ID: 914675415

View in Genome Browser
Species Human (GRCh38)
Location 1:149904195-149904217
Sequence GCCTGGGATGGAGGAGCCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 8, 3: 54, 4: 539}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675415_914675425 12 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675415_914675429 21 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675429 1:149904239-149904261 GGGAGGAACTGTGGGAGGCAGGG 0: 1
1: 0
2: 14
3: 124
4: 1798
914675415_914675420 -1 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675415_914675426 13 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675415_914675421 0 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
914675415_914675427 16 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675415_914675423 4 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675423 1:149904222-149904244 CACAGAAACCAGATTAGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 197
914675415_914675422 1 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661
914675415_914675428 20 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675415 Original CRISPR GCCTGGGATGGAGGAGCCCT AGG (reversed) Exonic
900140283 1:1136923-1136945 GGCTGGGATGGTCGGGCCCTGGG + Intergenic
900266875 1:1761854-1761876 CCATGGGATGGGGGAGTCCTCGG - Intronic
900308751 1:2023492-2023514 GCCAGGCGTGGAGGAGGCCTGGG + Intronic
900421413 1:2557480-2557502 GCCTGGCAGCGCGGAGCCCTGGG - Intronic
900457975 1:2786556-2786578 CCATGGGATGGAGAAGTCCTAGG - Intronic
900547607 1:3237264-3237286 CCCAGAGACGGAGGAGCCCTGGG - Intronic
900781086 1:4617572-4617594 GCCTGGGGTGGAGGGGCCAGGGG + Intergenic
900830205 1:4960172-4960194 GGCAGGGATGAAGGAGCCCATGG + Intergenic
900992364 1:6103959-6103981 GCCTGGGGTGGAGGTGCACACGG - Exonic
901319261 1:8329837-8329859 CCCTGAGCTGGAGGGGCCCTCGG + Intronic
901513028 1:9727359-9727381 GCCTGGGAAGAAGGTTCCCTCGG - Exonic
901685304 1:10940465-10940487 GCCTGGGAAGGCGGTGGCCTAGG - Intergenic
901702530 1:11053323-11053345 GCCTGAGATGCAGGAGACCCTGG + Intergenic
902010793 1:13269129-13269151 GCCTGGGGTGGGGGAGGTCTGGG + Intergenic
902044122 1:13512874-13512896 GTCTGGGTGGGAGGAGCCGTGGG - Intronic
902202390 1:14843559-14843581 GGCTGGGGTGGAAGAGCCTTTGG + Intronic
902238900 1:15075219-15075241 GCCAGGAAGGCAGGAGCCCTGGG - Intronic
902540744 1:17152708-17152730 CCCTGGAATGGTGGAGCCATGGG + Intergenic
902923488 1:19680807-19680829 GCCAGGCATGGAGGACCCCCTGG - Intergenic
903101500 1:21034920-21034942 GCCAGGCAAGGGGGAGCCCTGGG + Intronic
903260183 1:22127451-22127473 GCCTGGCATGGAGGAGACAGTGG - Intronic
903860348 1:26360880-26360902 GCCTGGGAGGCAGGAGGCCCAGG - Intergenic
904160281 1:28518103-28518125 GGCCGGGCTGGGGGAGCCCTTGG - Intronic
904160292 1:28518124-28518146 TCCCGGGCTGGGGGAGCCCTTGG - Intronic
904425357 1:30419306-30419328 GCCTGGGTGTCAGGAGCCCTGGG + Intergenic
904494338 1:30878227-30878249 GCCTGGGATGGCCCCGCCCTGGG - Intronic
904770445 1:32878315-32878337 GCCTGGGATGGGGCAGCCTTTGG - Intergenic
905414614 1:37795269-37795291 GCCTACGAAGGAGGCGCCCTGGG - Intronic
905812572 1:40923367-40923389 GCCTGGGATGGTGGTTCCCAGGG - Intergenic
906510634 1:46408647-46408669 GCCAGGGATGGAGTAGCCATGGG - Intronic
906587451 1:46991819-46991841 GCGTGGGAAGGAGGAGGCTTTGG + Intergenic
906685533 1:47760945-47760967 GACTGGGATGAAGGGGGCCTTGG + Exonic
906713883 1:47952723-47952745 GCCTGGGTCACAGGAGCCCTGGG - Intronic
906725555 1:48041692-48041714 GCCTGGGAAGGAGCTACCCTGGG + Intergenic
907114384 1:51956082-51956104 GGCTGGGAGGCAGGAGGCCTGGG + Intronic
907272443 1:53298812-53298834 GCCTGGAATGCAGGGGTCCTTGG - Intronic
907313408 1:53552687-53552709 AAGTGGGATGGAGGAGCCCTGGG - Intronic
908119466 1:60971992-60972014 GCATGGTTTGGAGGAGACCTGGG + Intronic
908224098 1:62038835-62038857 GGGTGGGATGGAGGCGACCTTGG + Intronic
908464288 1:64376295-64376317 GGCTGGGCTGGAGGAGCATTTGG + Intergenic
911219754 1:95234239-95234261 GCCTGTGCAGGAGGAGCTCTCGG + Exonic
912372885 1:109187347-109187369 GCAGGGGAAGGAGGAGCCCAGGG + Intronic
912498666 1:110107479-110107501 GCCTGGGATGGAGCAGAACCTGG - Intergenic
912540001 1:110407605-110407627 GGGTGGGATGGAGGCGACCTTGG - Exonic
912949637 1:114111834-114111856 GCCTGGGAGAGAGGAGCTGTGGG + Intronic
914675415 1:149904195-149904217 GCCTGGGATGGAGGAGCCCTAGG - Exonic
915302882 1:154961606-154961628 GCGGGGGATGGAGGCGCCCTTGG + Exonic
915399895 1:155614540-155614562 GCCTAGGATGGCAGAGCCCCTGG + Exonic
915417053 1:155750404-155750426 GCCTAGGATGGCAGAGCCCCTGG + Exonic
916813055 1:168322647-168322669 GCCTGGAATGGAGGCTCCGTTGG + Intergenic
917679967 1:177355660-177355682 GCCTGGGTTTGGGGAGACCTAGG - Intergenic
918058538 1:181043331-181043353 ACCTGTGAGGGAGGAGCCCATGG + Intronic
918131172 1:181631012-181631034 GCCTGGCTGGCAGGAGCCCTGGG + Intronic
919986104 1:202676293-202676315 TCCTGGCCTGGAGGAGCCCATGG + Intronic
920117328 1:203629862-203629884 GCCTGGGATGTTAGAGCGCTGGG + Intronic
920232111 1:204477617-204477639 GCCAGAGAGGGAGGAGCCCAGGG + Intronic
921242010 1:213194521-213194543 CCCAGGGATGGGGGACCCCTGGG - Intronic
921737134 1:218641779-218641801 ACCTGGGAAAGAGGAGCCCCTGG + Intergenic
922725000 1:227918489-227918511 GCCTGGGAAGGAGGAGAAATTGG - Intergenic
922765978 1:228157026-228157048 GACTGGGCGGGCGGAGCCCTGGG + Intronic
922986343 1:229868922-229868944 GGCTGGGATGAAGGGGCCCAGGG + Intergenic
923289096 1:232526866-232526888 GTCTGGGAGGGAAGAGTCCTTGG - Intronic
