ID: 914675417

View in Genome Browser
Species Human (GRCh38)
Location 1:149904207-149904229
Sequence TTTCTGTGTTGAGCCTGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675417_914675426 1 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675417_914675425 0 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675417_914675429 9 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675429 1:149904239-149904261 GGGAGGAACTGTGGGAGGCAGGG 0: 1
1: 0
2: 14
3: 124
4: 1798
914675417_914675423 -8 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675423 1:149904222-149904244 CACAGAAACCAGATTAGGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 197
914675417_914675427 4 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675417_914675428 8 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675417 Original CRISPR TTTCTGTGTTGAGCCTGGGA TGG (reversed) Exonic
900892243 1:5457912-5457934 TTTCTGGGTGCAGCCTGGGAGGG + Intergenic
901119745 1:6881520-6881542 TTGCTGTGCAGAGCGTGGGAAGG + Intronic
901415701 1:9114526-9114548 CCTCTGAGTTGGGCCTGGGAGGG + Intronic
902249014 1:15141139-15141161 TTCCTGTGTGGAGCCCGGGGTGG + Intergenic
902523712 1:17039534-17039556 TTGCTTGGTTGAGCCTGGGAGGG + Intronic
903570629 1:24302043-24302065 TTTCTGAGATTAGCCTGGGTTGG - Intergenic
903733175 1:25512975-25512997 TTTCTGTGTGCAGCCTTGGAGGG - Intergenic
905461064 1:38123336-38123358 TTTCAGTTCTGAGCCTAGGAGGG + Intergenic
905670454 1:39787662-39787684 TCTCTGTGCGGAGCCTGGGTGGG - Intronic
906343771 1:45002881-45002903 TTTGTGTGTTGAGACTGGGTTGG + Exonic
906513710 1:46425728-46425750 TTTGTTTGCTGAGCCTGTGAGGG - Intergenic
907972187 1:59393858-59393880 ATTGTGTCCTGAGCCTGGGAGGG - Intronic
911616592 1:100018965-100018987 TTTCTGTTTTCAGCTTGGTATGG + Intronic
912105846 1:106273586-106273608 TTACTGGGATGAACCTGGGATGG - Intergenic
912239547 1:107891243-107891265 TTTCTGTGTCAAGCCTTGCATGG + Intronic
912472311 1:109914183-109914205 TTTCTGCGTTGAGCAGGGCATGG + Intronic
914675417 1:149904207-149904229 TTTCTGTGTTGAGCCTGGGATGG - Exonic
917721008 1:177786586-177786608 TGTCTGTGTCAAGCCTGGGCTGG - Intergenic
922853263 1:228752449-228752471 TGTCTGTGCCGAGACTGGGAAGG + Intergenic
923149199 1:231218786-231218808 TTTCCGGATTGAGCCTGGGCAGG + Intronic
1063662827 10:8045683-8045705 TTTCTGTGGTGACCTTGGGCGGG + Intergenic
1067945407 10:50685539-50685561 TTTCTCTTTTGAGACTGTGAGGG - Intergenic
1068779123 10:60900298-60900320 TGACTCTGCTGAGCCTGGGAGGG + Intronic
1070441109 10:76444278-76444300 TTGCTGGGCTGAGCCTGGGTGGG - Intronic
1070862921 10:79686756-79686778 GTTCTGAGTGGACCCTGGGAAGG - Intergenic
1070866917 10:79712411-79712433 TTTCTCTTTTGAGACTGTGAGGG - Exonic
1070880707 10:79850532-79850554 TTTCTCTTTTGAGACTGTGAGGG - Exonic
1071633829 10:87234634-87234656 TTTCTCTTTTGAGACTGTGAGGG - Exonic
