1096124214 12:49107798-49107820 GGAGGAGCCATTGGCCAGCTTGG + Intronic
1096313817 12:50545584-50545606 AGAGGAGCTCAAGACCAGCCTGG - Intronic
1096373433 12:51087281-51087303 CCAGGAGTCCAAGGCCAGCCTGG - Intergenic
1097019844 12:56012613-56012635 CCAGGAGTTCTAGGCCAGCCTGG - Intronic
1097093823 12:56529341-56529363 CCAGGAGCTCTAGACCAGCCTGG + Intronic
1097122481 12:56745727-56745749 CTAGGAGTTCTAGGCCAGCCTGG + Intronic
1098258366 12:68641218-68641240 GGAGGAGTTCAAGACCAGCCCGG - Intronic
1098259382 12:68652603-68652625 TGAGGAGTTCAAGGCCAGCCTGG + Intronic
1098357786 12:69627449-69627471 GGAGGAGCGCTAGGCCAGGCTGG + Intergenic
1098678367 12:73319405-73319427 CCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1098891505 12:76014128-76014150 GGGGGAGACCAAGGGCAGCCGGG - Intergenic
1099194472 12:79598944-79598966 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
1100258597 12:92909805-92909827 TCAGGAGCCCAAGACCAGCCTGG + Intronic
1100425654 12:94483447-94483469 GCAGGAGTTCGAGGCCAGCCTGG - Intergenic
1100508867 12:95248776-95248798 CCAGGAGTTCTAGGCCAGCCTGG + Intronic
1100565664 12:95791007-95791029 GGAGGGGCGCCAGGGCAGCCGGG - Intronic
1100614499 12:96220596-96220618 GGAGGAGTTCAAGACCAGCCTGG - Intronic
1101272832 12:103165829-103165851 GCAGGAGTTCTAGACCAGCCTGG + Intronic
1101433034 12:104642607-104642629 CCAGGAGTTCTAGGCCAGCCTGG - Intronic
1101608423 12:106268121-106268143 GCAGGAGTTCGAGGCCAGCCTGG + Intronic
1101700479 12:107169290-107169312 GGATGTGCCCTGGGCCAGCTGGG + Intergenic
1101910073 12:108854844-108854866 TCAGGAGACCTAGGCCAGGCCGG - Intronic
1102015992 12:109648396-109648418 GGAGGAGACCCAGCCCAGCATGG - Intergenic
1102277638 12:111595851-111595873 GGAGGAGTTCGAGACCAGCCTGG + Intronic
1102468506 12:113144890-113144912 GGAGGAGTTCGAGGCCAGCCTGG - Intergenic
1102854328 12:116279633-116279655 TGAGGAGCTCGAGACCAGCCTGG + Intergenic
1102970745 12:117164048-117164070 CCAGGAGTCCAAGGCCAGCCTGG + Intronic
1103261371 12:119592135-119592157 GGAGGAGCCATGTGACAGCCAGG + Intergenic
1103334998 12:120182726-120182748 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
1103436725 12:120932500-120932522 TGAGGAGTTCAAGGCCAGCCTGG + Intergenic
1103644692 12:122382013-122382035 TCAGGAGTCCAAGGCCAGCCTGG + Intronic
1104142393 12:126001439-126001461 GTAGGAGTTCGAGGCCAGCCTGG - Intergenic
1105208351 13:18241982-18242004 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1105747320 13:23390448-23390470 TCAGGAGTCCTAGACCAGCCTGG + Intronic
1105793515 13:23827720-23827742 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
1105927189 13:25018648-25018670 CGCGGACCCCTGGGCCAGCCCGG - Intergenic
1106068348 13:26380688-26380710 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1106233941 13:27845602-27845624 TGAGGAGTCCTAGTCCAGGCAGG - Intergenic
1106303206 13:28488040-28488062 GGACTAGACCTGGGCCAGCCAGG - Intronic
1106852172 13:33805494-33805516 TCAGGAGTCCTAGACCAGCCTGG - Intergenic
1107255141 13:38417124-38417146 CCAGGAGATCTAGGCCAGCCTGG - Intergenic
1107474719 13:40724619-40724641 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1107537614 13:41350832-41350854 CCAGGAGCCCAAGACCAGCCTGG - Intronic
1108074805 13:46668690-46668712 AGCTGAGCCCTCGGCCAGCCAGG - Intronic
1108318678 13:49264506-49264528 TCAGGAGCCCAAGACCAGCCTGG + Intronic
1108383056 13:49872574-49872596 CGAGGAGCTCCAGACCAGCCTGG + Intergenic
1109280622 13:60351070-60351092 GGAGGAGTTCGAGACCAGCCTGG - Intergenic
1109287263 13:60424465-60424487 GGAGGAGTTCGAGACCAGCCTGG + Intronic
1110062467 13:71060479-71060501 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1110226992 13:73129960-73129982 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
1110563637 13:76936176-76936198 TTAGGAGCTCTAGACCAGCCTGG - Intergenic
1111879627 13:93939657-93939679 TGAGGAGCTCAAGACCAGCCTGG - Intronic
1112265412 13:97919263-97919285 CCAGGAGCTCGAGGCCAGCCTGG + Intergenic
1112286292 13:98107382-98107404 GGCTTAGCCCTTGGCCAGCCTGG + Intergenic
1112458610 13:99583693-99583715 TCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1112508501 13:99989528-99989550 GGAAGAGCTCTGGGACAGCCAGG - Intergenic
1112509808 13:99998846-99998868 TGAGGAGTTCTAGACCAGCCTGG - Intergenic
1113641779 13:111962851-111962873 TGATGAGGCCTGGGCCAGCCTGG + Intergenic
1114617842 14:24077646-24077668 GGTGGAGTACTACGCCAGCCAGG + Exonic
1115352078 14:32406417-32406439 TCAGGAGCCCAAGACCAGCCTGG - Intronic
1115612939 14:35066275-35066297 CGAGGAGTCCAAGACCAGCCTGG - Intronic
1115752439 14:36505923-36505945 GGAGGAGGCCTGGGCTTGCCCGG - Intronic
1116846234 14:49867426-49867448 GCAGGAGTTCGAGGCCAGCCTGG + Intergenic
1117389704 14:55251052-55251074 TGAGGAGTTCGAGGCCAGCCTGG + Intergenic
1118043173 14:61938923-61938945 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1118396717 14:65343958-65343980 TGAGGAGTTCTAGGCCAGCCTGG - Intergenic
1118409657 14:65465379-65465401 CTAGGAGCTCTAGACCAGCCTGG - Intronic
1118859938 14:69655002-69655024 TGAGGAGTTCAAGGCCAGCCTGG - Intronic
1119046950 14:71326919-71326941 TCAGGAGTCCTAGACCAGCCTGG - Intronic
1119336618 14:73838560-73838582 TCAGGAGTCCTAGACCAGCCTGG + Intergenic
1119415043 14:74464289-74464311 GGAGGAGCCCTAAGCCAGCATGG - Intergenic
1119516198 14:75250521-75250543 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
1119540928 14:75437894-75437916 GGAGGAGTGGCAGGCCAGCCTGG - Exonic
1119733329 14:76964988-76965010 GGAGGAGCCTAAGGCTAGGCCGG + Intergenic
1119805009 14:77476826-77476848 GTAGGAGCTCAAGACCAGCCTGG + Intronic
1120235310 14:81883523-81883545 TCAGGAGCCCAAGACCAGCCTGG - Intergenic
1120474182 14:84966843-84966865 CCAGGAGTTCTAGGCCAGCCTGG + Intergenic
1120548905 14:85845074-85845096 CAAGGAGTCCTAGACCAGCCTGG + Intergenic
1120648491 14:87102057-87102079 CCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1120680148 14:87471368-87471390 AGAGGAGTTCAAGGCCAGCCTGG - Intergenic
1120756397 14:88248517-88248539 GCAGGAGTTCAAGGCCAGCCTGG + Intronic
1120891682 14:89497163-89497185 TCAGGAGCTCTAGACCAGCCTGG - Intronic
1121133277 14:91469771-91469793 TCAGGAGTTCTAGGCCAGCCTGG - Intronic
1121685405 14:95831791-95831813 GCAGGAGCTCTGGGACAGCCTGG + Intergenic
1121784752 14:96649138-96649160 GGAGGGGCTCCAGGCCAGGCAGG + Intergenic
1122142274 14:99669531-99669553 GGAGGAGTTCAAGTCCAGCCCGG + Intronic
1122287150 14:100658765-100658787 GGAGGAGCCACAGGCTGGCCAGG - Intergenic
1122362536 14:101175927-101175949 GGAGAGGCCCCAGGTCAGCCAGG + Intergenic
1122604060 14:102936700-102936722 TGAGGAGTTCAAGGCCAGCCTGG - Intronic
1122648449 14:103210680-103210702 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
1122874534 14:104657603-104657625 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
1202853788 14_GL000225v1_random:37475-37497 GGATGAGCTCCAGGCAAGCCCGG + Intergenic
1202857300 14_GL000225v1_random:59206-59228 GGATGAGCTCTTGGCGAGCCCGG + Intergenic
1202858212 14_GL000225v1_random:64335-64357 GGTAGAGCCCCAGGCCAGCAGGG + Intergenic
1202859370 14_GL000225v1_random:72092-72114 GGATGAGCTCTTGGCGAGCCTGG - Intergenic
1123758192 15:23413271-23413293 TGAGGAGCCCCTGACCAGCCTGG + Intergenic
1124406614 15:29398512-29398534 TCAGGAGTCCTAGACCAGCCTGG + Intronic
1124486990 15:30126548-30126570 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1124542073 15:30595523-30595545 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1124700515 15:31908226-31908248 GCAGGAGTCCGAGACCAGCCTGG - Intergenic
1124756535 15:32411774-32411796 TCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1124971989 15:34496677-34496699 GGAGGCGTCCCAGGCAAGCCTGG + Intergenic
1124998683 15:34748956-34748978 GCAGGAGCACTAAGCCAGACTGG + Intergenic
1125117223 15:36108764-36108786 TCAGGAGCCCTAGGGGAGCCTGG + Intergenic
1125696853 15:41645375-41645397 GGCGGAGCTCCAGACCAGCCTGG + Intronic
1125715307 15:41816664-41816686 GGAGGAGCCCTGTGCCATTCCGG - Intronic
1126111803 15:45179612-45179634 GGAGAAGCCCAAGCCCAGCTTGG - Intronic