1062904635 10:1171628-1171650 GCCTGGGATAGAGGAGCTGATGG - Intergenic
1064352164 10:14586213-14586235 GCCTGGGATGGAGGAGGATAAGG - Intronic
1064982057 10:21174482-21174504 GCCTGGGATGAGGGTGCCCCCGG - Intergenic
1065046196 10:21749280-21749302 GCCTGCTCTGGAGGAGCCCTGGG - Intergenic
1065367137 10:24947867-24947889 GCCAGGGAAGGAGGTACCCTGGG + Intronic
1066058402 10:31701789-31701811 GCCTGGGAGGCAGGAGGCCCAGG + Intergenic
1067703889 10:48592761-48592783 GGCTGAGATGGGGGAACCCTGGG - Intronic
1068113297 10:52706977-52706999 TCCTGGGAGGGAGGGTCCCTTGG - Intergenic
1069386036 10:67884480-67884502 GCCTGGGCTGGAAGCGCACTCGG - Intergenic
1069752408 10:70752795-70752817 CCCTGGGCTGGGGGAGCCCCAGG + Intronic
1069897458 10:71688490-71688512 GCCAGGGATGGTGGAGCCAGGGG + Intronic
1069897549 10:71688760-71688782 GCCAGGGATGGTGGAGCCAGGGG + Intronic
1069897594 10:71688895-71688917 GCCAGGGATGGTGGAGCCAGGGG + Intronic
1069897646 10:71689046-71689068 GCCAGGGATGGTGGAGCCAGGGG + Intronic
1069979836 10:72244721-72244743 GCCTGGGATGGCAAAGTCCTAGG - Intergenic
1070554713 10:77518610-77518632 GACTGGAAGGGAGGAGGCCTGGG + Intronic
1070717523 10:78733370-78733392 GGCTGGGATTGGGAAGCCCTGGG - Intergenic
1071509646 10:86253546-86253568 GCCTGGGAGGGAGGAGTGTTCGG - Intronic
1071599964 10:86954241-86954263 GCCTGGTTTGGAGCTGCCCTTGG + Intronic
1073082991 10:100871600-100871622 GCCTGTGATGGAGTGACCCTGGG + Intergenic
1074551009 10:114442375-114442397 GCTTGAGAGGGAGCAGCCCTGGG + Intronic
1075462171 10:122624122-122624144 GCCTGGCAAGGTGCAGCCCTAGG - Intronic
1075467104 10:122659890-122659912 GACTTGGATGCAGGAGCTCTGGG - Intergenic
1075856822 10:125636945-125636967 GACTGGAATGGAGGTGACCTGGG - Intronic
1075924094 10:126236340-126236362 GCCTGCGATGGGGAAGCCCCCGG + Intronic
1076005385 10:126944567-126944589 GACTGAGATGGAGGAGACCGGGG + Intronic
1076153909 10:128188154-128188176 GCCAGGGATGGAGGGGCCACAGG + Intergenic
1077036681 11:498782-498804 AGCTGGGGTGGAGCAGCCCTGGG + Exonic
1077247656 11:1547270-1547292 GCGGGGCGTGGAGGAGCCCTGGG + Intergenic
1077453746 11:2665744-2665766 CCCAGGCATGGAGAAGCCCTAGG + Intronic
1077503857 11:2921424-2921446 GCCCCGGCTGGAGGAGCCCCTGG - Intronic
1078102091 11:8336089-8336111 CACTGAGATGGAAGAGCCCTGGG + Intergenic
1078326925 11:10388671-10388693 GGCTGGGAGTCAGGAGCCCTGGG - Intronic
1078759847 11:14243170-14243192 CTCTGGGATGGGGGAACCCTGGG - Intronic
1079312306 11:19377768-19377790 CCCTGGGAAGCAGGAGACCTGGG - Intronic
1083293541 11:61703040-61703062 GGCTGGGAGTCAGGAGCCCTGGG + Intronic
1083738765 11:64696704-64696726 GCCAGGGATGCAGTAGTCCTGGG - Intronic
1083775576 11:64893002-64893024 GGGTGGGATGGGGGATCCCTGGG + Intergenic
1084500376 11:69531526-69531548 GTCTGGGCTGGAGAAACCCTAGG - Intergenic
1084620332 11:70265590-70265612 GTCTGAGCTGGAGGAGCCCTAGG - Intergenic
1084644358 11:70446052-70446074 GCCTGGGATGGGGGAGCAGGAGG + Intergenic
1084803370 11:71561877-71561899 GGCTGGAAGGGAGGATCCCTTGG + Intronic
1084868545 11:72080276-72080298 GCCTGAGAGGGAGGAGCCGGGGG - Intronic
1085554898 11:77411361-77411383 AACTGGGAGGGAGGAGACCTGGG - Intronic
1089910558 11:122095649-122095671 GGCCGGGAAGGTGGAGCCCTGGG + Intergenic
1089941617 11:122423956-122423978 ACCTGGGATTAAGGAGTCCTGGG - Intergenic
1090150581 11:124379519-124379541 ACCTGAGAAGGAGCAGCCCTGGG - Intergenic
1090334091 11:125951178-125951200 GCCTGGAATGTCAGAGCCCTGGG - Intergenic
1090391895 11:126394232-126394254 TCCTGGGAGGGAGGAGCGCCCGG + Intronic
1090414542 11:126531559-126531581 GCCTTGGGTGGGGGAGCCTTGGG - Intronic
1090515599 11:127423422-127423444 GCCCTGAAGGGAGGAGCCCTAGG - Intergenic
1090939416 11:131374091-131374113 GCCTGGGATGATGGGACCCTGGG + Intronic
1090985669 11:131763645-131763667 GCCTGGGAATGAGGATCCCTGGG - Intronic
1091226253 11:133957864-133957886 GTCTGGGATGGAGGAGACCCAGG + Intergenic
1091714764 12:2768831-2768853 GCCTGGAATGGAATGGCCCTGGG + Intergenic
1092444717 12:8543980-8544002 ACCTGGGAAGCAGCAGCCCTGGG - Intergenic
1092525392 12:9306555-9306577 GGCTGGGATGGAGGTCCTCTAGG + Intergenic
1092541880 12:9425262-9425284 GGCTGGGATGGAGGTCCTCTAGG - Intergenic
1095231580 12:39746295-39746317 GCCTGGCTTGGAGGATCCCACGG + Intronic
1095921193 12:47532871-47532893 ACCAGGGATGGGTGAGCCCTGGG - Intergenic
1095971370 12:47904165-47904187 GCCTGGGCTGGGGGAGCCTTAGG - Intronic
1096123312 12:49102616-49102638 GCCTGGGACTACGGAGCCCTGGG - Intronic
1096569577 12:52514114-52514136 GTCAGGGATGGAGTAGCTCTTGG - Intergenic
1096978802 12:55716666-55716688 GCCTGGGAGTCAGGAGTCCTGGG + Intronic
1097812346 12:64032500-64032522 GCCAGGCATGGAGCAGGCCTGGG + Intronic
1101599184 12:106193846-106193868 GACTGGGAGGCAGGAGACCTAGG - Intergenic
1102148361 12:110671425-110671447 GGCTGGGATGGAAGAGGCCTGGG + Intronic
1102229434 12:111252376-111252398 GCCTGGGGGTGAGGAGACCTGGG - Intronic
1102816119 12:115867856-115867878 GGTTGGGTTGGAGCAGCCCTGGG - Intergenic
1103905865 12:124326940-124326962 GCCTGGTGGGGAGGAGCCCAGGG - Intronic
1104231529 12:126889207-126889229 GCATGTGATGGAGGTGACCTTGG + Intergenic
1104733338 12:131121136-131121158 GCCTCGACTGGAAGAGCCCTGGG - Intronic
1104837052 12:131798404-131798426 GCCTTGGCTGTAGGTGCCCTCGG - Intronic
1106559216 13:30834043-30834065 TCCTGGCATTGAGGAGCCCCAGG + Intergenic
1107417742 13:40217031-40217053 GCCTGGGATAGAAGAGGCCAAGG + Intergenic
1108696657 13:52907838-52907860 GTCTGGGCTGCCGGAGCCCTGGG + Intergenic
