ID: 914675416

View in Genome Browser
Species Human (GRCh38)
Location 1:149904204-149904226
Sequence CTGTGTTGAGCCTGGGATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 386}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675416_914675429 12 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675429 1:149904239-149904261 GGGAGGAACTGTGGGAGGCAGGG 0: 1
1: 0
2: 14
3: 124
4: 1798
914675416_914675420 -10 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675416_914675428 11 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848
914675416_914675427 7 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675416_914675426 4 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675416_914675421 -9 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
914675416_914675425 3 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675416_914675423 -5 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675423 1:149904222-149904244 CACAGAAACCAGATTAGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 197
914675416_914675422 -8 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675416 Original CRISPR CTGTGTTGAGCCTGGGATGG AGG (reversed) Exonic
900662227 1:3790532-3790554 CTGTGGTGAGCCGAGGATGGGGG - Intronic
900711160 1:4115246-4115268 CTGTGTTGAGTCTAGACTGGGGG + Intergenic
900735790 1:4298669-4298691 CTGTGCAGGACCTGGGATGGTGG + Intergenic
901486501 1:9566557-9566579 CTGTGTTGGGCCGGGTGTGGTGG + Intronic
901642029 1:10697510-10697532 ATGTGGGGAGCCTGGGTTGGGGG - Intronic
902679436 1:18032661-18032683 CTGTGTTGAGGTCGGGCTGGAGG + Intergenic
902792825 1:18780732-18780754 CTGAGCTGGGGCTGGGATGGAGG + Intergenic
903052323 1:20610950-20610972 CTGTGTTCTGCCAGGCATGGTGG + Intronic
903470784 1:23585942-23585964 GTGCTTTGAGCCAGGGATGGTGG - Intronic
903861692 1:26368319-26368341 CTATGATGTGCCTGGGATAGGGG + Intronic
904486139 1:30825504-30825526 CTGTGTGGAGGATGGGCTGGAGG + Intergenic
904492403 1:30869248-30869270 CTGCGGTGAGGCTGGGATGGGGG - Intergenic
904800855 1:33092255-33092277 CTGTGGGGAGCCTGGGCTGTGGG + Intronic
904800861 1:33092271-33092293 CTGTGGGGAGCCTGGGCTGTGGG + Intronic
905342394 1:37288195-37288217 CTGTGCTGCCTCTGGGATGGGGG - Intergenic
905391700 1:37639854-37639876 CTGTGTGAAGCCTGTGTTGGTGG - Intergenic
905613232 1:39373563-39373585 CAGTGTTGGGCCAGGCATGGTGG + Intronic
905620074 1:39437597-39437619 CTGTTTTGGGCCAGGGGTGGTGG - Intronic
905827433 1:41036581-41036603 CTGTGTTGAGCATGGATTTGAGG - Intronic
907277125 1:53322933-53322955 CTTTATTAAACCTGGGATGGAGG + Intronic
907277349 1:53324184-53324206 CTTTATTAAACCTGGGATGGAGG - Intronic
907552592 1:55316829-55316851 CTGAGTTGGGGCTTGGATGGGGG + Intergenic
907926179 1:58957005-58957027 CTCAGTTGAGCCTTGAATGGAGG + Intergenic
907949125 1:59164011-59164033 CTGTGGTGTGCCTGGGATGCTGG - Intergenic
908927902 1:69278915-69278937 CTGAGTTGAAACTGGGAGGGAGG - Intergenic
911202686 1:95061581-95061603 CTGTGTTGGTCCTGGATTGGTGG - Intronic
912068429 1:105777446-105777468 CTGTGTTGGGCCGGGCACGGTGG - Intergenic
912769358 1:112448930-112448952 CTGTGTTGGGCCTGGGAAAGAGG - Exonic
912902925 1:113672040-113672062 TTATGCTGTGCCTGGGATGGAGG - Intronic
913240468 1:116825658-116825680 CTGTTTTTAGCCTGGGCTGGTGG - Intergenic
914418823 1:147509672-147509694 CTGTGTTGGGCTGAGGATGGGGG - Intergenic
914675416 1:149904204-149904226 CTGTGTTGAGCCTGGGATGGAGG - Exonic
914744599 1:150492522-150492544 CTATTTTGAGCCGGGCATGGTGG + Intronic
915360795 1:155285318-155285340 CTGGGTTGGGCCTGGAAGGGGGG + Intronic
915553562 1:156648666-156648688 CTGTATGCAGCCTGGGATGGTGG + Exonic
915597404 1:156903459-156903481 CTGGGTAGGGCCTGGGCTGGGGG + Intronic
917037867 1:170769020-170769042 CTGGGTAGAGACTGAGATGGAGG + Intergenic
917938996 1:179898014-179898036 ATGGCTTGAGCCTGGGAGGGAGG + Intronic
919851702 1:201677296-201677318 CTGGGGTGAGCCTGGGGTTGGGG - Intronic
920032589 1:203046173-203046195 CTCTGCTGAGGCTGGGGTGGGGG + Intronic