1071647278 10:87366850-87366872 TTTCTCTTTTGAGACTGTGAGGG - Exonic
1072986180 10:100143077-100143099 TTTCTGTGGTGAGACTGTCATGG + Intergenic
1075212454 10:120502706-120502728 ATTCTGTCTGGAGACTGGGACGG + Intronic
1076896119 10:133313178-133313200 TTTCTGTGTTGAGTCAGGTGCGG + Intronic
1077440016 11:2563800-2563822 TTTCTGTCTTCATCCTGAGAGGG + Intronic
1078450370 11:11436425-11436447 TTTCAGTGCTGAAACTGGGAAGG - Intronic
1079131214 11:17747884-17747906 TTTCTGTGTTGCACTGGGGAAGG - Intronic
1079794546 11:24783761-24783783 TTTCTCTGTTGAGGAGGGGAAGG + Intronic
1080573308 11:33576690-33576712 ATTCTGTGTGTAGCCAGGGAAGG + Intronic
1082302806 11:50530573-50530595 TTTCCTTGTTGAATCTGGGAAGG - Intergenic
1082763137 11:57145712-57145734 GTTGTGTGTTGAGCCCAGGATGG - Intergenic
1083367438 11:62150104-62150126 TATCTGGGTTGATCTTGGGAGGG - Exonic
1083773364 11:64880390-64880412 TTTCTGGGTTGATCTAGGGAAGG + Intronic
1084416458 11:69035599-69035621 TTTTGGTGGAGAGCCTGGGAAGG - Intergenic
1084573018 11:69970830-69970852 TATCCGTGCTGAGCATGGGAGGG - Intergenic
1085717610 11:78886862-78886884 TTTGTGTCTTGAGCCAGGAATGG - Intronic
1086891463 11:92263167-92263189 TCTCTGTGTTAATCCTGTGAGGG + Intergenic
1087934776 11:104019729-104019751 TTTCTGTCCTGAGCATGGAAGGG + Intronic
1088118549 11:106340467-106340489 CTTCTGTGCTGGGGCTGGGAAGG - Intergenic
1088846675 11:113674113-113674135 TGTCTGTGTAGACCCTGGGAAGG - Intergenic
1088884067 11:113993544-113993566 TTTATCTGTTGAGGTTGGGAAGG + Intergenic
1090685787 11:129117496-129117518 TTTCTGCCTTGATGCTGGGAAGG - Intronic
1090960732 11:131554306-131554328 TTTCAGTGATGAACCTGTGATGG + Intronic
1091122098 11:133065183-133065205 CATCTGTGCTGAGCCTGGGCTGG + Intronic
1091728565 12:2863215-2863237 ATTCTTTGTTGGGCGTGGGAGGG - Intronic
1093701010 12:22220728-22220750 TTTCCGTGAGGATCCTGGGAGGG - Intronic
1095777804 12:46028629-46028651 TTTCTGTGCTAAGCCAGGGGAGG + Intergenic
1096060558 12:48695487-48695509 TTTCTGTGTGGAAACTGGTAGGG - Intronic
1099961343 12:89400110-89400132 GCTCTGGGTTGGGCCTGGGAAGG + Intergenic
1102370757 12:112381396-112381418 TCTCTGTGTTGTGTCTCGGATGG - Intronic
1102957963 12:117071744-117071766 TTTCTAAGCTGAGCCTGGGCAGG + Intronic
1102980765 12:117239138-117239160 GTCCTCTGTTGAGACTGGGAAGG + Intronic
1103700886 12:122848242-122848264 TTTTTGTGATGAGACTGAGATGG - Intronic
1103710679 12:122910246-122910268 CCACTGTGTAGAGCCTGGGAGGG + Intergenic
1104022528 12:125002951-125002973 TCTCTGGGTTGAGGCTGGGCAGG + Intronic
1104140599 12:125983441-125983463 TTTCTGGGAGGAGCCTGGGGGGG - Intergenic
1104667211 12:130656127-130656149 TTTCTGTGTGGGCCCCGGGAGGG + Intronic
1105665211 13:22548179-22548201 TTTCTGTGTTTAGTATGTGAGGG - Intergenic
1105938065 13:25120218-25120240 TCTCTGTGTTGACCCTGGGCAGG - Intergenic
1105946732 13:25196800-25196822 TGTCTGTCTTGGGCCTGGGCTGG + Intergenic