1126217634 15:46174715-46174737 GGAGGAGCCCTGGGGAAGACTGG - Intergenic
1127506854 15:59606248-59606270 TCAGGAGTCCTAGACCAGCCTGG + Intronic
1127779886 15:62302882-62302904 GGAGAAGGTCTAGGACAGCCAGG - Intergenic
1127989347 15:64100388-64100410 GCAGGAGTTCTAGACCAGCCTGG + Intronic
1128045733 15:64616201-64616223 TGAGGAGTTCTAGACCAGCCTGG - Intronic
1128099264 15:64984958-64984980 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
1128544546 15:68558287-68558309 GCAGGACCCCTGGGCCTGCCAGG - Intergenic
1128638082 15:69315924-69315946 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
1128770077 15:70275505-70275527 GGAGGAGCCCTTGGTCAGTTGGG + Intergenic
1128878025 15:71217994-71218016 GCAGGAGTTCGAGGCCAGCCTGG - Intronic
1129108664 15:73324962-73324984 GTAGGAGCCGTCGGCCAGCTTGG + Exonic
1129275465 15:74442563-74442585 TGAGGTGCCATAGGACAGCCAGG - Intergenic
1129611556 15:77063420-77063442 GAAGGAGTCTGAGGCCAGCCTGG - Intronic
1129637699 15:77339311-77339333 CCAGGAGCTCTAGACCAGCCTGG - Intronic
1129687659 15:77695757-77695779 GGCTGAGCTCTGGGCCAGCCAGG + Intronic
1130523743 15:84685481-84685503 GCAGGAGCTCTAGACCAGCCTGG - Intronic
1130528923 15:84730899-84730921 GGAGGAGTTCGAGACCAGCCTGG - Intergenic
1130556842 15:84928830-84928852 TGAGGAGTTCAAGGCCAGCCTGG - Intronic
1130822049 15:87506207-87506229 GGAGGAGACCCAGGCAGGCCAGG - Intergenic
1131186424 15:90278442-90278464 TGAGGAGTCCAAGACCAGCCTGG - Intronic
1131513761 15:93064195-93064217 AGAGGAGCCCTAGGCTGGCAAGG + Intronic
1131830901 15:96354070-96354092 GGAGGGACCAGAGGCCAGCCCGG - Intergenic
1131899154 15:97068823-97068845 GGAGGAGTTCGAGACCAGCCTGG - Intergenic
1132092804 15:98959461-98959483 GGTGCCGCCCTGGGCCAGCCTGG - Exonic
1132355126 15:101165811-101165833 TCAGGAGTCCTAGACCAGCCTGG + Intergenic
1132452362 15:101975341-101975363 GAAGGAGCCATAGCCCAGGCAGG - Intergenic
1132454534 16:15283-15305 GAAGGAGCCATAGCCCAGGCAGG + Intronic
1132461662 16:58444-58466 AGAGGACCACCAGGCCAGCCAGG + Exonic
1132505414 16:305887-305909 GGAGGAGTTTGAGGCCAGCCTGG - Intronic
1132534495 16:471338-471360 TGAGGAGCCCCTGGCCTGCCCGG + Exonic
1132556319 16:574284-574306 GCAGGAGCCCGAGGAGAGCCTGG + Exonic
1132747725 16:1443932-1443954 GGAGGAGCCCCAGGTCTTCCAGG + Exonic
1132867784 16:2102461-2102483 GGAGGAGACCTCGCCCCGCCAGG - Exonic
1133018652 16:2956273-2956295 GAAAGAGCCCCAGCCCAGCCAGG + Intergenic
1133112371 16:3556117-3556139 GCAGGAGCTCGAGACCAGCCTGG + Intronic
1133285837 16:4690304-4690326 TGCGGAGCCCTGGGCCAGGCAGG + Exonic
1133558786 16:6930617-6930639 TGAGGAGCTCAAGACCAGCCTGG - Intronic
1133669429 16:8003478-8003500 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1133810570 16:9158250-9158272 TCAGGAGTCCGAGGCCAGCCTGG - Intergenic
1134051677 16:11141724-11141746 GGAGGTGCCCTTGGCTAGCATGG + Intronic
1134099004 16:11438559-11438581 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1134282073 16:12825964-12825986 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
1134480511 16:14614926-14614948 GGAGGACACCTAGCACAGCCTGG + Intronic
1134523994 16:14930653-14930675 GGAGGAGACCTCGCCCCGCCAGG + Intronic
1134548909 16:15130282-15130304 GGAGGAGACCTCGCCCCGCCAGG - Intronic
1134711587 16:16329138-16329160 GGAGGAGACCTCGCCCCGCCAGG + Intergenic
1134719438 16:16372437-16372459 GGAGGAGACCTCGCCCCGCCAGG + Intergenic
1134947988 16:18339448-18339470 GGAGGAGACCTCGCCCCGCCAGG - Intergenic
1134955242 16:18379555-18379577 GGAGGAGACCTCGCCCCGCCAGG - Intergenic
1135605150 16:23817719-23817741 CTAGGAGCTCGAGGCCAGCCTGG + Intergenic
1135709125 16:24700187-24700209 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
1136019318 16:27430005-27430027 GGGGGAGCCCTGAGCCCGCCTGG + Intronic
1136113397 16:28079120-28079142 TCAGGAGTCCGAGGCCAGCCTGG + Intergenic
1136362462 16:29789873-29789895 TGAGGAGCTCGAGACCAGCCTGG - Intergenic
1136474785 16:30506048-30506070 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
1136490365 16:30604185-30604207 GGAGGAGCCCCAGGTCATACAGG - Exonic
1136539069 16:30918491-30918513 CCAGGAGCCCAAGGCCAGCGTGG - Intergenic
1136618824 16:31414639-31414661 GGAGGAGCCCAAGGCTGGCCTGG + Intronic
1137350321 16:47708061-47708083 GGAGGAGTTCAAGGCCAGCCTGG + Intergenic
1137591436 16:49696528-49696550 GAAGGAGGCCCAGGCCCGCCAGG + Intronic
1137641069 16:50030225-50030247 GGAGGAGTTCAAGACCAGCCTGG + Intronic
1137729516 16:50679529-50679551 CGTGCAGCCCTGGGCCAGCCAGG - Intronic
1137732505 16:50699135-50699157 TCAGGAGCGCTAGACCAGCCCGG - Intronic
1137995117 16:53202069-53202091 CCAGGAGTCCAAGGCCAGCCTGG - Intronic
1138112120 16:54332048-54332070 CCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1138381254 16:56604274-56604296 CCAGGAGCTCGAGGCCAGCCTGG + Intergenic
1138484895 16:57333865-57333887 TCAGGAGCTCTAGACCAGCCTGG - Intergenic
1138485818 16:57342748-57342770 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1138742244 16:59324391-59324413 TCAGGAGATCTAGGCCAGCCTGG - Intergenic
1138771985 16:59676419-59676441 TGAGGAGCTCAAGACCAGCCTGG + Intergenic
1138838683 16:60471025-60471047 TCAGGAGCCCGAGACCAGCCCGG + Intergenic
1139032735 16:62905233-62905255 TGAGGAGCTCGAGACCAGCCTGG + Intergenic
1139227270 16:65244923-65244945 AGAGGAGACCTAGGGCAGGCAGG - Intergenic
1139552688 16:67684161-67684183 TCAGGAGCCCGAGACCAGCCTGG + Intronic
1139871941 16:70114726-70114748 GGGGGAGCCCGAGGTCACCCCGG - Intronic
1140162246 16:72509320-72509342 GCAGGAGTCCGAGACCAGCCTGG + Intergenic
1140517346 16:75553407-75553429 TGAGGAGTTCTAGACCAGCCTGG + Intronic
1140864240 16:79046009-79046031 TCAGGAGCTCGAGGCCAGCCTGG - Intronic
1141065316 16:80909208-80909230 TGAGGAGCTCAAGACCAGCCTGG - Intergenic
1141084531 16:81083306-81083328 CTAGGAGCTCTAGACCAGCCTGG + Intronic
1141828047 16:86494721-86494743 GCAGGCGCCCTAGAGCAGCCGGG + Intergenic
1142436772 16:90064621-90064643 TGAGGAGTTCTAGACCAGCCTGG - Intronic
1142440042 16:90091906-90091928 TGAGGAGATCGAGGCCAGCCTGG + Intronic
1142451504 16:90175456-90175478 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1203140959 16_KI270728v1_random:1765538-1765560 TGAGGAGCTCGAGACCAGCCTGG - Intergenic
1142677319 17:1521932-1521954 CCAGGAGCCCAAGACCAGCCTGG - Intronic
1142849413 17:2697033-2697055 GGAGGTGCCCTATGCCTGCGGGG - Intronic
1142966262 17:3583681-3583703 GGAGGAGCTCTGGGCCTGCCGGG - Intronic
1143034415 17:3986203-3986225 GATGGAACCCCAGGCCAGCCTGG - Intergenic
1143238575 17:5424196-5424218 GGAGGAGTTCGAGACCAGCCTGG - Intronic
1143839408 17:9719855-9719877 CTAGGAGCCCGAGACCAGCCTGG + Intronic
1144116512 17:12098266-12098288 TCAGGAGCCCGAGACCAGCCTGG + Intronic
1144513585 17:15899018-15899040 CCAGGAGTCCTAGACCAGCCTGG + Intergenic
1144841410 17:18188629-18188651 GGAGGAGCTCTGGGCCAGGGGGG + Intronic
1145241303 17:21242280-21242302 GGAGGAGCCCAGGGCCAGATGGG + Exonic
1145257943 17:21337773-21337795 GGAGGTGGCCTCGGCCAGCCTGG + Intergenic
1145318694 17:21750233-21750255 GGAGGTGGCCCCGGCCAGCCTGG - Intergenic
1145325260 17:21817277-21817299 TGAGGAGTTCTAGACCAGCCTGG - Intergenic
1145803290 17:27705908-27705930 TCAGGAGTCCTAGACCAGCCAGG + Intergenic
1146218160 17:30995437-30995459 GGAGGAGTTCCAGACCAGCCTGG - Intronic
1146274265 17:31505919-31505941 CCAGGAGCTCCAGGCCAGCCTGG - Intronic
1146416202 17:32635487-32635509 TGAGGAGCTCAAGACCAGCCTGG + Intronic
1146796351 17:35784069-35784091 GCAGGAGTTCAAGGCCAGCCTGG + Intronic
1147056721 17:37840433-37840455 GCAGGAGCTCAAGACCAGCCTGG - Intergenic
1147061506 17:37883104-37883126 GTAGGAGCCTGAGACCAGCCTGG - Intergenic
1147124897 17:38360400-38360422 TCAGGAGCCCGAGACCAGCCTGG - Intronic
1147426717 17:40349242-40349264 TGTGGAGCCCCTGGCCAGCCTGG + Intronic
1147485377 17:40807429-40807451 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
1147647417 17:42042160-42042182 CCAGGAGCCCAAGACCAGCCTGG + Intronic
1147842021 17:43378661-43378683 ACAGGAGTTCTAGGCCAGCCTGG + Intergenic