920217226 1:204369515-204369537 CTGTGATGTGCCTGGGAAAGAGG + Intronic
920641348 1:207754388-207754410 ATGTGTTCAACCTGAGATGGGGG - Intronic
923981518 1:239328915-239328937 CTGTGTGGTGCCTGGGAAGGTGG + Intergenic
924113280 1:240721524-240721546 CTCTGTGGAGACTGGGTTGGAGG + Intergenic
924814683 1:247431390-247431412 GTGTGTTGAGCCGGAGAGGGAGG - Intronic
1062868436 10:877136-877158 ATGTGATGGGCCTGTGATGGGGG + Intronic
1062878972 10:963165-963187 CTGTGGTGATCCTGGGGTGGGGG - Intergenic
1063449869 10:6144295-6144317 ATGGGTTGAGCCTGGGGAGGTGG + Intergenic
1063716337 10:8530558-8530580 CTATCTTGAGCCTGACATGGTGG - Intergenic
1063879143 10:10512888-10512910 TTCTTTTAAGCCTGGGATGGTGG - Intergenic
1064298984 10:14104870-14104892 CTGAGTTGAGTGTGGTATGGGGG + Intronic
1064993668 10:21278151-21278173 CTGATTTGAGCCGGGCATGGTGG + Intergenic
1065427420 10:25619790-25619812 CTGAGGTCAGCCTGGGATGCTGG + Intergenic
1066527623 10:36298101-36298123 CTGTGGTGAGCCTGGTGTTGGGG + Intergenic
1068520195 10:58069088-58069110 CTCTGTCAAGCCTGAGATGGTGG + Intergenic
1070394834 10:76003032-76003054 GAGTTTTGTGCCTGGGATGGAGG + Intronic
1071157489 10:82707719-82707741 ATGTTTTGAGCCAGGCATGGTGG + Intronic
1072948058 10:99828306-99828328 CTGTGTTGGCCCTGGGATCTGGG + Intronic
1073302463 10:102479451-102479473 CTGTGTGAAGTCTGGGATTGGGG + Exonic
1074718969 10:116248324-116248346 TTGCATTGAGCCTGGCATGGTGG - Intronic
1074986452 10:118664136-118664158 CTGTCCTGAGCATGGGGTGGGGG + Intergenic
1075341292 10:121648604-121648626 GTGTGGTGGGCCTGGGATGCTGG - Intergenic
1075852388 10:125599917-125599939 CAGGGCTGAGCCTGGGATTGGGG - Intronic
1076039457 10:127231570-127231592 ATGTGTTTAGCCAGGCATGGTGG - Intronic
1076483595 10:130801363-130801385 CTGTCTTGAGGCTTGGATGCAGG - Intergenic
1076681503 10:132174166-132174188 CTGTGTTGGGGCTGGGTTGGTGG - Intronic
1077111510 11:864157-864179 CTGGGTTGCCCCAGGGATGGGGG + Intronic
1077190771 11:1255218-1255240 CTGTGGTGGGCATGGGGTGGGGG - Exonic
1077220578 11:1413734-1413756 CTGAGCTGAGCCTGGGGTGGTGG + Intronic
1077228762 11:1449521-1449543 CTGTGCTGTGCCTGGGCTGCTGG + Intronic
1078697757 11:13651635-13651657 CTGAGATCAACCTGGGATGGTGG + Intergenic
1079116950 11:17646047-17646069 ACGTGTTGAGCATGGAATGGTGG + Intronic
1079644191 11:22843176-22843198 CTTTGTTGGGCCAGGCATGGTGG + Intergenic
1079869703 11:25781576-25781598 GTGTGATCAGCCTGGGGTGGGGG - Intergenic
1080584069 11:33665908-33665930 CAGTCTTGTGCCTGGGAGGGTGG + Intronic
1080804959 11:35644308-35644330 CTGGGCTGAGCCTGGCATGGTGG + Intergenic
1081965906 11:47169568-47169590 CTGAGTTGGGCCGGGCATGGTGG + Intronic
1082805739 11:57448827-57448849 GTGTGTGGGGCCTGGCATGGTGG - Intergenic
1084000512 11:66293130-66293152 CTGTGATGAGCATGTGTTGGAGG + Intronic
1084516192 11:69639155-69639177 CTGTCTTGCGCCCGGGATGGGGG + Intergenic
1084573016 11:69970827-69970849 CCGTGCTGAGCATGGGAGGGCGG - Intergenic
1084605220 11:70168319-70168341 CTGAGTAGAGCCTGGGAGGCAGG - Intronic
1084678566 11:70651459-70651481 CTGTGGGGAGCCCTGGATGGCGG - Intronic
1084778281 11:71391733-71391755 ATGTGTTGAGCCTGAGTTTGTGG + Intergenic
1085012467 11:73150735-73150757 CTGTGCTGAGCCTGTGACCGGGG + Intergenic
1086295961 11:85368888-85368910 CTGTGTGGAGCCTGGGATTCAGG + Intronic
1087270061 11:96101987-96102009 CTGTTTTCAGCCAGGCATGGTGG + Intronic
1087514644 11:99142605-99142627 CTGTCTTGTCCATGGGATGGGGG - Intronic
1087881398 11:103419769-103419791 CTGGGCTGAGGCTGAGATGGCGG + Intronic
1089497783 11:118916443-118916465 CTGGGGTGAGAGTGGGATGGTGG - Intronic
1089675789 11:120088223-120088245 CAGTGTTGACCCTGGGATCCTGG + Intergenic
1089806815 11:121097889-121097911 CTGTGTGAAGCCAGGGATGTTGG - Intergenic
1090183715 11:124722353-124722375 CTGTCCTGAGGCTGGGATGCGGG - Intergenic
1090294635 11:125576283-125576305 CAGTGTTGTGCTTGGAATGGTGG + Exonic
1091431924 12:443383-443405 CTGTGATCAGCCAGGTATGGTGG + Intergenic
1091723932 12:2832979-2833001 CTGTGTTCATCGTGGGAAGGTGG - Intronic