1106125757 13:26898702-26898724 TTGCTGTGGTGAGGCTGGGTTGG + Intergenic
1106901345 13:34357608-34357630 ACTCTCTGTTCAGCCTGGGAAGG + Intergenic
1107861926 13:44669338-44669360 TTTCTGCTTTGAGCGTGGGTGGG + Intergenic
1109447957 13:62470100-62470122 TTCCTGTATTGAACCTGAGATGG - Intergenic
1109778101 13:67070327-67070349 TTTCTTTTTTGAACCTGTGAGGG - Intronic
1110211831 13:72982484-72982506 TTTCTTTGTTGAGGTAGGGAGGG - Intronic
1113632713 13:111899174-111899196 TTGCTGTGATTAGCCTGGGCAGG - Intergenic
1117454353 14:55882934-55882956 TTTCTCTGTAGAGTCAGGGAAGG + Intergenic
1119428266 14:74550006-74550028 TCTCTGTGCACAGCCTGGGAGGG - Intronic
1119775444 14:77245251-77245273 TGTCTGTGCTGGGCATGGGAAGG - Intronic
1122301994 14:100736779-100736801 TTTTTGGGGTGAGGCTGGGAGGG - Exonic
1122477273 14:102019318-102019340 TTTCTCTGTTGAGCCTCCCATGG + Intronic
1123020356 14:105395098-105395120 GTCCTGAGTTGAGCCTGGGGGGG + Exonic
1123212362 14:106773281-106773303 TTTCTGTGCTGTGCAAGGGAGGG - Intergenic
1124208387 15:27742484-27742506 TCTCAGTCTTCAGCCTGGGATGG - Intergenic
1124255293 15:28136556-28136578 TGTCAGTGCTGAGGCTGGGAAGG - Intronic
1124569021 15:30843064-30843086 TGTCAGTGCTGAGGCTGGGAAGG + Intergenic
1125097074 15:35867162-35867184 ATTCTGTGTTGAGCCTGAACTGG + Intergenic
1126739792 15:51765982-51766004 TTTCTATGGAGAGCCAGGGAAGG + Intronic
1126850424 15:52793563-52793585 TTTCTTTGCTGAACCTGGTAGGG - Intergenic
1127574632 15:60279007-60279029 TTTCTCTGTGAAGCCTGGAAAGG - Intergenic
1128159389 15:65413492-65413514 TTTTTGCCTTGACCCTGGGATGG - Intronic
1128486347 15:68094036-68094058 TTTCATTTTTAAGCCTGGGAAGG + Intronic
1130195622 15:81778014-81778036 TTTCTGTCTTGAGACTGGACTGG + Intergenic
1130649960 15:85756856-85756878 CTTCGGTGTTGAGCAAGGGATGG + Intergenic
1132786377 16:1658962-1658984 TTTCTGTGGTGAGCCAGACAGGG + Intronic
1132803851 16:1766785-1766807 ATTCTGTGCTGAGCCTGGTGTGG + Exonic
1134888914 16:17820968-17820990 TTTTTGTCTTCAGCCTGGGCTGG - Intergenic
1134916098 16:18072300-18072322 TCCCAGTGTGGAGCCTGGGAGGG - Intergenic
1135403692 16:22183418-22183440 ATTATGTGTTGAGGCTCGGAAGG + Intronic
1137484568 16:48880846-48880868 ACTCTGTGTGCAGCCTGGGATGG + Intergenic
1140809844 16:78566554-78566576 TGTCTGTGCTGAGGCTGGGAGGG + Intronic
1142100541 16:88268761-88268783 TTTTTGAGGTAAGCCTGGGAGGG + Intergenic
1147449086 17:40492609-40492631 TTTTTGTTTTAAGCCTGGGCTGG + Intronic
1147944929 17:44075569-44075591 GTTCTGTTTTGTGCCTGTGAGGG - Intronic
1149518014 17:57295017-57295039 TTTCTGGGGAGAGCCAGGGAAGG + Intronic
1150191157 17:63240773-63240795 TATTTGAGTTCAGCCTGGGAAGG - Intronic
1152961174 18:81401-81423 GTTGTGTGTTGTGCATGGGATGG - Intergenic
1154316107 18:13304432-13304454 TCTCTGTGTTGGGCCTGGCTTGG + Intronic
1154343727 18:13525579-13525601 AATCTGTGTTGTGTCTGGGAAGG + Intronic