1111829883 13:93314569-93314591 GACTGGGATTTAGGAGACCTTGG + Intronic
1112050780 13:95642326-95642348 GCCAGGGAGGGTGGCGCCCTGGG - Intronic
1113272731 13:108692524-108692546 GCCTGGGAAGGAGTAGGCTTTGG + Intronic
1113513740 13:110874839-110874861 GGGTGGAAGGGAGGAGCCCTCGG - Intergenic
1113670165 13:112170796-112170818 GCCTGGGTGAGAGGAGGCCTTGG + Intergenic
1115267940 14:31520904-31520926 CACAGGGATGGGGGAGCCCTTGG + Intronic
1115459501 14:33644672-33644694 GGCTGGGATGGAGAAGCCCCGGG - Intronic
1115507872 14:34110117-34110139 GTCTGTGATGGAGGAGGTCTGGG - Intronic
1116240308 14:42333662-42333684 GCCTGGGAAATAGGTGCCCTGGG - Intergenic
1116859051 14:49979139-49979161 GGCAGGGAGGGAGGAGCCCAGGG - Intergenic
1120883817 14:89435966-89435988 GGATGTGAGGGAGGAGCCCTAGG - Intronic
1121244822 14:92454103-92454125 GCCTTGGATGCAGGAGGCCTTGG + Intronic
1121525068 14:94613952-94613974 CCCAGGGATGAAGGAGCCCTGGG - Exonic
1121586164 14:95064475-95064497 GCCTGTGATGGAGGAGGAATTGG + Intergenic
1122136515 14:99635965-99635987 CCCTGGGAGTCAGGAGCCCTGGG + Intergenic
1122138166 14:99646311-99646333 GCCTGGGGTGGAGAGGCCCCAGG + Intronic
1122257319 14:100488415-100488437 GCCTGAGCTGCAGGAGACCTGGG + Intronic
1122644955 14:103188085-103188107 GGCTGGGATGGGGGAGGCCAGGG + Intergenic
1122771611 14:104100210-104100232 GCCTGGCATGAGGGGGCCCTGGG + Intronic
1122784061 14:104155828-104155850 GCCTGAGATGGGGGAGGGCTCGG + Intronic
1122854786 14:104554820-104554842 GGCTGGGAGGAAGGGGCCCTGGG + Intronic
1122931715 14:104936156-104936178 GCCTGGGATAGTGGGGACCTTGG - Exonic
1123044394 14:105504178-105504200 TGCTGGGGTGGAGGAGCTCTGGG + Intergenic
1123044414 14:105504244-105504266 CCCCGGGCTGGTGGAGCCCTGGG + Intergenic
1123112535 14:105880051-105880073 GCTGGGGCTGGAGGAGCCCTGGG + Intergenic
1125506769 15:40271788-40271810 TCCTGGGGTGGGGGAGCCTTGGG + Intronic
1126384956 15:48084869-48084891 ACCTGGGATGGAGCTCCCCTGGG - Intergenic
1126840509 15:52713274-52713296 ACTTGGGATGGAGGACACCTGGG + Intergenic
1127389553 15:58494321-58494343 TCCTGGGAGGCAGGGGCCCTTGG + Intronic
1128088680 15:64904311-64904333 GGCTGGGCTGGCAGAGCCCTGGG + Intronic
1128345463 15:66850074-66850096 GCTTGCGCTGCAGGAGCCCTTGG + Intergenic
1128747183 15:70122972-70122994 TTCTAGGAAGGAGGAGCCCTGGG - Intergenic
1128976283 15:72156079-72156101 ACCTGGACTGGAGGGGCCCTGGG + Intergenic
1129122974 15:73414175-73414197 ACCTGGGAGGCAGGAGGCCTGGG - Intergenic
1129274259 15:74434720-74434742 GCCTGAGATAGCTGAGCCCTAGG - Intergenic
1129361422 15:75026937-75026959 GCCTGTGAAGCAGAAGCCCTGGG - Intronic
1129385536 15:75194159-75194181 GCCTGGGATGGTAGAGCTATGGG - Intergenic
1129538525 15:76333360-76333382 GGCTGGCATGCAGGAGACCTGGG - Intergenic
1129681194 15:77659386-77659408 TCCTTGGATGGGGGAGTCCTAGG - Intronic
1129683344 15:77670918-77670940 GCCTGGGCTGGAGGAGCTAGGGG - Intronic
1129718627 15:77865859-77865881 GCCTAGGACGGAGCAGGCCTAGG + Intergenic
1130460297 15:84155007-84155029 GCCTAGGACGGAGCAGACCTAGG - Intergenic
1132826858 16:1909474-1909496 GCCTGGGATGGAGAGGCCTGTGG + Intergenic
1132891865 16:2208624-2208646 GCCAGGGATGGGGGAGGCCAGGG - Intronic
1132968787 16:2674705-2674727 GCCTGGGGTGGAGGAGCCTCGGG + Intergenic
1133049027 16:3106360-3106382 CCCAGGCATGGAGGAGGCCTCGG + Intergenic
1133218828 16:4309629-4309651 GCCTCTGATGAAGGAGCCCAAGG + Intergenic
1133331511 16:4977537-4977559 GCCTGGCATGAAGTTGCCCTTGG - Intronic
1133346931 16:5077543-5077565 GCCTGGGATGACGGCGGCCTGGG + Intronic
1133510990 16:6457285-6457307 GCCTGTGATGGAGTGGCCATAGG + Intronic
1133594616 16:7279629-7279651 GCCTGGCATGGAGGTGAGCTGGG + Intronic
1133752517 16:8735872-8735894 TCCTGGGCTGGAAGAGCCCTTGG + Intronic
1134365513 16:13574036-13574058 GCCTGGGAGGCAGGAGCCACTGG - Intergenic
1134441648 16:14302477-14302499 GCCCGGGAAGGCGCAGCCCTGGG + Intergenic
1136548071 16:30966398-30966420 GCCTGGGACCGGGGAGCCCTGGG + Intronic
1136576363 16:31127617-31127639 TCCTGGGATGGAGCTGGCCTTGG - Intronic
1136654679 16:31702836-31702858 ACCTGGGCTGGAGAAGCCCCTGG + Intergenic
1137480790 16:48850271-48850293 GCCAGGGCTGCAGGAGCTCTGGG - Intergenic
1137565415 16:49529775-49529797 GCCTGGGAGGGAGGAGCGGCGGG + Intronic
1137675043 16:50299955-50299977 CCCTGGGAAGCAGGGGCCCTGGG - Intronic
1137758341 16:50920172-50920194 ACCTGGGATGGAGCAGCACACGG + Intergenic
1140808332 16:78553708-78553730 GTCTGTGAGGGAGGAGGCCTGGG + Intronic
1140832648 16:78765825-78765847 CCCTGGGATGGTGGAGCCTAAGG + Intronic
1141152440 16:81573501-81573523 GCCTGGGATGCAGGAGACTGAGG + Intronic
1141991879 16:87615292-87615314 GCCTGGGCTGGAGTAGACCCAGG + Intronic
1142718749 17:1762662-1762684 GGCTGGGATGGAGGACAGCTGGG + Intronic
1142971172 17:3612691-3612713 CCCTAGGCTGGAGAAGCCCTAGG - Intronic
1143034214 17:3985257-3985279 GCATGGGAGGGATGAGCGCTTGG - Intergenic
1143137509 17:4720086-4720108 GCCTGGGCTGCTGGGGCCCTGGG + Intronic
1143205886 17:5139060-5139082 GCCTGGCATGGGGAAGCCGTTGG - Intronic
1143260042 17:5591980-5592002 GCATGGGAAGGAGGAGGCTTTGG - Intronic
1143363287 17:6388538-6388560 GCCTGTGCCGGAGGGGCCCTGGG - Intergenic
1143376502 17:6470536-6470558 CCCTGGCCTGGAGGAGGCCTGGG + Intronic
1143732906 17:8891011-8891033 GCCTGGGCTTGAGGAGGCCCTGG - Intronic
1143908860 17:10230940-10230962 TCCTAGGATGGGAGAGCCCTTGG - Intergenic
1144767147 17:17739038-17739060 CCCAGGGGTGGAGGAGGCCTTGG - Intronic
1144772056 17:17765367-17765389 TTCTGAGGTGGAGGAGCCCTAGG - Intronic
1144849250 17:18235760-18235782 GGCTGGGCGGGTGGAGCCCTGGG - Intronic