1147862952 17:43534278-43534300 GCAGGAGTCCAAGACCAGCCTGG + Intronic
1147882530 17:43663171-43663193 GGAGGAGCCGAAGGGCACCCAGG + Intergenic
1148015061 17:44515896-44515918 TTAGGAGCTCTGGGCCAGCCTGG - Intergenic
1148519310 17:48255036-48255058 GGAGGAGTACTAGCCCATCCAGG - Intronic
1148549754 17:48543442-48543464 CGAGGAACCCGCGGCCAGCCCGG - Exonic
1148764427 17:50028929-50028951 GGAGGAGCCCATGGCCAGAGAGG - Intergenic
1148922948 17:51055136-51055158 TGAGGAGCTCAAGACCAGCCTGG + Intronic
1149210709 17:54296938-54296960 TCAGGAGCTCTAGACCAGCCTGG + Intergenic
1149351030 17:55787562-55787584 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
1149621046 17:58045311-58045333 TGAGGAGTTCGAGGCCAGCCTGG + Intergenic
1149690512 17:58571781-58571803 AGAGGAGTCCCAGGCAAGCCAGG + Intronic
1149716890 17:58799651-58799673 TGAGGAGTTCAAGGCCAGCCTGG - Intronic
1149821886 17:59788275-59788297 TCAGGAGCTCTAGACCAGCCTGG + Intronic
1149864066 17:60140601-60140623 CGAGGAGCTCGAGACCAGCCTGG + Intergenic
1149935128 17:60797422-60797444 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1150214510 17:63459279-63459301 TCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1150362656 17:64550568-64550590 TCAGGAGTCCCAGGCCAGCCTGG + Intronic
1150725400 17:67647525-67647547 TGAGGAGCTCGAGACCAGCCTGG - Intronic
1151191043 17:72398343-72398365 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
1151401943 17:73861436-73861458 GGAGGAGACCTGGGCCCACCAGG - Intergenic
1151736739 17:75947077-75947099 TGAGGAGTTCTAGACCAGCCTGG - Intronic
1151873064 17:76849731-76849753 TGAGGAGGCCAAGCCCAGCCAGG + Intergenic
1151892958 17:76962001-76962023 GGAGGAGCCACAGGCCACACCGG - Intergenic
1152031499 17:77846132-77846154 GGAGGAGCCCCAGCCCAGTGGGG + Intergenic
1152095167 17:78268342-78268364 GGAGGGCCCCAAGGCCAGCCGGG + Intergenic
1152294298 17:79457672-79457694 GAATGCGTCCTAGGCCAGCCAGG + Intronic
1152543886 17:80991211-80991233 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1152942078 17:83178097-83178119 GGAGGGGCCAGAGGACAGCCCGG - Intergenic
1153240515 18:3027418-3027440 CGAGGACCCTGAGGCCAGCCCGG + Intergenic
1153654035 18:7266214-7266236 TGAGGAGTTCAAGGCCAGCCTGG + Intergenic
1153805118 18:8704672-8704694 GGAGGAGCCCTCGCCAAACCTGG - Intergenic
1153840797 18:9006017-9006039 GCAGGAGCTCAAGACCAGCCTGG + Intergenic
1153944387 18:10006283-10006305 GGTGGAGCCCATGACCAGCCAGG - Intergenic
1154387702 18:13910702-13910724 GGAGCAGCCTCAGCCCAGCCAGG - Intronic
1154984628 18:21537326-21537348 AGAGGAGTTCAAGGCCAGCCTGG + Intronic
1155594355 18:27467648-27467670 CCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1157290290 18:46405284-46405306 GGAGGTGCCCGTGGCCAGACAGG + Intronic
1157544331 18:48537483-48537505 TGAGGAGCTCAAGACCAGCCTGG - Intergenic
1157598320 18:48877317-48877339 GGAGGAGTTCGAGACCAGCCTGG - Intergenic
1157881663 18:51326841-51326863 TGAGGAGCTCGAGACCAGCCTGG - Intergenic
1158141693 18:54262456-54262478 GCAGGAGTTCAAGGCCAGCCTGG - Intergenic
1158497092 18:57966052-57966074 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
1158567320 18:58565990-58566012 TCAGGAGTCCTAGACCAGCCTGG - Intronic
1158694073 18:59687747-59687769 TGAGGAGCTCAAGACCAGCCTGG + Intronic
1158716500 18:59884960-59884982 TGAGGAGCTCGAGACCAGCCTGG + Intergenic
1159009278 18:63042949-63042971 GGAGGAGCAGTGGGCCAACCTGG + Intergenic
1159108111 18:64026775-64026797 GGAGAAGCGCTAGGCCCGGCTGG - Intergenic
1159167585 18:64722732-64722754 GCAGGAGTTCAAGGCCAGCCTGG - Intergenic
1159416011 18:68150513-68150535 TCAGGAGTTCTAGGCCAGCCTGG + Intergenic
1159905377 18:74085382-74085404 GCAGGAGTCCGAGACCAGCCTGG + Intronic
1159971752 18:74664288-74664310 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
1160645976 19:193592-193614 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
1161007846 19:1945261-1945283 GGGGGAGCCTGGGGCCAGCCCGG - Intronic
1161259084 19:3326233-3326255 CGAGGAGCTCAAGACCAGCCGGG + Intergenic
1161284334 19:3461209-3461231 GAAGGAGTTCAAGGCCAGCCTGG + Intronic
1161340927 19:3741757-3741779 TCAGGAGCTCTAGACCAGCCTGG + Intronic
1161428545 19:4217584-4217606 GGAGGCGGCCTCGGCCTGCCTGG + Exonic
1161434524 19:4254708-4254730 TCAGGAGTCCTAGACCAGCCTGG + Intronic
1161676703 19:5654774-5654796 TGAGGAGTTCGAGGCCAGCCTGG - Intronic
1161950997 19:7467988-7468010 GCAGGAGTTCCAGGCCAGCCTGG + Intronic
1162206054 19:9056950-9056972 CCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1162344251 19:10110498-10110520 GGAGGAGCTGCAGGCCATCCTGG + Exonic
1162418279 19:10551486-10551508 GGAGGAGTTCCAGACCAGCCTGG + Intronic
1162591251 19:11593383-11593405 TCAGGAGTCCTAGACCAGCCTGG + Intronic
1162597921 19:11643427-11643449 CCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1162646097 19:12051696-12051718 GGAGGAGTTCAAGACCAGCCTGG + Intronic
1163113421 19:15175321-15175343 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
1163545341 19:17938128-17938150 CCAGGAGCTCCAGGCCAGCCTGG + Intronic
1163586235 19:18165572-18165594 TGAGGAGTCTGAGGCCAGCCTGG - Intronic
1163653391 19:18531910-18531932 GGCGGAGACCTAGCCCAGCGGGG + Exonic
1163760539 19:19133978-19134000 GGAGGATCACTTGACCAGCCTGG - Intronic
1163803968 19:19385313-19385335 GGAGGCGGCCTTGGCCAGGCGGG - Intergenic
1163879102 19:19901878-19901900 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
1164121007 19:22265412-22265434 GCAGGAGCTCGAGACCAGCCTGG - Intergenic
1164133362 19:22386500-22386522 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1164139623 19:22447263-22447285 GCAGGAGTCTGAGGCCAGCCTGG - Intronic
1164739132 19:30563865-30563887 GGATGAGCCCAAGGACAGGCTGG + Intronic
1164781401 19:30896472-30896494 GGAGAAGCACTAAGGCAGCCTGG - Intergenic
1164973401 19:32551514-32551536 CTAGGAGCTCAAGGCCAGCCTGG + Intergenic
1165086402 19:33351066-33351088 CCAGGAGTCCAAGGCCAGCCTGG + Intergenic
1165466295 19:35977017-35977039 GGAGGGGCCCCAGGGCATCCAGG - Intergenic
1165499577 19:36177508-36177530 GCAGGAGCTCGAGACCAGCCTGG - Intergenic
1165502836 19:36203784-36203806 TGAGGAGCTCAAGACCAGCCTGG - Intronic
1165695736 19:37899655-37899677 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1165987125 19:39779159-39779181 CTAGGAGCTCGAGGCCAGCCTGG - Intronic
1166001514 19:39880274-39880296 TCAGGAGCCCGAGACCAGCCTGG - Intronic
1166004296 19:39896525-39896547 TCAGGAGCCCGAGACCAGCCTGG - Intronic
1166074120 19:40404008-40404030 GGAGGAGTTCGAGACCAGCCTGG - Intronic
1166282810 19:41806440-41806462 TGAGGACCCCAAGGTCAGCCAGG + Intronic
1166368699 19:42290123-42290145 GGTGCAGCCCTAGGCTGGCCTGG + Intronic
1166667040 19:44686621-44686643 GTAGGAGTTCAAGGCCAGCCTGG + Intergenic
1166799761 19:45449446-45449468 GGAGGAGTTCGAGACCAGCCTGG + Intronic
1166865740 19:45835700-45835722 TCAGGAGCCCAAGACCAGCCTGG + Intronic
1167072453 19:47228617-47228639 GGAGGCTCTCCAGGCCAGCCAGG - Intronic
1167128497 19:47568551-47568573 GCAGGAGGTCGAGGCCAGCCTGG - Intergenic
1167462429 19:49632764-49632786 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
1167645463 19:50703050-50703072 GAAGGAGGCGAAGGCCAGCCAGG - Intronic
1168232349 19:55041183-55041205 GGAGGAGTTCAAGACCAGCCTGG - Intronic
1168412234 19:56147196-56147218 GGAGGAGCTCTGGGTGAGCCTGG + Exonic
1168460942 19:56557345-56557367 CAAGGAGCCCAAGACCAGCCTGG - Intergenic
1168557351 19:57354213-57354235 TCAGGAGCTCTAGACCAGCCTGG - Intronic
925025765 2:606020-606042 GGAGGCACCCTGGGCCAGCAGGG + Intergenic
925223213 2:2159598-2159620 GGAGGTGGCCGATGCCAGCCTGG + Intronic
925410094 2:3634960-3634982 GGAGGAACCCAAGGGCAGCGGGG - Intronic
925918858 2:8625774-8625796 CCAGGAGCCCGAGCCCAGCCAGG + Intergenic
926146113 2:10398008-10398030 GGAGGAGCTGTGGGGCAGCCAGG - Intronic
926257915 2:11225547-11225569 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
926386126 2:12337611-12337633 GAAGTAGCCCTAGCCCAGCTTGG + Intergenic
927024910 2:19057266-19057288 CCAGGAGCTCTAGACCAGCCTGG + Intergenic
927828156 2:26324031-26324053 CCAGGAGTCCAAGGCCAGCCTGG + Intronic