1166019547 19:40013587-40013609 TTTCTGTGTTGGGGCAGGGATGG - Intronic
1167135824 19:47614827-47614849 TTTCTGTGTGAAGCATGGGAAGG + Intronic
1167576935 19:50322322-50322344 TTGCTGTGGGCAGCCTGGGAGGG - Intronic
1167587066 19:50381201-50381223 TTTCAGTGTTAAAACTGGGAAGG - Intronic
924978193 2:196741-196763 TTTCTGTTTAGACCCTGAGAAGG - Intergenic
926373156 2:12200832-12200854 TATTTGTGTTGAACCTGGAATGG + Intergenic
927477155 2:23422894-23422916 ATTCAGTGCTGAGCCTGCGAGGG + Intronic
928194881 2:29208371-29208393 TGTCAGAGCTGAGCCTGGGAAGG + Intronic
931485654 2:62688757-62688779 TTTCTGTGATTAGCCTGGGTAGG - Intronic
934714115 2:96533396-96533418 TTCCTGTGTTGGGCCAGGGCTGG - Intergenic
937747514 2:125432050-125432072 TTTCTGAGATGCTCCTGGGAAGG + Intergenic
937976223 2:127583581-127583603 TTTCTGACTTGAGCCGGGGGTGG + Intronic
939858717 2:147392336-147392358 TTTCTGATTTGGGCCTGGGGTGG + Intergenic
943492229 2:188569032-188569054 TTTCAATGTTGTGCCTGGGTAGG + Intronic
945651133 2:212560745-212560767 TTTCTATATTGAGTGTGGGAAGG - Intergenic
948069203 2:235106254-235106276 TTTCTGTGACGTTCCTGGGAAGG + Intergenic
948349974 2:237331743-237331765 TTTATGTCTTCACCCTGGGAAGG + Intronic
948384687 2:237574240-237574262 TTTCTGTATAGATTCTGGGAGGG - Intergenic
1169189084 20:3645768-3645790 TTGCCTTGTTGAGCCTGTGAAGG - Intronic
1169728030 20:8757145-8757167 TGGCTGTGGAGAGCCTGGGAGGG - Exonic
1173500438 20:43549059-43549081 TTCATGTGTTGAGTCTGGGAAGG + Intronic
1174661036 20:52213423-52213445 TGTCTCTGGTGAGCCTGAGAGGG + Intergenic
1175895545 20:62334147-62334169 CTTCTAGGCTGAGCCTGGGAGGG + Intronic
1176198441 20:63848446-63848468 TTCCTGTCCTGGGCCTGGGAGGG - Intergenic
1176227642 20:64010945-64010967 TCTGTGTGTTTAGCCTGTGAGGG + Intronic
1176267384 20:64217311-64217333 CTTCTGTGTTGCTCCTGGGAGGG + Intronic
1176272127 20:64240793-64240815 TTTGTCTGTCGAGGCTGGGAGGG + Exonic
1177126946 21:17206162-17206184 TTCCTGTGTTGTTCCTGTGATGG - Intergenic
1181054393 22:20253228-20253250 TTTCTCTGCTGAGGCTGAGATGG - Intronic
1181473807 22:23156568-23156590 TTTCTGTCTTCTTCCTGGGAAGG - Intronic
1183459336 22:37940568-37940590 TTCCTGTGTGGAGCCTGGGAGGG - Intronic
1183754683 22:39749219-39749241 CTTCTGTAGTGAGCCTGGGCAGG - Intronic
1184983432 22:48113031-48113053 TTTCTGCCTTCAGACTGGGATGG - Intergenic
949785330 3:7733913-7733935 GTACTGTGCTAAGCCTGGGAAGG - Intronic
950126556 3:10513436-10513458 TTTCTGTCCTTACCCTGGGAAGG + Intronic
950232566 3:11289460-11289482 TTTCTGTTTTCAGCCTGTCATGG + Intronic
952459691 3:33511594-33511616 CTTCTGTATTGAGCTTGGGGAGG + Intronic
952610635 3:35204930-35204952 TTGCTGTTTTGTTCCTGGGAAGG + Intergenic
953026510 3:39148248-39148270 TTTGTGGTTTGACCCTGGGAGGG - Intronic
953908618 3:46881314-46881336 TTTCTGTGTTTGGCTGGGGAGGG - Intronic
954955091 3:54511884-54511906 TTTCTGTGTTTTGCCTGGGAAGG + Intronic