1144941518 17:18945372-18945394 GGCTGGGGTGGTGGAGCACTTGG + Intergenic
1145762443 17:27433558-27433580 TCCTGGGACAGAGGAGCCCTGGG - Intergenic
1146692785 17:34888190-34888212 GCCTGGGATGCAGGTGTCCCTGG + Intergenic
1146937099 17:36818692-36818714 GGCTGGGCTGGGGGAGCCCTGGG + Intergenic
1147363319 17:39944700-39944722 GCTGAGGATGGAGGAGTCCTCGG - Exonic
1147878432 17:43638236-43638258 GGCTGAAATGGAGGATCCCTAGG - Intergenic
1147952118 17:44113076-44113098 GCGTGGGTGGGAGGAGTCCTGGG - Intronic
1148129587 17:45254893-45254915 GCGAGGGCTGGAGGAGGCCTGGG - Intronic
1148354329 17:46965415-46965437 GACAGGGAAGCAGGAGCCCTGGG - Intronic
1148505468 17:48123668-48123690 GCCTTGGAAGGAGAAGTCCTAGG + Intergenic
1148996671 17:51716300-51716322 GGTTGGGATGGAAGAGCCCTGGG + Intronic
1149536351 17:57436594-57436616 GCCTGGGGCAGAGGAGCCCCTGG + Intronic
1149550086 17:57533488-57533510 ACCTGGGATTGATGAGCCCCAGG + Intronic
1150128518 17:62653718-62653740 GGCTGGGATGGAGGGGCTGTTGG + Intronic
1150280492 17:63927464-63927486 CCCTGGGTTGGGGGAGGCCTTGG - Intergenic
1150484904 17:65536974-65536996 GCCAGGGAAGGAGGGGCCCCCGG - Exonic
1151429274 17:74051579-74051601 GCCCGGGCTGGGGAAGCCCTAGG + Intergenic
1151620618 17:75242785-75242807 GCACGGGGTGGAGGAGCCCATGG - Intronic
1151885801 17:76922768-76922790 TGGAGGGATGGAGGAGCCCTTGG + Intronic
1152008375 17:77696230-77696252 GCCTGGGTTGGCGGAGCGGTGGG + Intergenic
1152198945 17:78934102-78934124 GCCAGTGATGGAGAAGCCCTGGG - Intergenic
1152524837 17:80882485-80882507 GCCGGGGACAGGGGAGCCCTCGG + Intronic
1152657760 17:81527874-81527896 GTCTGGGGTGGAGGCGACCTGGG + Intergenic
1152691602 17:81720636-81720658 GCCTGGGAGGGAGTGGCCCAGGG + Exonic
1152797090 17:82313852-82313874 GCCTGGGATGACGGCGGCCTGGG + Intergenic
1152912669 17:83013957-83013979 GTGGGGGATGGAGGAGCCCACGG + Intronic
1152925170 17:83084373-83084395 ACGTGTGAAGGAGGAGCCCTGGG - Intronic
1153059822 18:983311-983333 GCCTGGGAAGGAGAAGCCATGGG - Intergenic
1158758564 18:60356154-60356176 GCCTGAGATGGAGAGGACCTGGG - Intergenic
1160353146 18:78202022-78202044 CCCTGAGATGGAGGAGACCTGGG - Intergenic
1161103899 19:2433972-2433994 GCTGGAGGTGGAGGAGCCCTTGG - Exonic
1161155906 19:2731856-2731878 GCGTGGGCTGGGGCAGCCCTGGG - Intronic
1161234310 19:3190314-3190336 GCCTGGGATGGAGGAGCCACAGG - Intronic
1161433515 19:4248216-4248238 TCCTGGGAAACAGGAGCCCTGGG + Intronic
1161574708 19:5049034-5049056 GCCTGGGCTGGGGGAGACCCTGG + Intronic
1161588839 19:5119597-5119619 ACCAGGGAGGGAAGAGCCCTAGG - Intronic
1162514405 19:11139258-11139280 GGCTGGCATGGAGGAGACCAAGG - Intronic
1162533198 19:11247612-11247634 GGCTGGTGTGGAGGGGCCCTGGG + Intronic
1162556641 19:11390649-11390671 GCATGGGATGGGGGAGCTGTTGG + Intronic
1163231186 19:16003259-16003281 GTGGGGGCTGGAGGAGCCCTGGG - Intergenic
1163602928 19:18259514-18259536 GCCTCGGATGGTGGAGCCCGGGG + Intronic
1164633062 19:29774176-29774198 GCCTGGGTTGGAGGGGAGCTGGG + Intergenic
1164822530 19:31261141-31261163 GCCAGGGGTGGGAGAGCCCTTGG - Intergenic
1165150316 19:33756502-33756524 TCAGGGAATGGAGGAGCCCTTGG - Intronic
1165266150 19:34664958-34664980 ACCTGGGCAGGAGGTGCCCTGGG - Intronic
1165273780 19:34732015-34732037 ACCTGGGCAGGAGGTGCCCTGGG - Intergenic
1165308065 19:35014143-35014165 GGCTGGGATGGAGGTGGCCAAGG + Intronic
1166069157 19:40377386-40377408 GGCTGGGATGGAGGAGGCCCAGG + Intronic
1166084814 19:40467498-40467520 GCCTGGGAAGGACAAGGCCTGGG - Intronic
1166104232 19:40589576-40589598 GGATGGGATGGAGGAGACCCAGG + Intronic
1166182530 19:41119019-41119041 GGCTGGGATGGGGGAAGCCTGGG + Intronic
1166190423 19:41173059-41173081 GGCTGGGATGGGGGAGGCCAGGG - Intergenic
1166339812 19:42130911-42130933 GGCTGGGATGGGGGAGGCCCAGG - Intronic
1166339891 19:42131117-42131139 GGCTGGGATGGGGGAGGCCCAGG - Intronic
1166339906 19:42131152-42131174 GGCTGGGATGGGGGAGGCCCAGG - Intronic
1166375410 19:42324602-42324624 GCCGGGGATGGGCGAGCTCTCGG - Intronic
1166759885 19:45217900-45217922 GGCTGGGATGGAGCACCCTTTGG - Intronic
1166774440 19:45303679-45303701 GCCTGGCATGGAGTAGGCATGGG - Exonic
1166792581 19:45406690-45406712 TCCCAGGATGGAGGAGCCCCAGG + Exonic
1167106381 19:47432165-47432187 ACCAGGGATGGAGGTGCCCAGGG + Exonic
1167162044 19:47774343-47774365 GCCAGCGATGGAGGAGCCAGGGG + Intergenic
1167221099 19:48198683-48198705 GGCTGAGCTGGAGGATCCCTTGG - Intronic
1167410130 19:49339492-49339514 GCCTGGGAAGGACGAGCTCAGGG + Intronic
1168498433 19:56873557-56873579 GCCTGGGATGGAGAACGCATGGG + Intergenic
925332914 2:3072627-3072649 GTCTGGGCTGGAGGAACCCCAGG + Intergenic
925666100 2:6257993-6258015 GCCTGGGATGCAGGTGGGCTGGG - Intergenic
925922513 2:8647038-8647060 GCCTGGGATGGAGTGGATCTCGG - Intergenic
926062596 2:9813629-9813651 GCTTGGGATGGAGGCGTCCCTGG - Intergenic
926129437 2:10292447-10292469 GCCAGGGATGGAGGAGGAATTGG - Intergenic
926317726 2:11723668-11723690 GACTGGGAAGGAGGAGCACAGGG + Intronic
926767499 2:16335100-16335122 GCCTGTGAAGGAGGAGGACTGGG - Intergenic
927062871 2:19440803-19440825 CCCTGGCATGGAGAAACCCTTGG + Intergenic
927157743 2:20231331-20231353 GCCTAGGCTGGAGGAGCCAGTGG + Intergenic
927881310 2:26692026-26692048 GCCTGGGAGGAAGGAACGCTTGG + Intergenic
928394400 2:30932489-30932511 GCCTGGAAAGGAGGAGCCTTGGG + Intronic
930124321 2:47783834-47783856 GCCTGGGAGGTGGGAGCACTGGG + Intronic
930247972 2:49004118-49004140 GCCTGGGAAGGAGAAATCCTTGG - Intronic
930701640 2:54463453-54463475 GCTTTGGATGGAGGGGCCCTGGG + Intronic