928121492 2:28586956-28586978 GCAGGAGTCCAAGACCAGCCTGG - Intronic
929493619 2:42420011-42420033 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
929521929 2:42660888-42660910 GGAGGAGTTCAAGACCAGCCTGG - Intronic
929563951 2:42973288-42973310 TCAGGAGTCCTAGACCAGCCTGG + Intergenic
929685110 2:44026704-44026726 TCAGGAGCACAAGGCCAGCCTGG + Intergenic
929707450 2:44228381-44228403 TCAGGAGTTCTAGGCCAGCCTGG - Intronic
929732522 2:44511048-44511070 TGAGGAGCCCAAGACCAACCTGG - Intronic
929780085 2:44951980-44952002 GGAGGAGCTACAGACCAGCCAGG + Intergenic
929952737 2:46428864-46428886 GGGGGAGCCCCAGGACAGACTGG + Intergenic
930095046 2:47560491-47560513 GGAAGAACCATAGCCCAGCCTGG - Intronic
930553934 2:52870995-52871017 GCAGGAGTTCTAGACCAGCCTGG - Intergenic
930578917 2:53186052-53186074 TGAGGAGTTCAAGGCCAGCCTGG - Intergenic
931149023 2:59551963-59551985 GCAGGAGCCCTAAGTCAGGCAGG + Intergenic
931467782 2:62506254-62506276 GGACGAGACCCAGCCCAGCCGGG - Exonic
932224077 2:70025346-70025368 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
932809419 2:74811765-74811787 GGAAGAGCCCAATCCCAGCCAGG + Intergenic
933198449 2:79420098-79420120 GGCTGAGCACTAGGCCAGCGAGG - Intronic
933253521 2:80055236-80055258 CTAGGAGCTCGAGGCCAGCCTGG - Intronic
933726994 2:85432743-85432765 TGAGGAGTTCGAGGCCAGCCTGG - Intronic
933730320 2:85451421-85451443 CCAGGAGCTCAAGGCCAGCCCGG - Intergenic
933896406 2:86814624-86814646 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
934072031 2:88393202-88393224 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
934541101 2:95175732-95175754 GGAGCATCCCTTGGGCAGCCAGG - Intronic
934650976 2:96091280-96091302 GGAAGTGCCCTGGGCAAGCCTGG + Intergenic
935696462 2:105774967-105774989 CCAGGAGCCTGAGGCCAGCCTGG + Intronic
936568575 2:113597813-113597835 GAAGGAGCCATAGCCCAGGCAGG - Intergenic
937227446 2:120377922-120377944 TGATGAGCCTTCGGCCAGCCTGG + Intergenic
937447504 2:121971242-121971264 GGAAGTCCCCTAGGACAGCCAGG - Intergenic
937902087 2:127027705-127027727 CCAGGAGTCCTGGGCCAGCCTGG - Intergenic
939443385 2:142277485-142277507 CCAGGAGCACTAGACCAGCCTGG - Intergenic
939615299 2:144355578-144355600 GCAGGAGTTCTAGACCAGCCTGG - Intergenic
939764711 2:146232262-146232284 TCAGGAGCTCTAGACCAGCCTGG + Intergenic
940938085 2:159523191-159523213 CCAGGAGTTCTAGGCCAGCCTGG + Intronic
941118208 2:161496436-161496458 TGAGGAGTTCAAGGCCAGCCTGG - Intronic
941963004 2:171272190-171272212 TGAGGTGGCCTATGCCAGCCTGG - Intergenic
942015003 2:171804700-171804722 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
943618838 2:190124498-190124520 GCAGGAGCGCAAGGCCAGCCTGG + Intronic
943847630 2:192672629-192672651 GGAGAAGCCGCAGGCCTGCCTGG - Intergenic
943922411 2:193725964-193725986 TCAGGAGCTCAAGGCCAGCCTGG - Intergenic
943971183 2:194408710-194408732 TGAGGAGCTCGAGACCAGCCTGG - Intergenic
944089752 2:195893157-195893179 CCAGGAGTCCTAGACCAGCCTGG - Intronic
944644765 2:201767648-201767670 GTAGGAGCTCGAGACCAGCCTGG + Intronic
944808072 2:203302133-203302155 TGAGGAGTTCGAGGCCAGCCTGG - Intronic
945096053 2:206220638-206220660 GCAGGAGTCCAAGACCAGCCAGG + Intergenic
945287234 2:208094776-208094798 GCAGGAGCTCAAGGCCAGCCTGG - Intergenic
945765432 2:213970509-213970531 TCAGGAGCTCGAGGCCAGCCTGG - Intronic
945993055 2:216412687-216412709 GGACGAGACCAATGCCAGCCTGG + Intronic
946047602 2:216834078-216834100 GGATGTGCCCTTGGCCAGCTGGG + Intergenic
946326673 2:218988197-218988219 GGAGGTGCCCATGACCAGCCAGG + Intergenic
947111434 2:226723266-226723288 GAGGCAGCCCTAGGCCAACCTGG - Intergenic
947196156 2:227569839-227569861 TGAGGAGTCCGAGACCAGCCTGG - Intergenic
947360461 2:229340630-229340652 GGAACAGCACCAGGCCAGCCTGG + Intergenic
947382091 2:229554480-229554502 GCAGGAGTCCGAGACCAGCCTGG + Intronic
947517891 2:230823186-230823208 GGAAGAGCCGCAGGCCAGCTGGG + Intergenic
947740632 2:232483256-232483278 AAGGGAGCACTAGGCCAGCCTGG + Intronic
948226976 2:236318916-236318938 TCTGGAGCCCTTGGCCAGCCTGG - Intergenic
948485411 2:238277861-238277883 CGTGGAGCCCCAGCCCAGCCAGG - Exonic
948648647 2:239424989-239425011 GGAGGAACCCCAGGGCAGCAAGG + Intergenic
948871638 2:240802837-240802859 CCAGGAGCCCAAGACCAGCCTGG - Intronic
949022388 2:241748892-241748914 CTGGGAGCCCGAGGCCAGCCCGG + Intronic
1169334994 20:4748677-4748699 GGCAGAGCTCAAGGCCAGCCAGG - Intergenic
1169484799 20:6019871-6019893 TGAGGAGTTCGAGGCCAGCCTGG - Intronic
1169945047 20:10979152-10979174 AGAGGAGGCCTGGACCAGCCAGG + Intergenic
1170219000 20:13921379-13921401 TCAGGAGCTCGAGGCCAGCCAGG - Intronic
1170619859 20:17986567-17986589 TCAGGAGCCCGAGACCAGCCTGG - Intronic
1170658757 20:18315985-18316007 GGAGAAGCCCTACGCCTGCAAGG + Exonic
1170825424 20:19790583-19790605 GGAGGAGTTCAAGGCCAGCCTGG + Intergenic
1170880803 20:20295371-20295393 GGAGGAGGCCTGGGGAAGCCTGG + Intronic
1171292742 20:23991802-23991824 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1171469278 20:25356923-25356945 ACAGGAGCTCAAGGCCAGCCTGG + Intronic
1171482025 20:25461228-25461250 GGAGGAGCCAGAGGCAAGCCTGG - Intronic
1172128402 20:32639113-32639135 GGCGGAGAGCCAGGCCAGCCAGG - Intergenic
1172139832 20:32714612-32714634 GCAGGAGTTCGAGGCCAGCCTGG + Intronic
1172230716 20:33333883-33333905 TGAGGAGGCCAAGGCCTGCCCGG - Intergenic
1172250909 20:33478465-33478487 CCAGGAGCTCTAGACCAGCCTGG + Intergenic
1172267593 20:33630155-33630177 CCAGGAGTCCAAGGCCAGCCTGG - Intronic
1172388056 20:34547827-34547849 GCAGGAGCTCAAGACCAGCCTGG - Intronic
1172428595 20:34872788-34872810 GGCGGAGAACGAGGCCAGCCAGG - Exonic
1172854631 20:37992484-37992506 TCAGGAGCTCCAGGCCAGCCTGG - Intronic
1172900865 20:38333913-38333935 GGAGGAGTTCAAGACCAGCCTGG - Intronic
1173795643 20:45857649-45857671 GGAGGAACCCTAGGCCTGACCGG - Exonic
1173808863 20:45943842-45943864 GGGGGAGGCCTTGCCCAGCCTGG - Intronic
1173872377 20:46350191-46350213 GGGCGAGCACCAGGCCAGCCTGG - Exonic
1173991069 20:47303866-47303888 GGAGGATCCCGAGGACTGCCTGG + Intronic
1174087362 20:48018722-48018744 GGAGGAGCCAGAGGCCAGTGCGG - Intergenic
1174128926 20:48328248-48328270 GGAGGAGCCAGAGGCCAGTGCGG + Intergenic
1174354968 20:49991367-49991389 CCAGGAGTCCAAGGCCAGCCTGG + Intergenic
1174472870 20:50773505-50773527 TCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1174643948 20:52069729-52069751 GCAGGAGGTCAAGGCCAGCCTGG + Intronic
1174785798 20:53431245-53431267 TCAGGAGTCCTAGACCAGCCTGG + Intronic
1174820775 20:53724974-53724996 GGAGGAGTTCGAGACCAGCCTGG - Intergenic
1175102181 20:56587210-56587232 TGAGGAGTTCAAGGCCAGCCTGG - Intergenic
1175119648 20:56708214-56708236 GGAGGGGGCCTAGGCCAGGATGG + Intergenic
1175119662 20:56708255-56708277 GGAGGGGGCCTAGGCCAGGATGG + Intergenic
1175119674 20:56708296-56708318 GGAGGAGGCCTAGGCCAGGATGG + Intergenic
1175119689 20:56708337-56708359 GGAGGGGGCCTAGGCCAGGATGG + Intergenic
1175119702 20:56708378-56708400 GGAGGAGGCCTAGGCCAGGATGG + Intergenic
1175413864 20:58788679-58788701 TGAGGACCTCTAGGCCATCCAGG + Intergenic
1175475156 20:59267635-59267657 AGAGGAGCTCGAGACCAGCCTGG - Intergenic
1175875276 20:62226591-62226613 CCAGGAGCCCAAGACCAGCCTGG + Intergenic
1176279530 20:64292624-64292646 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1176313407 21:5218122-5218144 CGAGGAGCTCCAGACCAGCCTGG + Intergenic
1176732735 21:10517156-10517178 ACAGGAGTTCTAGGCCAGCCTGG - Intergenic
1176945828 21:14980262-14980284 GGAGGAGTTCAAGACCAGCCTGG + Intronic
1179091601 21:38271036-38271058 TGGGGAGCCCCAGGCCAGCAGGG + Intronic
1179172732 21:38985280-38985302 GCAGGAGGCCTGGCCCAGCCAGG - Intergenic
1179216900 21:39375149-39375171 TCAGGAGCTCTAGACCAGCCTGG - Intergenic
1179968417 21:44819461-44819483 GGAAGTGCCCTAGGGCAGGCAGG + Intergenic
1180000534 21:44993498-44993520 GGAGGAGGCTCAGGCCTGCCAGG - Intergenic
1180009356 21:45039843-45039865 GGAGCAGCCCTAGGACTGGCGGG + Intergenic
1180094375 21:45549239-45549261 GGAGGGGCCAGAGTCCAGCCTGG + Intergenic