1094638210 12:32247489-32247511 CTCTGTTGGGCCGGGCATGGTGG + Intronic
1095486392 12:42689068-42689090 TTGTGTTAAGCCAGGCATGGTGG - Intergenic
1095565722 12:43621362-43621384 CTGTGATAAGCAAGGGATGGTGG + Intergenic
1097148070 12:56955195-56955217 CTGTGTTGTGCCTGTGCAGGTGG + Intronic
1099156213 12:79179705-79179727 CTGTTTTCAGCCAGGCATGGTGG - Intronic
1099961344 12:89400113-89400135 CTGGGTTGGGCCTGGGAAGGAGG + Intergenic
1100549958 12:95638217-95638239 CTGTGAGGAGTCTGGGAGGGTGG + Intergenic
1101628608 12:106471196-106471218 CTGAGATCAACCTGGGATGGTGG - Intronic
1102090555 12:110183838-110183860 GGGTGCTGAGTCTGGGATGGGGG - Intronic
1102582386 12:113898189-113898211 GTGTGTTGAGGGTGGGGTGGGGG + Intronic
1103131642 12:118474161-118474183 CTGTGTGGAGAGTGGGTTGGAGG - Intergenic
1103615193 12:122147461-122147483 GTGTGATAAGCCTGGGATGGAGG + Intergenic
1104182699 12:126398123-126398145 ATGGGGTGAGGCTGGGATGGTGG + Intergenic
1104761733 12:131300870-131300892 CTCTTTAAAGCCTGGGATGGAGG - Intergenic
1104818039 12:131659914-131659936 CTCTTTAAAGCCTGGGATGGAGG + Intergenic
1105448744 13:20479861-20479883 CAGTGTTGAGACAGGGATGCTGG + Intronic
1105577469 13:21667662-21667684 CTGTAAGGAGCATGGGATGGAGG - Intergenic
1105797884 13:23874410-23874432 CAGTGTTTACACTGGGATGGAGG - Intronic
1105815622 13:24033668-24033690 CTGTGCTTAGCATGAGATGGGGG - Intronic
1105963465 13:25364183-25364205 CAGTTTTGGGCCTGGCATGGTGG + Intergenic
1106170491 13:27284183-27284205 ATGTGGGGAGCTTGGGATGGAGG + Intergenic
1106184166 13:27394251-27394273 CTGATTTGAGGCTGGCATGGTGG + Intergenic
1106258644 13:28044511-28044533 CTATGTTGAGATGGGGATGGAGG - Intronic
1109215731 13:59587649-59587671 GAGTGATGAGCTTGGGATGGAGG - Intergenic
1110893703 13:80722560-80722582 ATGTGTTGAGCATGTGATGTGGG - Intergenic
1111658879 13:91184539-91184561 CTGTGTTGTGGCAGGGATGGAGG + Intergenic
1112449417 13:99495458-99495480 CTGTGTGGGGCATGGGGTGGGGG - Intergenic
1119264437 14:73255650-73255672 TTGTGGTGAGCTGGGGATGGGGG + Intronic
1119648354 14:76365185-76365207 CTGTGCTAAGGCTGGCATGGTGG + Intronic
1120185776 14:81392315-81392337 CTGTGTGGAACCTGGGATTTGGG + Intronic
1120571578 14:86124314-86124336 CTGTGTTGAGCATGGGAAGTAGG + Intergenic
1120791786 14:88590724-88590746 CTCTGTTGAGACGGGGAAGGAGG - Intronic
1121050691 14:90817035-90817057 CTGTGCCTTGCCTGGGATGGAGG - Intergenic
1122113034 14:99514882-99514904 CTCTGTCCTGCCTGGGATGGAGG - Exonic
1122327289 14:100890432-100890454 CAGAGTTGAGCCTGGGGCGGGGG + Intergenic
1122404499 14:101492047-101492069 ATGTGTTGAGCCAGGCGTGGTGG - Intergenic
1124252333 15:28115072-28115094 CTGTGTTGTGCCTCGGCTGCAGG - Intronic
1126784419 15:52164845-52164867 CTGGGTTGAGGCTGAGATAGAGG + Intronic
1127136131 15:55925777-55925799 GTGTGATGAGCCTGGGAACGTGG - Intronic
1128697788 15:69781420-69781442 CTGCGCTGAGCCTGGGAAGAAGG - Intergenic
1129156822 15:73723299-73723321 GTGTGCTGAGCATGGGGTGGAGG + Intergenic
1129300985 15:74625371-74625393 CTGTGCTGAGCCTGGGCAGATGG + Intronic
1129384685 15:75189430-75189452 CTGGGCAGAGCTTGGGATGGGGG + Intergenic
1132394179 15:101460030-101460052 CAGTGTGGGGCCTGGGATAGTGG - Intronic
1132513876 16:357106-357128 CTCTGTCGGGCTTGGGATGGGGG - Intergenic
1132743497 16:1427426-1427448 CTGTGTCCTGCCTGGGGTGGGGG - Intergenic
1132871386 16:2117191-2117213 CTGCTGTGAGCCTGGGCTGGTGG - Intronic
1133345474 16:5067075-5067097 ATGTGCTTAGCCTGGCATGGTGG - Intronic
1134073264 16:11273565-11273587 CTGTGTTGAGCTTGGCACAGCGG + Exonic
1134220336 16:12348597-12348619 GGGTGCTGAGCCAGGGATGGAGG - Intronic
1134521142 16:14919703-14919725 CTGCTGTGAGCCTGGGCTGGTGG + Intronic
1134550428 16:15136269-15136291 CTGCTGTGAGCCTGGGGTGGTGG - Intronic
1134708818 16:16318354-16318376 CTGCTGTGAGCCTGGGCTGGTGG + Intergenic
1134716029 16:16358388-16358410 CTGCTGTGAGCCTGGGCTGGTGG + Intergenic
1134748510 16:16606811-16606833 CCATGTCTAGCCTGGGATGGTGG - Intergenic
1134950787 16:18350291-18350313 CTGCTGTGAGCCTGGGCTGGTGG - Intergenic