955942469 3:64159318-64159340 GTTCTGGGATGATCCTGGGAGGG + Intronic
956782910 3:72618479-72618501 TTCCCGTGTTGAGTCTGGGCTGG - Intergenic
957302519 3:78410994-78411016 TGGCTGTGTTGGGCCTGGAAGGG + Intergenic
960426255 3:117511396-117511418 TTTTTGGGGTGAGCATGGGATGG - Intergenic
963134932 3:141893803-141893825 TTTTTGCTTGGAGCCTGGGAAGG - Intronic
964614496 3:158648380-158648402 ATTCAGTTTTGAGCCTGGGCCGG + Intronic
969529369 4:7722214-7722236 TTCCTGTGCTAATCCTGGGAAGG - Intronic
969848329 4:9937101-9937123 TTTCTATGTTGTGCCTGTGATGG - Intronic
970464422 4:16308392-16308414 TGTCTGTGTTGAGCTGGTGAGGG - Intergenic
970578454 4:17451027-17451049 TTTTTGTGTTGGGACTGAGATGG + Intergenic
970838708 4:20441647-20441669 TTTCTGAGTTAAGGCTGTGATGG + Intronic
971231360 4:24802162-24802184 TTTCTGTTTTGGGAATGGGATGG + Intergenic
971576977 4:28286994-28287016 TGGCTGTGTGGGGCCTGGGAAGG - Intergenic
972006545 4:34115315-34115337 TGTCTGTGTAGAGACAGGGAGGG - Intergenic
972192335 4:36610063-36610085 TTTCTGTGCTGAGCCAAGAATGG - Intergenic
975802530 4:78076132-78076154 TTTCTCTGTAGAGCTTTGGAGGG + Intronic
977634593 4:99282565-99282587 GTGCTGTGTTTGGCCTGGGAGGG - Exonic
977637283 4:99314040-99314062 GTGCTGTGTTTGGCCTGGGAGGG - Exonic
977639694 4:99343014-99343036 GTGCTGTGTTTGGCCTGGGAGGG - Exonic
981882147 4:149627122-149627144 GTTCTGTGTGGAGGCTGGGGAGG + Intergenic
981932805 4:150208965-150208987 GTTCTGTGGTGGGCCTGTGATGG + Intronic
982086046 4:151837087-151837109 TTTCAGTGGTAAGGCTGGGAGGG + Intergenic
984012459 4:174386743-174386765 TTTCTGTGTTGTGGGTGGAAAGG - Intergenic
984255255 4:177382390-177382412 TTTTTGTGTAGAGACAGGGAGGG + Intergenic
984637496 4:182126870-182126892 TCTCTGTGTTGAGGATGGGGTGG - Intergenic
987254320 5:16134126-16134148 GCTCAGTGTTGAGCCTGGCATGG + Intronic
988120611 5:26956194-26956216 TTCCTGTGTTGTTCTTGGGATGG + Intronic
990450654 5:55929324-55929346 TTTCTGTGTGGGGCCAGGGGAGG + Intergenic
992089137 5:73302464-73302486 CTTCAGTGTTCATCCTGGGAAGG - Intergenic
993037744 5:82775611-82775633 TTTCTGTGTGGAGACAGGGTTGG + Intergenic
996106224 5:119507069-119507091 TTTCTGGGCTTAGGCTGGGAAGG + Intronic
999325982 5:150643843-150643865 TTTCTCTGTGCAGCCTGGGGAGG + Intronic
1001015749 5:168139619-168139641 TATCTGTGTTGATTCAGGGAAGG + Intronic
1001031081 5:168263419-168263441 TTTGTGTGTAGCGCCTGGGGAGG + Intronic
1002159351 5:177306029-177306051 TTTCGGTGTTGGGGCTGGGCTGG + Intronic
1002289623 5:178190996-178191018 ATTCTGTTTTGAGCCAGGCACGG + Intergenic
1002461839 5:179377796-179377818 TGTCTCTGGTGAGCCTGGGCAGG - Intergenic
1002785757 6:398736-398758 TGTGTGTGTGAAGCCTGGGAAGG - Intronic
1003565284 6:7217015-7217037 TTGCTGTGTGCAGCCTGGGCGGG + Intronic
1006592377 6:35167962-35167984 CTGCTTTGTTGAACCTGGGAAGG - Intergenic
1009396828 6:63208941-63208963 TTTCTGTGTTGACTCCAGGAAGG - Intergenic