931317966 2:61150244-61150266 TCCTGGGATGGAGGTGCACCTGG + Intronic
931790190 2:65658051-65658073 GCAGGGGCTGGAGGACCCCTTGG + Intergenic
932929343 2:76015388-76015410 GCCTGGGACCCAGGAGACCTTGG - Intergenic
932974036 2:76577889-76577911 GCCTGGCAAGGAGCAGCCTTGGG + Intergenic
933123172 2:78568586-78568608 GCTTGGCTTGGAAGAGCCCTTGG - Intergenic
933775817 2:85770627-85770649 GCCTGGGCTGGAGGGGTCATTGG + Intronic
933794388 2:85907942-85907964 GCCTTGCATGGGGGAGGCCTGGG - Intergenic
933846697 2:86332561-86332583 GTCGGGGGAGGAGGAGCCCTGGG - Intronic
936616234 2:114050474-114050496 GCCAGGGTGGGAGGAGCACTTGG + Intergenic
937206168 2:120238542-120238564 GGCTGGGGTGGAGGAGGCCTGGG + Intergenic
937321967 2:120966434-120966456 GCCTGGGATGAAGGGACTCTGGG - Intronic
938466857 2:131530359-131530381 CCCTGGGAAGGGAGAGCCCTAGG - Intronic
939063053 2:137448277-137448299 GCCTGGGATGGCAGAACACTGGG + Intronic
942197629 2:173537474-173537496 GTCTGGGAAGGAGAAACCCTAGG - Intergenic
942961374 2:181833379-181833401 GCCTGGAAGATAGGAGCCCTTGG - Intergenic
943141818 2:183992746-183992768 GCCTGGCATGGGGGACCCATAGG - Intergenic
945308477 2:208283108-208283130 CCCTGGGATTGGGGACCCCTGGG + Intronic
945316117 2:208372348-208372370 TCCTGGGATGGATGGGACCTTGG + Intronic
945946438 2:216000117-216000139 GGGTGGAATGCAGGAGCCCTTGG - Intronic
946008228 2:216543496-216543518 GCCTGGTTTGGAGTAGCCATGGG - Intronic
946326388 2:218986599-218986621 CCCAGGGGTGGAGGAGGCCTGGG + Intergenic
946400608 2:219466501-219466523 GCATGGCATGGAGGGGCCCAAGG + Intronic
948305586 2:236944707-236944729 TCCTGAGCTGGAGGAGCCCTGGG - Intergenic
948408725 2:237742767-237742789 GCCTGGGAGGGAGGAGCAACAGG + Intronic
948473910 2:238204093-238204115 GGCTTGGATGGAGCGGCCCTGGG + Intergenic
948478187 2:238234636-238234658 GGCTGGAAGGGAGGAGCCCCGGG + Intergenic
948530063 2:238598564-238598586 GCCAGGGATGGGGGATCCCACGG - Intergenic
948608787 2:239154060-239154082 AGCAGGGATGGGGGAGCCCTAGG - Intronic
948631473 2:239305528-239305550 GCCTGGGATGGAGGGGCAAGAGG + Intronic
948746146 2:240095654-240095676 GCCGCGGATGCAGGAGCCCCAGG + Intergenic
949021437 2:241743267-241743289 GCCTGGGTTGGGGGTGCCATGGG - Intronic
949022969 2:241751880-241751902 GCCTGGGCAGGGGGAGCCCTCGG + Intronic
949022984 2:241751917-241751939 GCCTGGGCAGGGGGAGCCCTCGG + Intronic
949022999 2:241751954-241751976 GCCTGGGCAGGGGGAGCCCTCGG + Intronic
1168961399 20:1872432-1872454 GACTGGGGCGCAGGAGCCCTGGG - Intergenic
1169590283 20:7133290-7133312 GGCTGGGATGGCAGGGCCCTGGG - Intergenic
1170029554 20:11930986-11931008 TTCTGGGATGGTAGAGCCCTAGG - Intergenic
1170827636 20:19810067-19810089 GCTGTGGATGGTGGAGCCCTAGG - Intergenic
1170945201 20:20885251-20885273 GCCTGGAGAGCAGGAGCCCTGGG + Intergenic
1171232572 20:23499553-23499575 GCCTGAAATGCAGGAGCACTGGG + Intergenic
1171310564 20:24141576-24141598 GCACAGGATGGAGGAGCCATGGG + Intergenic
1171971136 20:31566045-31566067 GTCTGGGAGTTAGGAGCCCTGGG + Intronic
1172102389 20:32493091-32493113 GGCTTGTATGGAGAAGCCCTGGG - Intronic
1172449543 20:35012200-35012222 GCATATGATGGAGGTGCCCTGGG + Intronic
1172474815 20:35228510-35228532 GCCTGGGATTAAGGAGGCCTGGG + Intronic
1172591310 20:36119965-36119987 GTCTGGGAGAGAGGACCCCTGGG - Intronic
1173911537 20:46674427-46674449 GCCTGGGATGGAGGAGGCCAGGG - Intronic
1174075337 20:47931516-47931538 GCCTGGGGAGTAGGAGGCCTAGG + Intergenic
1174628421 20:51935185-51935207 GCAGGGCATGGAGGAGGCCTGGG + Intergenic
1175708331 20:61198407-61198429 GTTCGGGCTGGAGGAGCCCTGGG - Intergenic
1175735360 20:61382416-61382438 CCCTGGCATGGGGGACCCCTGGG + Intronic
1176071129 20:63226914-63226936 GCCTGGGACAGAGGGGCCTTGGG - Intergenic
1176250176 20:64116853-64116875 GCCCGAGAAGGAGGAGCCCCAGG - Intergenic
1176297277 21:5080824-5080846 GCCTGGAATGGAGGAGGCCTTGG - Intergenic
1176822207 21:13667440-13667462 GCTGGAGATGGAGGAGCCCCTGG - Intergenic
1178185376 21:30213101-30213123 GCCTAGGATGAATGAGCACTTGG + Intergenic
1178919389 21:36728711-36728733 GCCTGGGCTGGCCCAGCCCTGGG + Intronic
1179080729 21:38168595-38168617 GCCTGGGAGGGAGCTGCCCTTGG - Intronic
1179631822 21:42683599-42683621 TCCTGAGATGGAGAAGCCCCAGG + Intronic
1179859752 21:44181124-44181146 GCCTGGAATGGAGGAGGCCTTGG + Intergenic
1179998524 21:44984888-44984910 GCCGGGGGTGGAGGGGCCGTGGG - Intergenic
1180099802 21:45579142-45579164 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099854 21:45579261-45579283 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099860 21:45579278-45579300 CCCTGGAATGGAGGCGCCCCTGG + Intergenic
1180099883 21:45579329-45579351 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099905 21:45579380-45579402 CCCTGGGATGGGGGCGCCCCTGG + Intergenic
1180099924 21:45579431-45579453 ACCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099933 21:45579448-45579470 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099955 21:45579499-45579521 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099969 21:45579533-45579555 CCCTGGGATGCCGGTGCCCTGGG + Intergenic
1180099981 21:45579566-45579588 ACCTGGGATGCAGGTGCCCCTGG + Intergenic
1180099990 21:45579583-45579605 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180099996 21:45579600-45579622 CCCTGGGATGCAGGCGCCCCTGG + Intergenic
1180100004 21:45579617-45579639 CCCTGGGGTGGAGGTGCCCCTGG + Intergenic
1180100057 21:45579770-45579792 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180100076 21:45579821-45579843 CCCTGGGATGGGGGTGCCCCTGG + Intergenic