1134958727 16:18393771-18393793 CTGCTGTGAGCCTGGGCTGGTGG - Intergenic
1134996955 16:18746805-18746827 CCATGTGTAGCCTGGGATGGTGG + Intergenic
1135403693 16:22183421-22183443 ATGTGTTGAGGCTCGGAAGGAGG + Intronic
1135605028 16:23816611-23816633 ATATGTTCAGCCTGGCATGGTGG - Intergenic
1136069750 16:27780781-27780803 ATGTGTGGATCCTGGAATGGTGG + Intergenic
1136609806 16:31359449-31359471 CTGTGATGAGCCAGGCGTGGTGG - Intronic
1136669169 16:31840035-31840057 GTGTCTGGAGCCTGGGATTGTGG - Intergenic
1137004254 16:35258303-35258325 CTGGGTTGAGCCAGAAATGGCGG - Intergenic
1137010586 16:35316365-35316387 CTGTGATGTCCCTGTGATGGGGG + Intergenic
1138445349 16:57059746-57059768 CTGAGTTGGGCTTAGGATGGTGG - Intronic
1138818147 16:60226522-60226544 CTGAATTGAGCCGGGCATGGTGG - Intergenic
1139434551 16:66928503-66928525 CTGTGTTGAGCTGGGGATGAAGG - Intergenic
1139525967 16:67516906-67516928 CTCTGTGGGGCCAGGGATGGTGG - Intergenic
1142010899 16:87713564-87713586 CTGTGTGGAGCATGGGCGGGGGG - Intronic
1142113621 16:88345084-88345106 GTGACGTGAGCCTGGGATGGGGG + Intergenic
1142160285 16:88554025-88554047 CTGACTTGAGCCTGGGGTAGGGG + Intergenic
1142667284 17:1470324-1470346 CTCGGATGAGCCTGGGGTGGGGG + Exonic
1143374225 17:6457896-6457918 CTGGGTTGGGCCTGGGGTGCAGG - Intronic
1143671221 17:8397435-8397457 CTGTGCTGAGGTGGGGATGGGGG - Intronic
1143706168 17:8699008-8699030 CCGAGCTGAGCCTTGGATGGGGG - Intergenic
1144183975 17:12778712-12778734 ATCACTTGAGCCTGGGATGGTGG - Intergenic
1144632586 17:16881652-16881674 CTGTGTGCAGCTTGGGGTGGGGG + Intergenic
1144711869 17:17406453-17406475 CTGTGCTGAGGCTGGGCTGGAGG + Intergenic
1145208616 17:20997387-20997409 CTGTGTGCAGCCTGGGGTGGGGG - Intergenic
1145260054 17:21349215-21349237 CTGCCTCCAGCCTGGGATGGCGG + Intergenic
1145316564 17:21738723-21738745 CTGCCTCCAGCCTGGGATGGCGG - Intergenic
1146257260 17:31398815-31398837 CTGTGTGCTGCCTGGGCTGGTGG + Intronic
1146874398 17:36396852-36396874 TTGTGTTGGGCCGGGAATGGTGG + Intronic
1146881755 17:36447771-36447793 TTGTGTTGGGCCGGGAATGGTGG + Intergenic
1147064988 17:37916019-37916041 TTGTGTTGGGCCGGGAATGGTGG - Intergenic
1147554004 17:41464759-41464781 CTGTGTTCATCCTGGGAGGAGGG + Intronic
1147874944 17:43614416-43614438 CCCTGGAGAGCCTGGGATGGAGG - Intergenic
1148052901 17:44777868-44777890 CTGCCTGGAGCCTGGGATGGCGG + Intronic
1148538303 17:48458938-48458960 ATGTTTTGAGCCGGGCATGGTGG - Intergenic
1148593889 17:48837355-48837377 CTCTTTTGAGCCGGGCATGGTGG + Intronic
1148613641 17:48982410-48982432 CTGAGTTGAGCCAGGTGTGGTGG - Intergenic
1148635569 17:49146596-49146618 CAGTGTTGGGCCAGGCATGGTGG - Intronic
1148810827 17:50290029-50290051 CTGTGTCTAGGCTGGGGTGGGGG - Intergenic
1149749793 17:59134918-59134940 ATCTGTTGAGCCTGGGAGGTTGG - Intronic
1149988665 17:61368004-61368026 TTGGGTTGAACCTGGGAAGGGGG + Intronic
1150135410 17:62692587-62692609 CTGGGCAGAGCCTGGGCTGGTGG + Exonic
1150191156 17:63240770-63240792 TTGAGTTCAGCCTGGGAAGGTGG - Intronic
1150421993 17:65045230-65045252 CTGTGTTCAGCCAGGCATGGCGG + Intronic
1150434149 17:65141084-65141106 CTGCATTGAGACTGAGATGGAGG - Intronic
1150640327 17:66945361-66945383 CTGTGTGGGGGGTGGGATGGGGG + Intergenic
1151530076 17:74698504-74698526 AGGTGGTGAGCCTGGGATGCAGG - Intronic
1151942358 17:77300752-77300774 GCGCTTTGAGCCTGGGATGGGGG - Intronic
1151942378 17:77300817-77300839 GCGCTTTGAGCCTGGGATGGGGG - Intronic
1151942419 17:77300947-77300969 ATGCTTTGAGCCTGGGGTGGGGG - Intronic
1152494515 17:80661481-80661503 CGGTGTTGAGCCGTTGATGGGGG + Intronic
1152961173 18:81398-81420 GTGTGTTGTGCATGGGATGGAGG - Intergenic
1154405893 18:14090692-14090714 CTGTGTCCAGCATGTGATGGGGG - Intronic
1157086580 18:44586514-44586536 CAGTGTAGAGCCAGGCATGGTGG + Intergenic
1157518020 18:48324778-48324800 CTGGGTTGGGCTGGGGATGGTGG + Intronic
1157617156 18:48993818-48993840 CTGTGCTGAGCCTTGGAGGAGGG - Intergenic
1158859981 18:61582350-61582372 CTATTTTAAGCCTGGGGTGGGGG - Intergenic