1180697245 22:17759646-17759668 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1180732996 22:17995949-17995971 CCAGGAGCTCTAGACCAGCCTGG + Intronic
1180767918 22:18357358-18357380 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1180778389 22:18505032-18505054 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1180811114 22:18762341-18762363 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1180823804 22:18849562-18849584 TCAGGAGCCCGAGACCAGCCTGG - Intronic
1181008990 22:20029233-20029255 GGAGGAGCCCTAGGCTGGAGAGG + Intronic
1181188932 22:21124985-21125007 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1181197263 22:21196596-21196618 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1181210269 22:21285508-21285530 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1181399255 22:22641431-22641453 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1181550379 22:23635416-23635438 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
1181566450 22:23741746-23741768 TGAGGAGCCCAAGGGAAGCCAGG + Exonic
1181650162 22:24254629-24254651 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
1181707213 22:24656108-24656130 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1181797938 22:25323587-25323609 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
1181904070 22:26179177-26179199 CCAGGAGCTCTAGACCAGCCTGG + Intronic
1181926867 22:26366856-26366878 TCAGGAGTTCTAGGCCAGCCTGG - Intronic
1183186871 22:36296847-36296869 GGAGGAGCTCCAGGCCGCCCTGG - Exonic
1183451386 22:37897424-37897446 TCAGGAGTTCTAGGCCAGCCTGG + Intergenic
1183602356 22:38847284-38847306 TCAGGAGTTCTAGGCCAGCCTGG + Intergenic
1183838462 22:40477118-40477140 TCAGGAGGTCTAGGCCAGCCTGG + Intronic
1183914731 22:41108456-41108478 GCAGGAGTTCAAGGCCAGCCTGG - Intronic
1184141416 22:42579931-42579953 GGAGGAGTTCCAGACCAGCCTGG - Intergenic
1184148349 22:42624451-42624473 GGGGGAGCCGCAGGCCAGCCAGG - Intronic
1184391180 22:44204555-44204577 GGAGGTGGCCTGGGCCAGGCTGG + Intronic
1184517116 22:44969454-44969476 TCAGGAGCCCAAGACCAGCCTGG + Intronic
1184518067 22:44975292-44975314 GGGGGAGTCCAAGGCCAGGCAGG - Intronic
1184541366 22:45127730-45127752 TCAGGAGTTCTAGGCCAGCCTGG + Intergenic
1184589648 22:45473416-45473438 TGAGGAGTTCGAGGCCAGCCTGG - Intergenic
1184751839 22:46490807-46490829 GCAGCAGCCCCAGGCCAGCTGGG - Intronic
1185111436 22:48902287-48902309 GGAGGTGCCCTGGGACTGCCAGG + Intergenic
1185223349 22:49640037-49640059 GGAGGAGGCAGAGGCCAGCCGGG + Intronic
1185279416 22:49963598-49963620 GGAGGTGCCCTCGGCCCACCGGG + Exonic
1185392987 22:50572692-50572714 GCAGGAGCTCAAGACCAGCCTGG - Intronic
1185421148 22:50735079-50735101 GGTGGAGTTCTAGACCAGCCTGG - Intergenic
1185421377 22:50736314-50736336 TCAGGAGCCCCAGACCAGCCTGG - Intergenic
1203216680 22_KI270731v1_random:9923-9945 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1203229535 22_KI270731v1_random:98240-98262 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1203273947 22_KI270734v1_random:75466-75488 TCAGGAGCCCGAGACCAGCCTGG - Intergenic
949467926 3:4362710-4362732 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
949553528 3:5132446-5132468 TGAGGAGTTCAAGGCCAGCCTGG - Intronic
950367591 3:12498967-12498989 CCAGGAGCCCAAGACCAGCCTGG - Intronic
950444758 3:13030304-13030326 GGAGGAGTTCGAGACCAGCCTGG - Intronic
950465819 3:13153131-13153153 AGAGGAGCCCTAGCCTGGCCTGG - Intergenic
950482220 3:13251141-13251163 GGCTGAGCCCTGGGCCAGGCTGG + Intergenic
950522018 3:13502831-13502853 GTAGGTGCCCTAGGCAAGGCTGG - Intronic
950679114 3:14572953-14572975 AGAGGACCACCAGGCCAGCCAGG + Intergenic
950786143 3:15437495-15437517 GGAGGAGTTCAAGACCAGCCTGG - Intronic
951228184 3:20145004-20145026 TGAGGAGCTCGAGACCAGCCTGG - Intronic
952490797 3:33870736-33870758 TGAGGAGTTCAAGGCCAGCCTGG - Intergenic
952506453 3:34010815-34010837 GGTGTAGCCCTTAGCCAGCCTGG + Intergenic
952818790 3:37468196-37468218 TGAGGAGCCGCAGGGCAGCCTGG + Intronic
953150622 3:40320933-40320955 CCAGGAGTTCTAGGCCAGCCTGG + Intergenic
953683287 3:45056449-45056471 CCAGGAGCTCCAGGCCAGCCTGG - Intergenic
953785929 3:45911161-45911183 AGAGCAGCCAGAGGCCAGCCCGG + Intronic
953788437 3:45928733-45928755 GAAGGATGCCTAGCCCAGCCTGG - Intronic
953916624 3:46924636-46924658 GGAGGAGTTCAAGACCAGCCTGG + Intronic
954098018 3:48346624-48346646 TTAGGAGCTCGAGGCCAGCCTGG + Intergenic
954141729 3:48610357-48610379 CGAGGAGTCCAAGACCAGCCTGG + Intronic
954311936 3:49776305-49776327 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
954449297 3:50563125-50563147 GGAGGAGCTCTGGGCCAGGCTGG - Intronic
954579108 3:51693416-51693438 GGTCGAGCCCAGGGCCAGCCTGG - Intronic
955273194 3:57522012-57522034 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
955549619 3:60070012-60070034 GGGGGATCCCTATACCAGCCTGG - Intronic
956055867 3:65298287-65298309 TCAGGAGTCCGAGGCCAGCCTGG + Intergenic
956530572 3:70213180-70213202 CCAGGAGCTCTAGTCCAGCCTGG - Intergenic
956637851 3:71384005-71384027 GCAGGAGTCCCAGACCAGCCTGG + Intronic
956868440 3:73392186-73392208 GCAAAAGCCCTAGGCCAGCATGG + Intronic
958917197 3:100062795-100062817 GGAGGAGGCTTGGGCCAGACAGG - Intronic
959011690 3:101085188-101085210 GCAGGAGTTCGAGGCCAGCCTGG + Intergenic
959289344 3:104452929-104452951 GTAGGAGTTCTAGACCAGCCTGG + Intergenic
959465934 3:106687646-106687668 GGAGGAGTTCAAGACCAGCCTGG + Intergenic
959543330 3:107565962-107565984 TGAGGAGCTCAAGACCAGCCTGG + Intronic
959588949 3:108054171-108054193 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
960063087 3:113343270-113343292 TCAGGAGTCCGAGGCCAGCCTGG - Intronic
960114651 3:113881365-113881387 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
960801774 3:121547179-121547201 TCAGGAGCTCTAGACCAGCCTGG + Intergenic
960825900 3:121784253-121784275 TCAGGAGTTCTAGGCCAGCCTGG - Intronic
961357665 3:126349311-126349333 GGAGGAGCCCTCAGGAAGCCCGG + Intronic
961603279 3:128076573-128076595 GGCTGAGGCCTAGGCCAGGCAGG + Intronic
962518759 3:136178742-136178764 GGAGGAGTTCGAGACCAGCCTGG - Intronic
962781879 3:138726830-138726852 GGAGGAGTTCAAGGCCAACCTGG + Intronic
962785468 3:138764237-138764259 CCAGGAGCCCAAGACCAGCCTGG + Intronic
963261351 3:143194566-143194588 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
964083833 3:152791759-152791781 TCAGGAGCTCAAGGCCAGCCCGG + Intergenic
965165300 3:165188948-165188970 GGAGAATCCCCAGCCCAGCCTGG - Exonic
965533841 3:169803639-169803661 TGAGGAGTCCAAGACCAGCCTGG - Intronic
965584749 3:170307656-170307678 GGAGGAGTTCAAGGCCAGCTTGG - Intergenic
966313024 3:178615678-178615700 GGACCTGCCCTAGGCCAGCGGGG - Intronic
966764209 3:183445630-183445652 CCAGGAGCTCTAGGCCAGCCTGG - Intergenic
966864730 3:184251193-184251215 GCAGGAGCTCAAGACCAGCCTGG + Intronic
966889020 3:184392844-184392866 TGAGGAGTTCTAGACCAGCCTGG + Intronic
967074533 3:185990316-185990338 GGAGGAGCCCTGGGGAAGACAGG - Intergenic
967220164 3:187241986-187242008 GGAGCAGCCCTCAGCCAGGCAGG - Intronic
967899671 3:194436640-194436662 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
967911901 3:194549410-194549432 CCAGGAGTTCTAGGCCAGCCTGG + Intergenic
967915593 3:194576055-194576077 GGAGGAGGCGGAGGCCAGACAGG - Intergenic
968078280 3:195829145-195829167 TCAGGAGCCCAAGACCAGCCTGG - Intergenic
968121477 3:196128904-196128926 GCAGGAGTTCAAGGCCAGCCTGG - Intergenic
968167804 3:196481861-196481883 GGAGGAGTTCAAGACCAGCCTGG - Intronic
968371705 3:198225934-198225956 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
968403595 4:319323-319345 GGAGGAGTTCGAGACCAGCCTGG - Intergenic
968454389 4:689541-689563 GGAGGGGCCAGAGGCCAGCCTGG + Intergenic
968481951 4:837166-837188 GGTGGAGGCCGAGGACAGCCAGG - Intergenic
968552311 4:1229919-1229941 AGGGGAGCCCTGGGCTAGCCTGG + Intronic
968815933 4:2821752-2821774 TCAGGAGCTCCAGGCCAGCCTGG - Intronic
969211620 4:5692235-5692257 CCAGGAGTCCAAGGCCAGCCTGG - Intronic