1180100094 21:45579855-45579877 CCCTGGGATGGGGGTGCCCCGGG + Intergenic
1180101043 21:45586082-45586104 GGCTGGGATGTTGGAGGCCTTGG - Intergenic
1181089736 22:20464502-20464524 GACTGGGATGGAGAGGACCTAGG - Intronic
1181759555 22:25048827-25048849 GCCAGGGATGGAGGAGGCTAGGG + Intronic
1182574306 22:31262546-31262568 GCCTGGGATGGGGCAGCCTGTGG + Intronic
1183165476 22:36144274-36144296 GCCTGGGTTGGAGGAGCAGCAGG - Intronic
1183667806 22:39255263-39255285 GCCTGGGATGGGGGAGGCCACGG + Intergenic
1184291667 22:43500734-43500756 GCCTGGGTTGGAGGGCCCCCAGG + Intronic
1184423901 22:44397738-44397760 CCGTGGCATGGAGGAGCCCACGG + Intergenic
1184470270 22:44692170-44692192 GCCCCGGGTGGAGGAGCCCCGGG - Intronic
1184470297 22:44692244-44692266 GCCCCGGGAGGAGGAGCCCTGGG - Intronic
1184470344 22:44692361-44692383 GCCCCGGGAGGAGGAGCCCTGGG - Intronic
1184470424 22:44692565-44692587 GCCCCGGGAGGAGGAGCCCTGGG - Intronic
1184975481 22:48058602-48058624 GGCTGGGAGGAGGGAGCCCTAGG - Intergenic
1185161964 22:49235550-49235572 GCCTGGGAAAGGGGAGCCCAGGG - Intergenic
1185295244 22:50049852-50049874 GCCCGGGCAGGAGGAGGCCTGGG + Intronic
949533419 3:4978580-4978602 TCCTGGGAGCGAGGGGCCCTCGG + Intergenic
949564424 3:5231847-5231869 GCCTGAGATGGGGGTGCCGTGGG + Intergenic
950128886 3:10528207-10528229 GGCTGGCATGGAGCAGCCCTGGG + Intronic
950424961 3:12920282-12920304 GTCTGGCATGGAGGGGCCTTTGG - Intronic
950528115 3:13536369-13536391 GTCTGTGATGGAGGAGGCCGGGG + Intergenic
950692456 3:14671013-14671035 GCCAGGCATGGAGCAGACCTGGG + Exonic
952965739 3:38620192-38620214 GCCTGGGCTGCAGCAGGCCTGGG + Intronic
953863513 3:46564750-46564772 GCCTGGGGTGGAGGGGTCCTGGG - Intronic
954295846 3:49674191-49674213 GCCTGGGAGCGAGAAGTCCTGGG - Exonic
954748196 3:52798853-52798875 GCCTCACAGGGAGGAGCCCTTGG - Intronic
955001631 3:54932746-54932768 GACAGGGATGGAGGAGCACTTGG - Intronic
955383838 3:58462961-58462983 CACTGGGCTGGAGGAGGCCTAGG - Intergenic
956302872 3:67791471-67791493 GCCTGAGAAGTAGGAGACCTGGG + Intergenic
956416937 3:69041925-69041947 TCCTGGGAGAGAGGAGCCTTTGG - Intronic
956797822 3:72732211-72732233 GCCTGGCTTGGAGGTGCCCTGGG + Intergenic
960178031 3:114540443-114540465 GCCTAGGTATGAGGAGCCCTGGG - Intronic
960700721 3:120436814-120436836 ACCAGGGATGGTGGTGCCCTGGG + Intronic
961103982 3:124225489-124225511 GCCTGGGAAGTAGAAGCCCTAGG + Intronic
961485472 3:127212866-127212888 GCCTGGCAGGTGGGAGCCCTAGG - Intergenic
961565618 3:127761412-127761434 GCTGGAGAAGGAGGAGCCCTGGG - Intronic
961830357 3:129619970-129619992 TTCTGGGATGGAGGCTCCCTGGG - Intergenic
962609894 3:137066335-137066357 GGCCTGGATGGAGGAGCCCCAGG - Intergenic
964319573 3:155481139-155481161 GCCTGCGATGTAGGAGCCGGTGG + Exonic
966831903 3:184017449-184017471 GCCTGGGATGCCCGGGCCCTAGG + Intronic
968439796 4:617510-617532 GCCAGGCTCGGAGGAGCCCTGGG - Intergenic
968575619 4:1364752-1364774 GGCTGGGGTGGAGGTGCCCCAGG - Intronic
968770594 4:2503439-2503461 GCTTGGGAAGCAGGAGTCCTAGG + Intronic
969732334 4:8964447-8964469 GCCGGGGATGGAGCGCCCCTGGG + Intergenic
970644096 4:18099355-18099377 TCCTGAGATGGAGGAGACTTTGG + Intergenic
971268709 4:25117321-25117343 GCCAGGGCAGGGGGAGCCCTCGG + Intergenic
972094637 4:35333931-35333953 GCCTGGGAAGGAGCTGCCCAAGG - Intergenic
972203862 4:36747816-36747838 CTCTGGGATGGAGAGGCCCTGGG - Intergenic
972314954 4:37917561-37917583 GATGGGGATGGAGGAGCCATGGG + Intronic
972653777 4:41046772-41046794 GCCTGGGAGGCAGCTGCCCTTGG - Intronic
976102264 4:81578307-81578329 GCCCAGGCTGGAGGAGCCCTAGG - Intronic
977886956 4:102262812-102262834 GCCTGGTATATAGGAGCCTTTGG - Exonic
978559884 4:110021963-110021985 CCCTGGGCAGGAGGAGCCCCAGG + Intergenic
981269919 4:142833847-142833869 GCCTGGGATAGAAGAGCTTTGGG - Intronic
982165628 4:152611477-152611499 GTCTGGGATGGAGCAGGCTTGGG - Intergenic
982192612 4:152873673-152873695 GGCTGGGATGGAGGAGAACGGGG - Intronic
984735984 4:183108529-183108551 CCCAGGGGTGGAGGAGTCCTGGG + Intronic
985545811 5:508449-508471 GCCTGGGATGGAGATGCCGCAGG + Intronic
985545852 5:508618-508640 GCCTGGGATGGAGATGCCGCGGG + Intronic
985642372 5:1069629-1069651 GCCTGGGAATGAGGTGCCCTTGG + Intronic
985654296 5:1121939-1121961 GCCTGGCATGAAGCAGGCCTAGG - Intergenic
985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG + Intergenic
985764133 5:1768038-1768060 CCCTGGGCTGAGGGAGCCCTGGG + Intergenic
985861174 5:2471670-2471692 GGCTGGGAAGGAGGAGCCCTGGG + Intergenic
986304651 5:6506325-6506347 GCCTGCCAGGGAGGGGCCCTTGG + Intergenic
986412515 5:7494589-7494611 GCCAGGCCTGGAGGAGCCCTTGG - Intronic
988708948 5:33754396-33754418 ACCTGGGCAGGATGAGCCCTAGG + Intronic
991413373 5:66367036-66367058 GAGAGCGATGGAGGAGCCCTGGG + Intergenic
991470834 5:66967335-66967357 GCCTGGCCTGGAGAAGCCCCTGG - Intronic
993480549 5:88419093-88419115 GCCTGGGAATCAGGAGCCCTGGG - Intergenic
994310825 5:98268312-98268334 ACCTGGTATGAAAGAGCCCTTGG + Intergenic
994627820 5:102243078-102243100 GCCTGGGTTGGAGGGGCCTATGG + Intronic
995436676 5:112144124-112144146 CCCTGATATGGAGCAGCCCTGGG + Intronic
995697748 5:114899339-114899361 GCCTGGGATGGTGGTGGCCATGG - Intergenic
998038648 5:138937121-138937143 GCAGAGGATGGAGGAGCCCAGGG - Intergenic
998205666 5:140155377-140155399 GCCTGGGATGAAGGGATCCTGGG - Intergenic
998392723 5:141797702-141797724 GCCTCAGATGCAGGAGCTCTGGG + Intergenic
998395409 5:141814813-141814835 GCCTGGGATGGGGTTGCCATGGG - Intergenic