1160583692 18:79901335-79901357 TTGTGCTGAGACTGGGGTGGGGG + Intergenic
1160702945 19:517375-517397 CTGGGTGGAGGCTGGGAGGGGGG + Intronic
1161768991 19:6221335-6221357 CTGTTTGGGGCCTGGGACGGCGG - Intronic
1162550625 19:11356436-11356458 CTCTGTTTGGCCTGGGGTGGGGG + Intronic
1162890332 19:13728172-13728194 CAGGGTTGATGCTGGGATGGAGG + Intergenic
1163666135 19:18604958-18604980 CCGTGGGGACCCTGGGATGGAGG - Intronic
1164011487 19:21206569-21206591 CTGTGGTGTGCCTTGGATGCTGG + Intergenic
1164715003 19:30384737-30384759 ATGTGTTCAGCCAGGCATGGTGG + Intronic
1166019544 19:40013584-40013606 CTGTGTTGGGGCAGGGATGGGGG - Intronic
1166089762 19:40501083-40501105 TTGAGTTGAGCCAGGCATGGTGG + Intronic
1166549326 19:43654763-43654785 CTGGGTTGAGCCTTGGCTGTAGG + Intronic
1167101094 19:47404731-47404753 GGGTGTTGGACCTGGGATGGGGG - Intronic
1167166389 19:47802687-47802709 CTGGGCTGGGCCTGGGATTGGGG + Exonic
1167175472 19:47861118-47861140 CTGGGCTGGGCCTGGGATAGGGG - Intergenic
1167658603 19:50782575-50782597 CTGTGTTGAGCGCAGGATGGGGG - Intergenic
1168089682 19:54074393-54074415 CTGTGTAAGGCCTGGCATGGTGG + Intronic
1168126128 19:54284201-54284223 CTGTGTTATGCCCGGCATGGCGG - Intergenic
1168171162 19:54590583-54590605 CTGTGTTATGCCTGGCATGGTGG + Intronic
1168180062 19:54656177-54656199 CTGTCTTTAGCCTGGCGTGGTGG - Intronic
1168255254 19:55161408-55161430 ATGACTTGAGCCTGGGGTGGGGG + Exonic
1168695053 19:58399474-58399496 GTGTGTTTAGCCAGGCATGGTGG - Intergenic
925609649 2:5692556-5692578 CTGTGTGCAGCCTGGAAGGGGGG + Intergenic
925851041 2:8082479-8082501 ATATGTTGTGCCTGGGTTGGGGG - Intergenic
926004488 2:9362549-9362571 CTCTCTTGAGCCTGGTGTGGTGG + Intronic
926059853 2:9798410-9798432 CTGTGTTGAGCCTGGCACCCAGG - Intergenic
926386455 2:12340130-12340152 CTGTGGTGGGCCTGGGATAGGGG + Intergenic
926590572 2:14735819-14735841 CTGTGCTGACGCTGGGAAGGTGG - Intergenic
927917733 2:26947524-26947546 CTGTGTAGGGGCAGGGATGGGGG + Exonic
928475543 2:31623446-31623468 CTGGGCTGAGGCTGAGATGGTGG - Intergenic
930711797 2:54557238-54557260 CTGAGGTGAACCTGGGGTGGGGG + Intronic
931355734 2:61537096-61537118 CGGTGGAGAGCTTGGGATGGGGG - Intronic
931485653 2:62688754-62688776 CTGTGATTAGCCTGGGTAGGAGG - Intronic
931639694 2:64370902-64370924 CTGTGTCTTGACTGGGATGGTGG - Intergenic
932263060 2:70343164-70343186 CTGTTTTGAGTCTGGGAAGAGGG + Intergenic
932462740 2:71893843-71893865 CTGTGTTCCGCCAGGGAGGGAGG + Intergenic
933900461 2:86846117-86846139 CTGTGCAGAGCTTGGGGTGGGGG + Intronic
935024105 2:99259992-99260014 CTGTTGTCAGCCTGGGCTGGAGG + Intronic
935246356 2:101221784-101221806 ATGTGTTCAGCCAGGCATGGTGG - Intronic
935780085 2:106503108-106503130 CTGTGCAGAGCTTGGGGTGGGGG - Intergenic
936261983 2:110967796-110967818 CTCTGTTGAGCCACGGATGTGGG + Intronic
937392611 2:121503941-121503963 CTTTCTTGAGCCGGGCATGGTGG + Intronic
938101344 2:128499947-128499969 CTGTGTTATGGCTGGGGTGGCGG + Intergenic
941130849 2:161649273-161649295 ATGTCTTGAGCCTGGGAGGCAGG + Intronic
941278190 2:163517176-163517198 CTCTGTTGAGCCAGCAATGGAGG + Intergenic
942123915 2:172804544-172804566 CAGTGGTGAGCCTGGGAACGGGG + Intronic
942190809 2:173468151-173468173 CTGTGTGGATCCTAGCATGGAGG + Intergenic
942327801 2:174790415-174790437 CCGTGTTCAGCATGGTATGGTGG - Intergenic
942453042 2:176120527-176120549 CTGTCTTGCGCTTGGGATGGGGG - Intergenic
944999306 2:205331492-205331514 CTGTGTTGGGCCGGGCGTGGTGG + Intronic
945286878 2:208091520-208091542 CTGTTTTAAGCCTGGCATGGTGG - Intergenic
946186939 2:217986376-217986398 CTCTGGTGAGCCTGGAATGGGGG - Intronic
946300075 2:218817648-218817670 CTGTGATGAGACTTGGATTGGGG + Intergenic
946760891 2:222992174-222992196 CTTTGGTGAGAATGGGATGGAGG + Intergenic
948487614 2:238290873-238290895 CTCTGTTGGAGCTGGGATGGAGG - Intergenic
948631470 2:239305519-239305541 CTCTGTCAGGCCTGGGATGGAGG + Intronic
948778007 2:240299822-240299844 CTGGCTTTAGGCTGGGATGGAGG - Intergenic
948869711 2:240791915-240791937 CAGTGCAGGGCCTGGGATGGGGG - Intronic