969709203 4:8833032-8833054 TAAGGAGCCCTAAGCGAGCCGGG + Intergenic
970575893 4:17427347-17427369 TGAGGAGTTCTAGACCAGCCTGG - Intergenic
970588858 4:17541211-17541233 CCAGGAGCTCGAGGCCAGCCTGG + Intergenic
971311167 4:25526740-25526762 TCAGGAGTTCTAGGCCAGCCTGG + Intergenic
971483429 4:27134792-27134814 CCAGGAGCTCAAGGCCAGCCCGG + Intergenic
971564401 4:28119021-28119043 GGAGGAGCCCTGGGGGAGCCAGG - Intergenic
972295335 4:37732383-37732405 GCAGGAGCTCGAGACCAGCCTGG + Intergenic
972576474 4:40356646-40356668 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
972975516 4:44630175-44630197 CCAGGAGCTCTAGACCAGCCTGG - Intronic
973173312 4:47172849-47172871 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
973298711 4:48556102-48556124 TCAGGAGTCCGAGGCCAGCCTGG - Intronic
974305622 4:60135325-60135347 GCAGGAGTCCAAGACCAGCCAGG + Intergenic
975923077 4:79416399-79416421 TCAGGAGCTCTAGACCAGCCTGG + Intergenic
976146056 4:82043948-82043970 GGAAGACCCCCAGGCCCGCCAGG + Intronic
976249583 4:83036222-83036244 GCAGGAGTTCTAGACCAGCCTGG + Intronic
976425435 4:84897588-84897610 GGAGGAGTTCAAGACCAGCCTGG - Intronic
976911706 4:90315054-90315076 GGAGGAGTTCAAGACCAGCCTGG - Intronic
977234945 4:94496697-94496719 CCAGGAGTTCTAGGCCAGCCTGG - Intronic
977260929 4:94796172-94796194 TCAGGAGTCCGAGGCCAGCCTGG - Intronic
977786993 4:101047663-101047685 CCAGGAGTCCTAGTCCAGCCTGG - Intronic
979260393 4:118638412-118638434 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
980960870 4:139473589-139473611 CCAGGAGCTCAAGGCCAGCCTGG - Exonic
982040110 4:151389122-151389144 ACAGGAGCTCGAGGCCAGCCTGG + Intergenic
982165238 4:152608103-152608125 TCAGGAGTCCTAGACCAGCCTGG + Intergenic
982557430 4:156885679-156885701 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
983116840 4:163829021-163829043 GGAAGGGCACTTGGCCAGCCAGG + Intronic
984842719 4:184082971-184082993 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
984986371 4:185334127-185334149 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
985523359 5:389523-389545 CGAGGAGCCCTTAGCCACCCAGG + Intronic
985725341 5:1513164-1513186 GCAGGACCCGGAGGCCAGCCTGG - Intronic
985788848 5:1914680-1914702 TGAGGGTCCGTAGGCCAGCCTGG - Intergenic
985846986 5:2357120-2357142 CCAGGAGCCCAAGACCAGCCTGG + Intergenic
987054204 5:14176095-14176117 GGAGGAGTTCAAGGCCAGCCTGG + Intronic
987296580 5:16557722-16557744 TGAAGAGGCCTAGGCGAGCCTGG - Intronic
987625712 5:20397339-20397361 CCAGGAGTTCTAGGCCAGCCCGG - Intronic
988499591 5:31773427-31773449 TCAGGAGCCCGAGACCAGCCTGG + Intronic
988526239 5:31989631-31989653 TCAGGAGCTCGAGGCCAGCCTGG - Intronic
988976703 5:36523060-36523082 GTAGGAGCTCGAGACCAGCCTGG + Intergenic
989268001 5:39499913-39499935 CGAGGAGTCCAAGACCAGCCTGG - Intergenic
989771795 5:45154441-45154463 GAAGGAGCCCTACGTCTGCCAGG + Intergenic
989810988 5:45674868-45674890 CCAGGAGTTCTAGGCCAGCCTGG + Intronic
990906132 5:60805425-60805447 GGAGGAACCAAAGGCCAGCCAGG + Intronic
991647098 5:68811307-68811329 TGAGGAGTTCAAGGCCAGCCTGG + Intergenic
992414428 5:76539139-76539161 GCAGGAGCCCTTGGGCTGCCAGG - Intronic
992440871 5:76796660-76796682 CGAGGAGCTCAAGACCAGCCTGG - Intergenic
992453972 5:76899141-76899163 TGAGGAGTTCAAGGCCAGCCTGG - Intronic
992933745 5:81679216-81679238 TAAGGAGTTCTAGGCCAGCCTGG - Intronic
993902219 5:93592335-93592357 AGAGGAGCCCTTAGCCAGTCAGG - Intronic
995032785 5:107498123-107498145 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
995341233 5:111062935-111062957 CCAGGAGCTCTAGACCAGCCTGG + Intergenic
996066013 5:119080135-119080157 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
996674306 5:126156818-126156840 TGAGGAGTCCAAGACCAGCCTGG - Intergenic
997000283 5:129751416-129751438 GCAGGAGTTCGAGGCCAGCCTGG - Intronic
997098656 5:130942931-130942953 GGAGCAGCCCTAGGCCAGAAAGG + Intergenic
997832008 5:137158226-137158248 GGAGGAGCCCCAGGGCAGAGGGG + Intronic
997878611 5:137570617-137570639 GGAGGAGTTCCAGACCAGCCTGG + Intronic
998042171 5:138957963-138957985 GGAGGAGTTCAAGACCAGCCTGG - Intronic
998069658 5:139187305-139187327 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
998200591 5:140114828-140114850 GGAGGTGCCCTCGGGCAGCTCGG - Exonic
998254438 5:140573898-140573920 GCAGGGGCCTCAGGCCAGCCCGG + Intronic
998983433 5:147729271-147729293 GGAGGTGACCTAGGCAAGGCTGG - Intronic
1001141254 5:169145836-169145858 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
1001412837 5:171522986-171523008 CCAGGAGTCCAAGGCCAGCCTGG - Intergenic
1001460550 5:171909236-171909258 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1001530967 5:172461421-172461443 TCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1001962958 5:175891505-175891527 TGAGGAGTCCAAGACCAGCCTGG + Intergenic
1002285611 5:178160888-178160910 TCAGGAGTCCTAGGCCAACCTGG - Intergenic
1002543744 5:179924589-179924611 GGAGGAGTTCGAGACCAGCCTGG + Intronic
1002618590 5:180470470-180470492 GGAGGTGCCATAGTCCATCCAGG - Intergenic
1002730945 5:181331480-181331502 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1002753588 6:142624-142646 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
1002852233 6:1006834-1006856 GCAGGAGTTCAAGGCCAGCCTGG + Intergenic
1003211887 6:4076117-4076139 TCAGGAGCTCTAGACCAGCCTGG + Intronic
1003610243 6:7607106-7607128 TCAGGAGCTCAAGGCCAGCCCGG + Intronic
1003630277 6:7780336-7780358 TCAGGAGCCCAAGACCAGCCTGG + Intronic
1003773874 6:9338023-9338045 TCAGGAGCCCGAGACCAGCCTGG + Intergenic
1003872291 6:10412699-10412721 GGCGGAGCCCGCGGCCAGACAGG - Intronic
1004517664 6:16334504-16334526 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1004728507 6:18334455-18334477 CCAGGAGCCCAAGACCAGCCTGG + Intergenic
1005707606 6:28470724-28470746 GTAGGAGTTCTAGACCAGCCTGG + Intergenic
1005990342 6:30898309-30898331 TGAGCAGCCCGAGGACAGCCAGG + Intronic
1006022266 6:31124245-31124267 GGAGGAATCCGAGGCCAGCTGGG + Intronic
1006172699 6:32103938-32103960 TGAGGAGCTCAAGACCAGCCTGG - Intronic
1006359893 6:33581481-33581503 GCAGGAGTTCCAGGCCAGCCTGG + Intergenic
1006478325 6:34272455-34272477 GTGGGAGCCCGAGGCCAACCTGG - Intergenic
1006529382 6:34638095-34638117 CCAGGAGCCCAAGACCAGCCTGG - Intronic
1007071397 6:39040921-39040943 GGAGGAGTTCTAGGGCAGGCAGG - Intergenic
1007638066 6:43312508-43312530 GGAGGAGTTCGAGACCAGCCTGG - Intronic
1007709485 6:43813025-43813047 GCAGGAGTTCAAGGCCAGCCTGG - Intergenic
1008194459 6:48501190-48501212 TTAGGAGCCCAAGGTCAGCCTGG - Intergenic
1008594683 6:53029680-53029702 CCAGGAGTCCAAGGCCAGCCTGG + Intronic
1008703594 6:54130709-54130731 GGAGGATGCCTAAGTCAGCCTGG + Intronic
1009371198 6:62905504-62905526 GAAGGAGTCCCAGGCCAGGCAGG + Intergenic
1009818180 6:68763861-68763883 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1009984318 6:70765008-70765030 CGAGGAGCTCAAGACCAGCCTGG - Intronic
1010361525 6:75000692-75000714 GGAGGAGATCAAGGCCAGCCTGG + Intergenic
1010422396 6:75690118-75690140 GCAGGAGCTCAAGACCAGCCTGG - Intronic
1010968056 6:82235068-82235090 TCAGGAGTCCGAGGCCAGCCTGG - Intronic
1012625962 6:101403072-101403094 CGGTGAACCCTAGGCCAGCCGGG - Intronic
1012980385 6:105823327-105823349 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1013083326 6:106832195-106832217 TCAGGAGCTCTAGACCAGCCTGG - Intergenic
1013114741 6:107094160-107094182 CGAGGAGCTCGAGACCAGCCTGG + Intronic
1013131139 6:107233955-107233977 CTAGGAGCCCAAGACCAGCCTGG + Intronic
1013366083 6:109439564-109439586 GGCGGAGTTCTAGACCAGCCTGG - Intronic
1013513160 6:110861630-110861652 TGAGGAGCTCGAGACCAGCCTGG + Intronic
1013980343 6:116121289-116121311 GCTGGAGCCCCAGGCCAGCCAGG - Exonic
1014070309 6:117174242-117174264 CCAGGAGTTCTAGGCCAGCCTGG + Intergenic
1015559055 6:134495303-134495325 TCAGGAGTCCTAGGCTAGCCTGG - Intergenic
1015574134 6:134652926-134652948 GCAGGAGCTCAAGACCAGCCTGG + Intergenic
1015596212 6:134869935-134869957 TGAGGAGCTCAAGACCAGCCTGG + Intergenic