999081072 5:148844126-148844148 GCCAGCGAGGAAGGAGCCCTTGG - Intergenic
999093651 5:148958882-148958904 GCCTGGGACTGAAGAGCCCATGG - Intronic
999252047 5:150188556-150188578 TCCTTGGATTCAGGAGCCCTTGG + Intergenic
999302571 5:150500342-150500364 GGCTGGTAGGGAGGAGCCTTGGG + Intronic
999748537 5:154609763-154609785 GCCCGAAATGGAGGAGCCTTGGG + Intergenic
1000120672 5:158194845-158194867 GCCTGGAATGGAGGGGGCGTGGG + Intergenic
1000918937 5:167116064-167116086 GCCTGGGACAGAAAAGCCCTAGG + Intergenic
1001036947 5:168303804-168303826 CCCTGGGGTGAAGGAGCCCAGGG - Intronic
1001306853 5:170581121-170581143 GCCTGGGATGCAAAAGCCATAGG + Intronic
1001316027 5:170641823-170641845 GCATGGGATGGAGGAGTGCAGGG + Intronic
1001713853 5:173798705-173798727 GCCTGGGCTGGGGCAGCTCTCGG - Intergenic
1001743268 5:174070885-174070907 GCCTGGCATGGAGCAGGCTTTGG + Intronic
1002175346 5:177398306-177398328 GCCTGGAATGGGGAAGGCCTGGG + Exonic
1002319235 5:178365294-178365316 GCATGGGGTAGAGGAACCCTAGG + Intronic
1003183786 6:3813372-3813394 CCCTGGGGTGGAGGAGCTCGGGG + Intergenic
1003852815 6:10242345-10242367 ACCTGGGATGCAGGAGCCCTTGG - Intergenic
1004177804 6:13355265-13355287 CCCTGGGAAGGAGGGACCCTAGG - Intergenic
1004413458 6:15402921-15402943 GCCTGGGATAGAGTAGTCATGGG + Intronic
1006096272 6:31658694-31658716 TCCTGGGGTGGAGGAGACCAGGG - Exonic
1006410405 6:33870371-33870393 GCCTGGGTTGGAGGGACCCCTGG + Intergenic
1006419567 6:33924788-33924810 GACTGGGTTGGAGGGCCCCTGGG - Intergenic
1006439280 6:34043151-34043173 GCCTGGGATGGAGCAGGGGTGGG - Intronic
1006603624 6:35241847-35241869 GCTCGGGCTGGAGCAGCCCTGGG - Exonic
1006915935 6:37593992-37594014 GGGTGGGATGGGGCAGCCCTGGG + Intergenic
1007077122 6:39075052-39075074 GCCTGGGAGTCAGGAGGCCTGGG - Intronic
1007283725 6:40731942-40731964 GCCTGGGAGGGAGAGGGCCTGGG - Intergenic
1011194950 6:84771962-84771984 GCCTGGCCAGGGGGAGCCCTGGG - Intergenic
1012436009 6:99215946-99215968 GGGTGGGACGGAGGAGCCCAGGG - Intergenic
1013369622 6:109457384-109457406 CCCTGGGGTGGTGGAGCCCAGGG - Intergenic
1017111375 6:150936277-150936299 GCATGGCAGGGAGAAGCCCTGGG + Intronic
1018390079 6:163335479-163335501 TCCTGGGAGGCAGGAGCCCCTGG - Intergenic
1018472898 6:164112237-164112259 GCCTGGGATGGTGGGGGCTTTGG + Intergenic
1018854534 6:167666214-167666236 GACTGGGATGGAGGAGCCTCAGG + Intergenic
1018911254 6:168101765-168101787 GGCTGGGATGCTGCAGCCCTGGG - Intergenic
1018919328 6:168160650-168160672 GCCTGGGACAGAGGAGCTTTCGG + Intergenic
1018962682 6:168459553-168459575 CCCTGGGGTGGGTGAGCCCTGGG + Intronic
1018962688 6:168459569-168459591 CCCTGGGGTGGATGAGCCCTGGG + Intronic
1018962731 6:168459679-168459701 CCCTGGGGTGGGTGAGCCCTGGG + Intronic
1019143422 6:169962203-169962225 GCCCGGGCGGGAGGAGCGCTGGG + Intergenic
1019214669 6:170435457-170435479 GCCTGGCGTGGGGGAGACCTGGG - Intergenic
1019300741 7:302256-302278 GCCTGAGCTGGAGGACCCCATGG + Intergenic
1019324722 7:432495-432517 CCCTGGGTGGGAGGAGCTCTGGG - Intergenic
1019365135 7:629281-629303 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365185 7:629449-629471 CCCTGGGGTGGTGGCGCCCTCGG - Intronic
1019365219 7:629561-629583 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365271 7:629729-629751 CCCTGGGGTGGTGGCGCCCTCGG - Intronic
1019365306 7:629841-629863 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365324 7:629897-629919 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365343 7:629953-629975 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365362 7:630009-630031 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019419597 7:944885-944907 CCCTGGGAGGGAAGAGCCCGGGG + Intronic
1019446084 7:1072050-1072072 GCTCAGGATGGAAGAGCCCTGGG + Intronic
1019558650 7:1645155-1645177 TCCTGGGGTGAGGGAGCCCTGGG - Intergenic
1019828465 7:3302023-3302045 GTCTGGCGTGGAGGAGCCCCTGG - Intronic
1019999207 7:4745290-4745312 TCCTGGGAATGAGGGGCCCTGGG - Intronic
1021616040 7:22504265-22504287 GAGTGGGATAGAGGAGCCCTAGG + Intronic
1021698990 7:23299544-23299566 GCCTGGGCTGGAGGAGCGGGCGG + Exonic
1021767956 7:23968269-23968291 GCCAGGGCTGGAGGAGCTCAAGG + Intergenic
1021924816 7:25524018-25524040 CCCTGGGATGGAAAAGTCCTTGG + Intergenic
1022114369 7:27249457-27249479 GGCCGGGATTGAAGAGCCCTGGG - Intergenic
1022140871 7:27492097-27492119 GCCTGGGATGAAGAACCCTTTGG + Intergenic
1022410524 7:30135633-30135655 GCCTGGCATGGAGCATCCCTGGG + Intronic
1022925833 7:35055468-35055490 GAGTGGGATAGAGGAGCCCTAGG + Intergenic
1025025497 7:55513190-55513212 GCCTGTCCTGGAGGAGCCCAGGG - Intronic
1026015117 7:66666338-66666360 AGCTGGGATGGTGGAGCCCCAGG - Intronic
1026055395 7:66979428-66979450 GGCTGGGATCCAGGAGCCCCAGG - Intergenic
1027268380 7:76506133-76506155 GCCAGGCATGGAGGAGCCCACGG + Intergenic
1028376432 7:90150077-90150099 GAGTGGGATGGAGGAGCCCTAGG - Intergenic
1029410735 7:100408574-100408596 TCCTGGGATGTAGGAGGCATAGG + Exonic
1029496146 7:100896302-100896324 GCCGGGGATGCATGACCCCTTGG - Intronic
1029596392 7:101539713-101539735 GGCTGGGATGGAGGGAACCTGGG + Intronic
1029823839 7:103170161-103170183 GAGTGGGATAGAGGAGCCCTAGG + Intergenic
1030358531 7:108569938-108569960 GGCGGGGAAGGAGGAGCGCTAGG + Exonic
1031340569 7:120595105-120595127 GCTTGGGATGGAAGAGACTTAGG - Intronic
1032174633 7:129612612-129612634 GCCTGGGGTGGTGGTCCCCTGGG + Intronic
1032806791 7:135363066-135363088 GTCTGTGATGGAGCAGCGCTGGG + Exonic
1032854131 7:135820133-135820155 GGCTGGGATGGATGATACCTTGG + Intergenic