1169134480 20:3188997-3189019 CTGTCCTGAGCATGGGATGCTGG + Intergenic
1169728029 20:8757142-8757164 CTGTGGAGAGCCTGGGAGGGTGG - Exonic
1170351529 20:15447185-15447207 TTGTGGTGAGCATGGGAAGGTGG + Intronic
1171396081 20:24834190-24834212 GTGTGTTGAGTCTGCAATGGTGG + Intergenic
1171962626 20:31505698-31505720 CTTTGTTGAGTTGGGGATGGAGG - Intergenic
1172182037 20:33009567-33009589 CTGTGTTTACCCAGGGGTGGGGG - Intronic
1172519229 20:35556538-35556560 CTGTGGTCTGCCTGGGCTGGGGG + Intronic
1173105189 20:40127143-40127165 CTGTGTTGAGCCTTTGATCAGGG - Intergenic
1174448236 20:50604594-50604616 CTGTGGTCACCCTGGGATGGGGG - Intronic
1174815646 20:53684726-53684748 ATGTCTTGAGCCTGGGAAGCGGG - Intergenic
1175221628 20:57420699-57420721 CCGTGTTGAGTGTGGGCTGGTGG + Intergenic
1175758842 20:61547563-61547585 CACTGTTGACCCTGGGGTGGGGG + Intronic
1176724289 21:10417234-10417256 CTGTGTTGAGACTAGAATGAAGG + Intergenic
1177598882 21:23284779-23284801 CTTTATTCAGCCTGGCATGGTGG - Intergenic
1178360733 21:31947046-31947068 CTGGCTTGAGCCTGGGATGTGGG - Intronic
1178360755 21:31947160-31947182 CTGGCTTGAGCCTGGGATGTGGG - Intronic
1178360762 21:31947198-31947220 CTGGCTTGAGACTGGGATGTGGG - Intronic
1178360769 21:31947236-31947258 CTGGCTTGAGACTGGGATGTGGG - Intronic
1178360778 21:31947274-31947296 CTGGCTTGAGCCCGGGATGTGGG - Intronic
1178360793 21:31947350-31947372 CTGGCTTGAGACTGGGATGTGGG - Intronic
1178408216 21:32342740-32342762 ATGTGATGAGCCAGGCATGGTGG - Intronic
1178816454 21:35934557-35934579 CTGAGTTCAGTCTGGGAAGGTGG - Intronic
1180737323 22:18027072-18027094 CTGGGTTAAGCCAGGGATGCCGG + Intergenic
1181645407 22:24228735-24228757 CTGTTTCGGGCCTGGCATGGTGG - Intronic
1183097737 22:35563460-35563482 CTGAGCTGAGCCTGGGCTGCGGG + Intergenic
1183315277 22:37133644-37133666 CTGTGTGGAGCGTGGCCTGGTGG - Intronic
1183734252 22:39635300-39635322 CTTTGTTGAGCCTGTGCTCGGGG + Intronic
1183793348 22:40092802-40092824 CTGTTTTTAGCCAGGCATGGCGG - Intronic
1184114247 22:42413011-42413033 CTGTTTGGATCCTGGGCTGGGGG + Intronic
1184511961 22:44939197-44939219 CTGTGATGAGCCAGGGACTGCGG + Intronic
1184852692 22:47129798-47129820 GTGTGAGGAGGCTGGGATGGAGG - Intronic
949535586 3:4993623-4993645 CTGTGAGGGTCCTGGGATGGGGG + Intergenic
950034925 3:9878501-9878523 CTGCGTTGGACCTGGGAAGGAGG + Exonic
950289643 3:11773242-11773264 CTGGGTTTGGCCAGGGATGGTGG - Intergenic
951222735 3:20085981-20086003 CTGTTTTGAGCTGGGCATGGTGG + Intronic
952052990 3:29408806-29408828 CTGTGATGAGCCTGAGCTAGAGG + Intronic
952899732 3:38102118-38102140 ATGGGTTGGGGCTGGGATGGAGG - Intronic
953029856 3:39172089-39172111 CTGGGTTGGGGCAGGGATGGAGG + Intergenic
954401366 3:50321403-50321425 CTGGGCTGGGCCCGGGATGGCGG - Exonic
955369809 3:58341272-58341294 GTGTTTTGAGCCAGGCATGGTGG + Intronic
955942470 3:64159321-64159343 CTGGGATGATCCTGGGAGGGAGG + Intronic
958914136 3:100029035-100029057 TTTTTTTGAGCCTGGAATGGTGG + Intronic
960039439 3:113134647-113134669 CTTGGTTGAGCCAGGCATGGTGG - Intergenic
961392049 3:126558025-126558047 CAGGGTTGAGCCTGGGCTGGAGG - Intronic
962929343 3:140022671-140022693 CTGTGTGGAGAATGGGATGGAGG + Intronic
964805797 3:160608384-160608406 CTGTGTGCAGCCTGGCATGGTGG - Intergenic
967891938 3:194369802-194369824 CAGTGTTGGCCCTGGGAGGGGGG + Intergenic
967994934 3:195159435-195159457 CTGTGTTGGGAGTGGGTTGGAGG - Intronic
968410695 4:387193-387215 CAGGGCTGAGCCTGGGCTGGAGG + Intergenic
968480343 4:830421-830443 AGGTGTTGAGGCTGGGAGGGCGG - Intergenic
968801545 4:2746391-2746413 CAGTGTTGAGCCTGAGGCGGGGG - Intronic
968921915 4:3526768-3526790 CTGTGTTGGGCCTGGGAGGAAGG + Intronic
969422639 4:7106311-7106333 CTGCATTCAGCCTGGGCTGGTGG + Intergenic
969423509 4:7110707-7110729 CAGTGCTGAGCCTAGGATGGGGG + Intergenic
969821544 4:9724591-9724613 GTGTGTTGGGCCGGGCATGGTGG - Intergenic
970550928 4:17180440-17180462 CTGTGTTGTCCCTGGAATGAGGG + Intergenic
973972285 4:56225379-56225401 CCATGTTGAGGCTGGCATGGTGG - Intronic
975445791 4:74463730-74463752 CTGTGATGAGAATGGGATGGAGG + Intergenic