1015941563 6:138457796-138457818 TCAGGAGCCCAAGACCAGCCTGG + Intronic
1015993241 6:138970570-138970592 TGAGGAGTCCGAGACCAGCCTGG + Intronic
1016139687 6:140593792-140593814 TGAGGAGTTCAAGGCCAGCCTGG - Intergenic
1016461728 6:144285753-144285775 AGAGGAGCCCTTGGCCAGCTCGG + Intronic
1017140254 6:151183679-151183701 CTAGGAGCTCGAGGCCAGCCTGG - Intergenic
1017518738 6:155182548-155182570 CCAGGAGCCCAAGACCAGCCTGG + Intronic
1017523247 6:155220448-155220470 CCAGGAGCCCTGGGCCAGCCTGG + Intronic
1018058876 6:160074494-160074516 CCAGGAGCCTGAGGCCAGCCTGG - Intronic
1018311382 6:162513267-162513289 TGAGGAGTTCTAGACCAGCCTGG + Intronic
1018372324 6:163179492-163179514 GAAGGAGTTCCAGGCCAGCCTGG + Intronic
1019055777 6:169222287-169222309 GGAGTAGCCATAGGCCCGCGTGG + Exonic
1019075097 6:169380595-169380617 AGTGGGGCCCCAGGCCAGCCTGG + Intergenic
1019143428 6:169962212-169962234 GGAGGAGCGCTGGGGCGGCCGGG + Intergenic
1019467456 7:1197211-1197233 CCAGGAGTCCCAGGCCAGCCTGG - Intergenic
1019492290 7:1321165-1321187 GGAGCAGCCTTAGAACAGCCTGG - Intergenic
1019561954 7:1663916-1663938 ACAGCAGCCCGAGGCCAGCCAGG + Intergenic
1019615043 7:1955498-1955520 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
1019697832 7:2457398-2457420 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1019796109 7:3049891-3049913 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1019999205 7:4745281-4745303 TGAGGGGCCCTGGGCGAGCCCGG - Intronic
1020079662 7:5280754-5280776 TCAGGAGCCCGAGACCAGCCTGG - Intronic
1020136123 7:5588981-5589003 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1020139842 7:5606257-5606279 GGAGGCGTCCCAGGCAAGCCTGG + Exonic
1020230927 7:6317956-6317978 GGGGGAGGCCAAGTCCAGCCTGG + Intergenic
1020231852 7:6325184-6325206 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1022384093 7:29885599-29885621 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
1022663291 7:32386680-32386702 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
1023045992 7:36210609-36210631 GGAGGTGTCAAAGGCCAGCCAGG - Intronic
1023402109 7:39798012-39798034 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1024076088 7:45818642-45818664 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1024647515 7:51382648-51382670 GGAGGAGCCCTGGGCCCTCAGGG + Intergenic
1025026769 7:55522716-55522738 GGAGCAGCCCTGGAGCAGCCAGG - Intronic
1025051348 7:55737143-55737165 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
1025059222 7:55789763-55789785 TGAGGAGTCCAAGACCAGCCTGG + Intergenic
1025060116 7:55798398-55798420 GGAGGAGCCCTGGGCCCCTCAGG + Intronic
1025176698 7:56805691-56805713 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic
1025190853 7:56894591-56894613 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1025214859 7:57047623-57047645 TCAGGAGTCCTAGACCAGCCTGG + Intergenic
1025657094 7:63529187-63529209 TCAGGAGTCCTAGACCAGCCTGG - Intergenic
1025681090 7:63682337-63682359 TCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1026101946 7:67390806-67390828 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1026654904 7:72248322-72248344 GGTGGAGTTCTAGACCAGCCGGG - Intronic
1026833698 7:73624539-73624561 GGAACAGCTCTTGGCCAGCCGGG + Exonic
1027167065 7:75842391-75842413 TCAGGAGTCCAAGGCCAGCCTGG - Intergenic
1027589704 7:80102197-80102219 CCAGGAGTCCTAGACCAGCCTGG + Intergenic
1027772939 7:82430205-82430227 TCAGGAGCCCGAGACCAGCCTGG + Intronic
1028322461 7:89477202-89477224 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
1029442612 7:100595408-100595430 CCAGGAGCTCTAGACCAGCCTGG + Intronic
1029662943 7:101975331-101975353 GGAGGAGCTTGAGACCAGCCTGG + Intronic
1030481571 7:110111287-110111309 TCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1030612815 7:111707237-111707259 TGAGGAGTTCAAGGCCAGCCTGG - Intergenic
1030626624 7:111852171-111852193 GGAGGAGTTCAAGACCAGCCTGG - Intronic
1030669038 7:112314582-112314604 GCAGGAGTTCAAGGCCAGCCTGG + Intronic
1030683702 7:112460450-112460472 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1031576064 7:123417325-123417347 TCAGGAGTCCTAGACCAGCCTGG - Intergenic
1032052623 7:128658405-128658427 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1032526095 7:132579026-132579048 GGATTAGCACAAGGCCAGCCGGG + Intronic
1032595602 7:133236530-133236552 TCAGGAGTCCGAGGCCAGCCTGG - Intergenic
1032712533 7:134473291-134473313 CCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1033254620 7:139789454-139789476 CCAGGAGTCCTAGACCAGCCTGG - Intronic
1033369474 7:140695702-140695724 GGAGGGGCCCGGGGTCAGCCTGG + Intronic
1033664435 7:143427458-143427480 GGAGGAGTTCGAGGCCAGCCTGG - Intergenic
1034340178 7:150347732-150347754 CGAGGAGTTCAAGGCCAGCCTGG + Intergenic
1034549137 7:151809248-151809270 GGTGAATCCCTAGGCCAGCCCGG + Intronic
1034825318 7:154257196-154257218 GCAGGAGCACGAGACCAGCCTGG - Intronic
1034996462 7:155580314-155580336 GCAGGAGCCCCAGGTCTGCCTGG - Intergenic
1035208554 7:157310883-157310905 GGAATAGCCCCAAGCCAGCCAGG - Intergenic
1035209495 7:157317351-157317373 GCAGGAGTTCAAGGCCAGCCTGG + Intergenic
1035439365 7:158883426-158883448 TCAGGAGCTCGAGGCCAGCCTGG - Intronic
1035712811 8:1731418-1731440 CGCAGAACCCTAGGCCAGCCAGG + Intergenic
1036638158 8:10565374-10565396 GGAGGAGCCCTCGGCCCCCCTGG - Intergenic
1036974690 8:13397617-13397639 CCAGGAGCTCTAGACCAGCCTGG + Intronic
1037817855 8:22121172-22121194 GCAGGGGCCCTCGGCCAGCACGG + Exonic
1037903186 8:22700199-22700221 TGAGGAGCTCAAGACCAGCCTGG - Intergenic
1038177306 8:25192719-25192741 CCAGGAGCCCAAGACCAGCCTGG - Intronic
1038268819 8:26058844-26058866 TCAGGAGTCCTAGACCAGCCTGG - Intergenic
1038783140 8:30585873-30585895 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1039013828 8:33124375-33124397 TCAGGAGTCCTAGACCAGCCTGG - Intergenic
1039037947 8:33379624-33379646 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
1039198843 8:35063614-35063636 GTAGGAGTCCGAGACCAGCCTGG + Intergenic
1039417985 8:37411894-37411916 GGAAGAGGCCTAGGCCAGGAAGG + Intergenic
1039454387 8:37697639-37697661 CCAGGAGCCCAAGCCCAGCCCGG + Exonic
1039515689 8:38131432-38131454 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
1039648976 8:39320077-39320099 GCAGGAGTTCAAGGCCAGCCTGG - Intergenic
1039806635 8:41005502-41005524 CCAGGAGCTCTAGACCAGCCTGG + Intergenic
1039990851 8:42486404-42486426 CCAGGAGTTCTAGGCCAGCCTGG - Intronic
1040029319 8:42810015-42810037 TGAGGAGTTCGAGGCCAGCCTGG - Intergenic
1040402910 8:47070766-47070788 GTAGGAGTTCGAGGCCAGCCTGG - Intergenic
1040471342 8:47737984-47738006 CCAGGGGCCCTAGGCGAGCCAGG - Exonic
1040517272 8:48145208-48145230 TGAGGAGCTCCAGACCAGCCTGG - Intergenic
1040650808 8:49447177-49447199 GGAGGAGTTCTAGACCAGCCTGG - Intergenic
1040868269 8:52072515-52072537 GGAGGAGTTCAAGGCCAGCCTGG - Intergenic
1041026065 8:53688325-53688347 GCAGGAGCTCAAGACCAGCCTGG + Intergenic
1041045692 8:53883733-53883755 TCAGGAGTTCTAGGCCAGCCTGG + Intronic
1041051563 8:53939639-53939661 GGCGCCGCCCCAGGCCAGCCCGG + Exonic
1041111002 8:54482443-54482465 CCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1041720509 8:60971286-60971308 CCAGGAGCTCCAGGCCAGCCTGG - Intergenic
1041908429 8:63059899-63059921 GCAGGAGTTCTAGACCAGCCTGG - Exonic
1042205879 8:66329187-66329209 TCAGGAGCTCGAGGCCAGCCTGG + Intergenic
1042213810 8:66408636-66408658 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
1042446772 8:68893972-68893994 GGAGGATCCCGAGGACAACCCGG + Intergenic
1042696951 8:71564827-71564849 TGAGGAGTTCAAGGCCAGCCTGG + Intronic
1042869068 8:73380916-73380938 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1043377521 8:79667270-79667292 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
1044563981 8:93643408-93643430 GGAGGAGTCCGAGACCAGACTGG - Intergenic
1044727052 8:95202521-95202543 GGAGGATCTCGAGACCAGCCTGG - Intergenic
1044865496 8:96567061-96567083 TGAGGAGTTCCAGGCCAGCCTGG - Intronic