1033214498 7:139483627-139483649 GCGCGGGATGGAGGAGTCTTGGG - Exonic
1033661499 7:143406152-143406174 GACTGGGGTGGGGGAGGCCTGGG + Intronic
1034076080 7:148232240-148232262 GCATGGGAGTGAGAAGCCCTGGG - Intronic
1034346577 7:150389058-150389080 GCCTGGAGTGGAGCAGCCCCTGG + Intronic
1034444883 7:151108741-151108763 GCCTGGGATTCTGGAGTCCTGGG + Intronic
1034449330 7:151129030-151129052 GCCTGGGATGGTGGAGGACCAGG + Intronic
1034885884 7:154798581-154798603 TCCTGGGATGGAGCGTCCCTGGG + Intronic
1035167445 7:157000057-157000079 GCCGCGGATGGGGGAGCCCGGGG + Intronic
1035476653 7:159148881-159148903 GCCTGGGGTGGAGGGTGCCTGGG - Intergenic
1035593540 8:836462-836484 GCCTGGCACACAGGAGCCCTCGG - Intergenic
1036133856 8:6140852-6140874 GCCTCGGATACAGGAGGCCTGGG + Intergenic
1036711377 8:11081550-11081572 TCCTGAGATGGAAGAGCCCCAGG - Intronic
1038436288 8:27539051-27539073 GACTGCAATGGAGGAGACCTGGG - Intronic
1038760747 8:30383149-30383171 GGCTGGGATGGAGAATTCCTGGG + Intergenic
1038777837 8:30546906-30546928 GCCTGGGAGGCAGGTGACCTGGG - Intronic
1039060274 8:33567020-33567042 GCCCGGGCTGCAGAAGCCCTCGG + Exonic
1039469447 8:37804182-37804204 GGATGGGAGGCAGGAGCCCTGGG - Intronic
1039610974 8:38919115-38919137 TCCTGGATTGGAGGTGCCCTTGG + Intronic
1039836630 8:41261389-41261411 AAGTGGGATGCAGGAGCCCTGGG + Intergenic
1039892546 8:41695034-41695056 GCCTGGTGTGGACAAGCCCTGGG - Intronic
1040549778 8:48429135-48429157 GGCTGTGCTGGAGGGGCCCTGGG + Intergenic
1041076667 8:54175633-54175655 GCCTGGGCAGGGAGAGCCCTGGG + Intergenic
1041152355 8:54948557-54948579 CCTTGGGATGGAGGAAGCCTAGG - Intergenic
1041995753 8:64055178-64055200 CCCTGGGGTGGAAGAGTCCTTGG + Intergenic
1044265276 8:90174506-90174528 GCCTGTGCAGCAGGAGCCCTGGG - Intergenic
1044713414 8:95078096-95078118 GCCTGGGACAAAGGAGCCCATGG + Intronic
1045172483 8:99686624-99686646 GCCTGGGATGGTGGTGGCCATGG - Intronic
1045703110 8:104889591-104889613 GCCTGGGATGAAGGATGACTAGG + Intronic
1047116728 8:121850725-121850747 GTCTGGGATCCAGGAGTCCTGGG + Intergenic
1047550688 8:125869393-125869415 GCCAGTGATGGAGGCTCCCTGGG + Intergenic
1048206364 8:132418378-132418400 GCGAGGGAGGGAGGAGCTCTGGG + Intronic
1048550310 8:135427607-135427629 GCCTGGGATGGAGGAGATAAAGG + Intergenic
1049102243 8:140588097-140588119 GCCTGGGGAGGAGGTGCCCATGG - Intronic
1049192231 8:141294783-141294805 CCCTGGGAGGGAGGCACCCTGGG + Intronic
1049324327 8:142014252-142014274 GCCTGGACTGAAGGAGCTCTGGG + Intergenic
1049362013 8:142216345-142216367 GGCTGGGAAGGATGAGGCCTGGG + Intronic
1049653943 8:143789594-143789616 GCCTGGGAGCGGGGAGCTCTGGG - Intergenic
1049792441 8:144478205-144478227 GCCCGGGAAGGAGGGGCACTGGG + Intronic
1050206860 9:3205477-3205499 GAGTGGGATGGACAAGCCCTGGG + Intergenic
1051406951 9:16747826-16747848 GCATGGGAAAGAGGAGCTCTGGG + Intronic
1051487980 9:17629119-17629141 GGCTGGGAGGCAGGAGACCTGGG + Intronic
1052754402 9:32525889-32525911 GCCAGAGTTTGAGGAGCCCTCGG - Intronic
1053030989 9:34777676-34777698 GCCTGGGATGTGGTAGCCCATGG + Intergenic
1053488225 9:38478303-38478325 GCCTGGGGAGGAAGAGCCGTGGG + Intergenic
1056090043 9:83196324-83196346 ACCTGGGATGGGGGAGCTGTGGG + Intergenic
1056517838 9:87371844-87371866 TCCTGGGATGAAGAAGCCCCAGG - Intergenic
1057720292 9:97526922-97526944 GCCTGGGACCCAAGAGCCCTAGG - Intronic
1057801063 9:98191982-98192004 TCTGGGGCTGGAGGAGCCCTAGG - Intronic
1059326162 9:113505176-113505198 GCCTGGGATGGACAAGGTCTTGG - Intronic
1059334920 9:113563031-113563053 CCCATGGCTGGAGGAGCCCTGGG - Intronic
1060986032 9:127819531-127819553 GCCTGGGAGGGAGCAGGCCTCGG - Intronic
1061009795 9:127948189-127948211 GCCTGGGATGGAGATGGACTTGG + Exonic
1061356659 9:130110707-130110729 GCCTGTGCTGGAGCTGCCCTCGG + Intronic
1061373943 9:130213139-130213161 GCCTGGGAGGCAGGAGCCCTGGG + Intronic
1061961612 9:133991781-133991803 GCCTGGGATGGGGGAGGCTCCGG - Intronic
1062149070 9:135008099-135008121 GGCTGGGAGGGAGGTGCCTTGGG - Intergenic
1062237938 9:135521653-135521675 TCCTTGGATGGAGGAGGCATGGG - Intronic
1185550873 X:981453-981475 GGCTGGGATGGAGGAGGAATTGG + Intergenic
1186123425 X:6386806-6386828 GCCTGGGATGAAGAAGACATGGG + Intergenic
1186774215 X:12847813-12847835 GCCTGGGGTGGCGGAGTCTTGGG + Intergenic
1186911628 X:14173960-14173982 GCCTGTGATGGTGCAGCCATGGG - Intergenic
1188484740 X:30670565-30670587 GCCTGGTATGGAGGAGCTTGTGG - Intronic
1189240371 X:39519974-39519996 GCCTGGGAGCCAGGAGACCTGGG + Intergenic
1190693877 X:52935217-52935239 GCCTAGGATTGACGAGCTCTGGG + Intronic
1190797893 X:53760898-53760920 GACTGGGAGGAAGGAGCCGTAGG - Intergenic
1190915402 X:54808302-54808324 GGCTGGGACGGAGGCCCCCTAGG + Intronic
1190917265 X:54820312-54820334 GACTGGGAGGAAGGAGCCGTAGG + Intergenic
1194584751 X:95718623-95718645 GCCAGGAATGAAGCAGCCCTTGG - Intergenic
1197353144 X:125401822-125401844 GTCAGGGATGGAGCAGCCCTTGG + Intergenic
1197754382 X:129983968-129983990 ACCCGGGGTGGGGGAGCCCTGGG - Intronic
1199530022 X:148835933-148835955 GCTTGGGATGGGGGAGCTGTTGG - Intronic
1199847168 X:151699932-151699954 GCCTGGTTTGAAGGAGCCCCTGG + Intronic
1201274855 Y:12287415-12287437 GGCTGGGAGGGGGGAACCCTTGG + Intergenic
1201605145 Y:15775839-15775861 GCCTGGGATGAAGAAGACATAGG + Intergenic
1201692577 Y:16783893-16783915 GCCTTGGTTGGAGGATCACTTGG + Intergenic
1202378955 Y:24260166-24260188 GCCTAGGACGGAGCAGACCTAGG + Intergenic
1202491827 Y:25409955-25409977 GCCTAGGACGGAGCAGACCTAGG - Intergenic