975736296 4:77384520-77384542 CTGTGTTGCGCTGAGGATGGTGG + Intronic
978172459 4:105689613-105689635 CTGCATTTAGCCTGGCATGGTGG + Intronic
980883280 4:138735564-138735586 CTGTGCAGAGGCTGGGAAGGTGG - Intergenic
980992923 4:139753934-139753956 CTGTCTGGAGACTGGGGTGGAGG + Intronic
981680988 4:147398010-147398032 AAGAGTTGAGGCTGGGATGGTGG + Intergenic
982202674 4:152975123-152975145 CTGTGCTGAGGGTGGGTTGGGGG - Exonic
982319903 4:154067162-154067184 GTTTCTTGAGCCTGGGATGTGGG + Intergenic
983927771 4:173420153-173420175 CTCTGTTGAGCCACGGATGTGGG - Intergenic
984950658 4:185005187-185005209 CTGGGTGGAGCCTAGGCTGGAGG - Intergenic
987269825 5:16295279-16295301 GTGTATCAAGCCTGGGATGGAGG - Intergenic
989115920 5:37952156-37952178 CTGTGTTGTGTCTGGGCTCGCGG + Intergenic
989601306 5:43203151-43203173 CTGAGTGGAGCCTAGGAGGGAGG - Intronic
990019500 5:51107814-51107836 CTGTCTGGAGCCAGTGATGGTGG + Intergenic
990361405 5:55024267-55024289 ATGTGTTGATCCTGTGATGAAGG - Exonic
991975232 5:72178450-72178472 CAGTGTTGAACCTGGGCAGGGGG + Intronic
992879954 5:81097952-81097974 CTGTGTTGAGGATGGGCTGAGGG + Intronic
993391965 5:87329354-87329376 ATGGGTTGAGCCTGGGAGGTGGG + Intronic
996520076 5:124416312-124416334 CTGTTGTGAGCCTGGTTTGGAGG + Intergenic
997975603 5:138439847-138439869 GTGTGCTCAGCCTGGGATTGTGG + Intronic
998092157 5:139377891-139377913 CTGTGTGGAGCCTTTGAGGGAGG + Intronic
999636722 5:153630622-153630644 CTGCTTTGAGCATGGGAGGGAGG - Intronic
1000348149 5:160331678-160331700 CTGTATTGAACCTGGGTTGAAGG - Intronic
1000463161 5:161547182-161547204 CTGGGGCGAGACTGGGATGGGGG + Intronic
1002056880 5:176603266-176603288 GTGTGTAGAGGCTGAGATGGTGG - Intronic
1002461838 5:179377793-179377815 CTCTGGTGAGCCTGGGCAGGTGG - Intergenic
1002846167 6:947346-947368 CTGTGCTGACCCTGGGCTGGAGG + Intergenic
1003130268 6:3389613-3389635 CTGTAGTGAGCCTGAAATGGTGG - Intronic
1003196526 6:3919943-3919965 CTGTGTGGAACCTGGGATTCAGG - Intergenic
1006011931 6:31049757-31049779 CTGTTTTGAGTCAGGCATGGTGG + Intergenic
1006374701 6:33665426-33665448 CTGTGTTGAGCCTGGTCTCAAGG + Intronic
1006641463 6:35491743-35491765 CTGGGTGGAGGCAGGGATGGGGG + Intronic
1007809093 6:44473879-44473901 CTGTGTTCATCTTGGGTTGGGGG - Intergenic
1009870960 6:69451617-69451639 CTCTGATGAGCATGGGACGGAGG - Intergenic
1012508771 6:99978703-99978725 CTGTCTTGGGCCAGGCATGGTGG - Intronic
1014642564 6:123930997-123931019 CTGTGTTTTGCCTGCGATGAAGG + Intronic
1015162190 6:130165967-130165989 CTGTCCTGACCCTGGGATGAAGG - Intronic
1017014140 6:150086256-150086278 CTTTGTTGGTCCTGGTATGGAGG + Intergenic
1018455813 6:163951312-163951334 AAGTGGTGAGCCTGGAATGGTGG + Intergenic
1019538127 7:1539311-1539333 CCGTCCTGAGCCTGTGATGGAGG + Intronic
1019642322 7:2110592-2110614 CTGTGTTGAGGATGGGAAGGAGG - Intronic
1019851252 7:3560605-3560627 CTGTGTGGAGACTGGGCTGTGGG - Intronic
1020257479 7:6510220-6510242 CAGGGCTGAGCCTGGGGTGGAGG + Intronic
1021992269 7:26150826-26150848 CTGTGTTAAGCCTTGGAAGATGG - Intergenic
1022250774 7:28605854-28605876 ATCAGTTGAGCCTGGGAAGGGGG + Intronic
1022480306 7:30739242-30739264 CAGTGTGAAGCCTGGGCTGGGGG + Intronic
1023790535 7:43749972-43749994 GGGTCCTGAGCCTGGGATGGAGG + Intergenic
1023996091 7:45159748-45159770 TTGTGTTGGGCATGGGATTGTGG + Intronic
1025035902 7:55592349-55592371 CTGTGGGGAGCCTGGGAATGGGG + Intergenic
1026742980 7:72990441-72990463 CTGTGCTGGGGGTGGGATGGGGG + Intergenic
1028487026 7:91370945-91370967 CTGAGATGAGCCTGGGATGCAGG - Intergenic
1031166524 7:118235323-118235345 GTGTATTGAGCCGGGCATGGTGG + Intronic
1031210703 7:118822965-118822987 CTGTTTTCAGCCAGGCATGGTGG - Intergenic
1032062920 7:128739599-128739621 CTGTGTGCAGCCTGGGATGGAGG + Intronic
1032085398 7:128880969-128880991 CTGGGGTGGGCCTGGGAGGGTGG - Intronic
1032513664 7:132491592-132491614 CTGTGTTTGGCCTGGGCTGGTGG - Intronic
1033098495 7:138450876-138450898 CTGTGTAGGGCAAGGGATGGGGG - Intergenic