1045284220 8:100776000-100776022 CGAGGAGCTCCAGACCAGCCTGG + Intergenic
1045676125 8:104609613-104609635 TCAGGAGTCCAAGGCCAGCCTGG - Intronic
1046173297 8:110542073-110542095 CCAGGAGCCCGAGGCCAGCCGGG + Intergenic
1046477395 8:114764057-114764079 GGAGGAGCTTGAGACCAGCCTGG - Intergenic
1046869252 8:119187008-119187030 GGAGGAGTTTTAGACCAGCCTGG + Intronic
1046872865 8:119222616-119222638 CCAGGAGCTCAAGGCCAGCCTGG + Intronic
1047620054 8:126597187-126597209 TCAGGAGTCCGAGGCCAGCCTGG + Intergenic
1048305174 8:133279097-133279119 TCAGGAGCTCGAGGCCAGCCTGG - Intronic
1048381648 8:133870629-133870651 GAAGGAGCAGGAGGCCAGCCAGG - Intergenic
1048878077 8:138852244-138852266 GGTGGAGGCAAAGGCCAGCCAGG + Intronic
1049564877 8:143332808-143332830 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
1049605425 8:143527019-143527041 GGAGGAGGACCAGGCCAGCAGGG + Intronic
1049883952 9:15712-15734 GAAGGAGCCATAGCCCAGGCAGG + Intergenic
1050076877 9:1874895-1874917 TCAGGAGCTCCAGGCCAGCCTGG + Intergenic
1050345572 9:4682536-4682558 GGAGGAGCTCGAGACCATCCTGG - Intronic
1051065722 9:13099923-13099945 GGAGGAGTTCGAGACCAGCCTGG + Intergenic
1051123997 9:13783310-13783332 TTAGGAGTTCTAGGCCAGCCTGG + Intergenic
1051301249 9:15653349-15653371 CCAGGAGTCCAAGGCCAGCCTGG - Intronic
1051613809 9:18987687-18987709 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
1052358295 9:27528542-27528564 GGAGGAGCCCGACCCCAGCGAGG - Intronic
1052819338 9:33126487-33126509 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1053345864 9:37377855-37377877 CCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1053576917 9:39363300-39363322 CGAGGAGTTCGAGGCCAGCCTGG - Intergenic
1054098487 9:60921990-60922012 CGAGGAGTTCGAGGCCAGCCTGG - Intergenic
1054715888 9:68557441-68557463 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1055159913 9:73113777-73113799 GGAGGAGTTCAAGACCAGCCTGG - Intergenic
1055958780 9:81799851-81799873 CCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1056124508 9:83521973-83521995 TGAGGGGCCCTAATCCAGCCTGG - Intronic
1056510969 9:87305307-87305329 GGAGGAGCCATGGGCCTGCCCGG + Intergenic
1056545667 9:87611358-87611380 GCAGGAGCTTGAGGCCAGCCTGG - Intronic
1056954597 9:91072163-91072185 GGAGTAGCCCTTGGCCACCGAGG - Intergenic
1057033090 9:91793549-91793571 TCAGGAGTCCAAGGCCAGCCTGG + Intronic
1057365814 9:94419644-94419666 GGAGGAGTTCAAGACCAGCCTGG - Intronic
1057522010 9:95767589-95767611 TAAGGAGCTCTAGACCAGCCTGG - Intergenic
1057580656 9:96285046-96285068 TGAGGAGCTCAAGACCAGCCTGG - Intronic
1057602507 9:96471053-96471075 GGAGGAGTCCCAGGGCACCCCGG + Exonic
1057628917 9:96703347-96703369 TCAGGAGCTCGAGGCCAGCCTGG + Intergenic
1057657517 9:96968433-96968455 GGAGGAGTTCAAGACCAGCCTGG + Intronic
1058453336 9:105116974-105116996 TCAGGAGTTCTAGGCCAGCCTGG - Intergenic
1058636141 9:107040500-107040522 CCAGGAGCTCGAGGCCAGCCTGG + Intergenic
1058664350 9:107296742-107296764 CCAGGAGCTCAAGGCCAGCCTGG - Intronic
1058879259 9:109272541-109272563 TGAGGAGTTCAAGGCCAGCCTGG + Intronic
1059129018 9:111724730-111724752 GGAGGAGCCCTTTGCTGGCCTGG - Intronic
1059259074 9:112958819-112958841 CCAGGAGCCCAAGACCAGCCTGG - Intergenic
1060071877 9:120557261-120557283 GAAGGATCCCCAGTCCAGCCTGG - Intronic
1060292317 9:122315224-122315246 CCAGGAGCCCAAGACCAGCCTGG - Intronic
1060364724 9:122999398-122999420 TGAGGAGTCCGAGACCAGCCTGG - Intronic
1060638532 9:125219610-125219632 GTAGGAGTTCTAGACCAGCCTGG - Intronic
1060738674 9:126083149-126083171 TGAGGATCCCTAAGCCAGGCAGG + Intergenic
1061129041 9:128697446-128697468 CCAGGAGCTCTAGGCCAACCTGG + Intergenic
1061137982 9:128746987-128747009 GGAGGAGTTCCAGACCAGCCTGG + Intronic
1061270426 9:129537395-129537417 GCAGGAGTTCGAGGCCAGCCTGG + Intergenic
1061415770 9:130446059-130446081 CCAGGAGCTCGAGGCCAGCCTGG - Intronic
1061572097 9:131484233-131484255 GGAGATGCCCTGGGCCAGACAGG - Intronic
1061930620 9:133831224-133831246 TCAGGAGCCCAAGACCAGCCTGG + Intronic
1062315098 9:135963218-135963240 GGAGGAGCCATTGGCCAGGAAGG + Intergenic
1062497968 9:136840510-136840532 CGAGGAGCTCTAGGCCGGCGTGG + Exonic
1062602735 9:137325878-137325900 CCAGGAGTCCTAGACCAGCCTGG + Intronic
1062664796 9:137664112-137664134 CCAGGAGTCCAAGGCCAGCCTGG - Intronic
1062755351 9:138283987-138284009 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1203369158 Un_KI270442v1:286663-286685 TGAGGAGATCGAGGCCAGCCTGG - Intergenic
1203579264 Un_KI270745v1:28159-28181 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1185601212 X:1340773-1340795 GCAGGAGTCCGAGACCAGCCTGG + Intronic
1185874267 X:3689466-3689488 TCAGGAGTCCTAGACCAGCCTGG + Intronic
1186012111 X:5145901-5145923 GGAGGAGTCCAACACCAGCCTGG - Intergenic
1186334073 X:8567582-8567604 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
1186502298 X:10061049-10061071 GGATGAGGCCGAGGCCACCCAGG - Intronic
1186766100 X:12772013-12772035 CGAGGAGCTCGAGACCAGCCTGG - Intergenic
1186981577 X:14962626-14962648 GGAGGAGTCGGAGACCAGCCTGG - Intergenic
1187055914 X:15741275-15741297 GCAGGAGTCCCAGACCAGCCTGG - Intronic
1187141259 X:16596081-16596103 CCAGGAGTTCTAGGCCAGCCTGG - Intronic
1187232338 X:17434941-17434963 GCTGGAGCCCTGGGCCAGGCTGG + Intronic
1187340101 X:18413462-18413484 TCAGGAGCTCGAGGCCAGCCTGG + Intergenic
1188021329 X:25161895-25161917 GCAGGAGTTCGAGGCCAGCCTGG - Intergenic
1188313846 X:28649791-28649813 GGAGGAGCCCTAGCCCTATCAGG - Intronic
1188349614 X:29112137-29112159 TGAGGAGTTCTAGACCAGCCTGG - Intronic
1188892041 X:35623639-35623661 TCAGGAGCTCTAGTCCAGCCTGG + Intergenic
1189392998 X:40593036-40593058 CGAGGAGTCCGAGACCAGCCTGG + Intronic
1189763056 X:44342665-44342687 TCAGGAGTCCGAGGCCAGCCTGG + Intronic
1189847779 X:45152146-45152168 TCAGGAGTCCGAGGCCAGCCTGG + Intronic
1190022415 X:46891205-46891227 TGAGGAGTTCAAGGCCAGCCTGG + Intronic
1190049272 X:47137464-47137486 CCAGGAGCCTGAGGCCAGCCTGG - Intergenic
1190217642 X:48490629-48490651 GGAGGGGCCCAGGGCAAGCCTGG + Intergenic
1190340363 X:49291194-49291216 TGAGGAGCTCGAGACCAGCCTGG - Intronic
1190770234 X:53508152-53508174 CCAGGAGCTCGAGGCCAGCCTGG - Intergenic
1190849223 X:54222339-54222361 CCAGGAGCTCGAGGCCAGCCTGG + Intronic
1190861497 X:54349124-54349146 TCAGGAGCTCAAGGCCAGCCTGG + Intronic
1191213203 X:57910057-57910079 GGAGGAGGCCAAGGCGGGCCCGG - Exonic
1191216408 X:57935947-57935969 ACAGCAGCCCCAGGCCAGCCTGG + Intergenic
1192263673 X:69524299-69524321 CCAGGAGTCCTAGACCAGCCTGG - Intronic
1192402150 X:70846712-70846734 CGAGGAGTTCAAGGCCAGCCTGG + Intronic
1192492442 X:71588002-71588024 CCAGGAGCTCTAGACCAGCCTGG - Intronic
1193058520 X:77180064-77180086 GCAGGAGCTCCAGACCAGCCTGG - Intergenic
1193106307 X:77677995-77678017 TCAGGAGCTCGAGGCCAGCCTGG + Intronic
1193677052 X:84467415-84467437 TGAGGAGTCCAAGACCAGCCTGG + Intronic
1194711901 X:97245620-97245642 TCAGGAGCTCAAGGCCAGCCTGG - Intronic
1195367055 X:104136545-104136567 GGAGCAGCCCTCTTCCAGCCAGG - Intronic
1196396250 X:115264515-115264537 CCAGGAGCTCTAGACCAGCCTGG + Intergenic
1196420485 X:115515760-115515782 CCAGGAGCTCAAGGCCAGCCTGG + Intergenic
1196431138 X:115627056-115627078 GGAGGAGTTCAAGACCAGCCTGG - Intronic
1196738521 X:119002991-119003013 TGAGGAGCTCAAGACCAGCCTGG - Intronic
1196994971 X:121372957-121372979 CCAGGAGTCCAAGGCCAGCCTGG - Intergenic
1197949863 X:131882739-131882761 CCAGGAGCTCAAGGCCAGCCTGG - Intergenic
1198242806 X:134801657-134801679 GGAGTATCCTTAGGGCAGCCTGG + Intronic
1198384274 X:136113735-136113757 TTAGGAGACCAAGGCCAGCCTGG - Intergenic
1199672954 X:150161913-150161935 GAGAGAGCCCAAGGCCAGCCAGG - Intergenic
1199783460 X:151083489-151083511 AGAGGAGCCATAGGCCAGAGCGG - Intergenic
1200115827 X:153769327-153769349 GAAGTAGCCCTAGGCGTGCCGGG + Intronic
1200401855 X:156024447-156024469 GAAGGAGCCATAGCCCAGGCAGG - Intergenic
1202381872 Y:24280781-24280803 GGAGGAGCCCTGGGCCCCTCAGG - Intergenic
1202488912 Y:25389344-25389366 GGAGGAGCCCTGGGCCCCTCAGG + Intergenic