1033640313 7:143256899-143256921 CTGTCATGACCCAGGGATGGAGG - Intronic
1033928587 7:146495124-146495146 CTGTGATAAGCCTGTGATGCCGG + Intronic
1034138352 7:148793005-148793027 CATTGTTGAGCCAGGCATGGTGG + Intronic
1034613521 7:152394183-152394205 CTGTGTTGAGACTAGAATGAAGG - Intronic
1035410140 7:158633453-158633475 CTGTGTTGAACCAGGGGTGAGGG + Intronic
1035650430 8:1260074-1260096 CCGGGTGGAGCCTGGGATGCTGG + Intergenic
1035795869 8:2355833-2355855 CTGTGTGGGGCCTGGGAGTGAGG + Intergenic
1035795882 8:2355872-2355894 CTGTGTGGGGCCTGGGATTGGGG + Intergenic
1036012900 8:4747761-4747783 CTGTGTAAAGCCTGGGATAGAGG + Intronic
1036731350 8:11268313-11268335 CTGTCTGGAGCCAGGCATGGTGG - Intergenic
1036766642 8:11553698-11553720 CTGGGCTGAGGCTGGGGTGGGGG + Intronic
1037259498 8:16991698-16991720 CTGTGCTGTGCCAGGCATGGTGG + Intergenic
1037337879 8:17809323-17809345 ACGTGTTGAGCGGGGGATGGTGG - Intergenic
1037833958 8:22205343-22205365 CTGTGCAGAGCCGGGGATGCAGG + Intronic
1037856540 8:22375156-22375178 CTGTGTTCAGACTGGAAAGGAGG - Intronic
1038265622 8:26037864-26037886 CTGTGTTTAGCTTTGAATGGGGG - Intronic
1039473385 8:37827097-37827119 CTGTGCTGGGTCTGAGATGGAGG - Intronic
1039549725 8:38434410-38434432 CAGTGTTGAGCCAGGAATTGAGG - Intronic
1040418450 8:47217637-47217659 TTGTGCTGACCCTGGGATGCCGG - Intergenic
1042423358 8:68618433-68618455 ATCTGTTGAGCCTGGGAAGCAGG - Intronic
1043702891 8:83313034-83313056 CTCTGATGAGCATGGGAGGGAGG - Intergenic
1044189135 8:89293892-89293914 CTGTGTGGAGCATGGGTTGTAGG - Intergenic
1047027850 8:120843999-120844021 CTGTGTGGAGTCTAGAATGGAGG + Intergenic
1047237175 8:123052096-123052118 CTGTCTTGGGCCAGGCATGGTGG + Intronic
1047529317 8:125660781-125660803 CTGTCCTGAGGCTGGCATGGTGG + Intergenic
1048586766 8:135781300-135781322 CTGGGTGGAGCCTGAGATAGAGG + Intergenic
1050012308 9:1197324-1197346 ATCTGTTGAACCTGGGTTGGGGG + Intergenic
1050554332 9:6776244-6776266 ATGTGTTGAGCGGGGCATGGTGG - Intronic
1052495991 9:29225005-29225027 CTGTGTTCGGCCAGGCATGGTGG + Intergenic
1053562204 9:39208235-39208257 CTGTGGTGAGGCAGGGTTGGGGG + Intronic
1053828011 9:42046236-42046258 CTGTGGTGAGGCAGGGTTGGGGG + Intronic
1054134914 9:61410723-61410745 CTGTGGTGAGGCAGGGTTGGGGG - Intergenic
1054602546 9:67141210-67141232 CTGTGGTGAGGCAGGGTTGGGGG - Intergenic
1056271804 9:84954562-84954584 CTGTGTTGAGCGGAGGTTGGAGG + Intronic
1059046929 9:110879076-110879098 CGGTGTTGTGCCTGGGTTTGTGG - Intronic
1061537062 9:131256813-131256835 CAGTCTTGAGCCTGAGACGGTGG - Intergenic
1062160296 9:135076009-135076031 CTCTGCTGAGCCGGGGCTGGAGG - Intronic
1062541778 9:137044747-137044769 CTGTGCTGAGCCCGGGTGGGTGG - Intronic
1062591895 9:137278098-137278120 CTGGGTTGAGCCTGGGGACGGGG + Intronic
1062644173 9:137538304-137538326 CTGTTTGGGGCCTGGGGTGGAGG - Intronic
1062736985 9:138142738-138142760 GTGTGTTGTGCATGGGATGGAGG + Intergenic
1203781019 EBV:100870-100892 CAGTCTTGAGCGTGGCATGGAGG + Intergenic
1187562749 X:20418223-20418245 CTGTGTTGGGAGTGGGGTGGGGG + Intergenic
1187987703 X:24832341-24832363 CTTTGTTGAGACTGAGATGCAGG - Intronic
1190632456 X:52401111-52401133 TTGTGCTGAGCCTGAAATGGTGG - Intergenic
1190634916 X:52424154-52424176 CTGTGCTGAGCCTGAAATGGTGG + Intergenic
1190653563 X:52591293-52591315 TTGTGCTGAGCCTGAAATGGTGG + Intergenic
1190825074 X:54010233-54010255 ATCTCTTGAGCCTGGGATGCAGG + Intronic
1192148874 X:68699626-68699648 CAGTGATGAGGCTGGGAAGGGGG - Intronic
1192152188 X:68719255-68719277 CTGAGTTGAGGCTGGGACGATGG - Exonic
1192496290 X:71618337-71618359 CTGTGGTGACCCTGGGCTGTGGG + Intronic
1193723957 X:85019138-85019160 CTGTGGTGATGCTGGGATTGGGG + Intronic
1194885040 X:99304155-99304177 TTGTCCTGAGCCTGGCATGGTGG - Intergenic
1194995421 X:100586781-100586803 CTGTGTTCAGGCTGGCAGGGTGG + Intronic
1195216944 X:102712302-102712324 CTACGGTGGGCCTGGGATGGGGG + Exonic
1197803951 X:130381434-130381456 CTGTGTTTGGCCAGGCATGGTGG - Intergenic
1199762143 X:150913067-150913089 CCATGTGGAGCCTGGGTTGGTGG - Intergenic