1010855453 6:80832894-80832916 TTTATCTGTGGACCCTGGGAAGG - Intergenic
1013111315 6:107067547-107067569 GTTCTGAGTGGACCCTGGGAAGG + Exonic
1013392587 6:109701676-109701698 TTTCTGTGATGGGGGTGGGAGGG - Intronic
1014365276 6:120532559-120532581 TCTTTGGGTTGAACCTGGGATGG - Intergenic
1018783492 6:167090237-167090259 TTTCTGTGTTGCTCCCTGGAGGG - Intergenic
1019642323 7:2110595-2110617 TGGCTGTGTTGAGGATGGGAAGG - Intronic
1021226972 7:18039273-18039295 TTTTTATGTTGTGCCTGGGAGGG + Intergenic
1022718722 7:32923069-32923091 TTTCTGGGTTGGGCCTGATATGG + Intergenic
1024243469 7:47452929-47452951 TTACTGTGCTGGGCCTGGGCAGG + Intronic
1025085918 7:56023158-56023180 GTCCTGACTTGAGCCTGGGAAGG + Intronic
1027825076 7:83102454-83102476 TTTGTGTGTTGTGGCAGGGATGG - Intronic
1030092156 7:105867207-105867229 TTTCCATGTTAAGCCTGGGAAGG - Intronic
1030375293 7:108746370-108746392 GCTCTGTGTTGCTCCTGGGAGGG + Intergenic
1030440607 7:109584028-109584050 TTTCTGTGGGGAGCCAGGCAGGG - Intergenic
1030996308 7:116362418-116362440 TGTCTGTCATGAGCATGGGAGGG + Intronic
1032062919 7:128739596-128739618 CCTCTGTGTGCAGCCTGGGATGG + Intronic
1034664832 7:152808602-152808624 TTTCTGAGTAGAGCTGGGGAAGG - Intronic
1036703947 8:11032639-11032661 CTTCTCTGGTGAGCCTGGGGAGG - Intronic
1037561700 8:20081096-20081118 TTTGTGTGTTGGGCCGGGCACGG + Intergenic
1047515913 8:125554747-125554769 CATCTGTGTAGAGCCTGGGCTGG + Intergenic
1047920435 8:129629384-129629406 TTTCAATGTTGAGTGTGGGAAGG - Intergenic
1048590186 8:135814130-135814152 TGACTGTGTTGAGGCTGGGAGGG + Intergenic
1053069420 9:35092292-35092314 TTTCTGTGGAAAGCCTGGGCTGG - Exonic
1053211681 9:36234485-36234507 TTGGTGTGTGGAGCCTGAGAGGG - Intronic
1054779033 9:69149686-69149708 TTTCTGGGTTGAGCTTGTGAAGG - Intronic
1055927538 9:81526211-81526233 ACTCTTTGTTGAGACTGGGATGG - Intergenic
1057353519 9:94318517-94318539 TTTCTCTTTTGAGACTGTGAGGG + Exonic
1057654232 9:96939075-96939097 TTTCTCTTTTGAGACTGTGAGGG - Exonic
1058083354 9:100722507-100722529 TTTCTGTGTGGATCCTGTGTGGG + Intergenic
1058277989 9:103070874-103070896 TTTCAGTGTTGCACCAGGGAGGG - Intergenic
1058428957 9:104901123-104901145 TTTCCGTGCTTAGCCAGGGAAGG - Intronic
1059720957 9:116959748-116959770 TTTCTGTCTTCTGCATGGGAAGG - Intronic
1060445000 9:123679811-123679833 TTTCTGTCTTTGGACTGGGAAGG - Intronic
1061159382 9:128884438-128884460 TGCCTGTCTTGGGCCTGGGATGG + Intronic
1061537063 9:131256816-131256838 TCTCAGTCTTGAGCCTGAGACGG - Intergenic
1062171493 9:135137314-135137336 TTTCAGGCTTGAGCCTGGGGTGG + Intergenic
1062736984 9:138142735-138142757 GTTGTGTGTTGTGCATGGGATGG + Intergenic
1186586408 X:10878481-10878503 GTACTGAGTTGAGCATGGGAAGG + Intergenic
1187726030 X:22203112-22203134 TTTCTGTGCTAAAACTGGGATGG - Intronic
1189337537 X:40179273-40179295 TATCTGTGTACAGCCTGGGGAGG + Intergenic
1189389321 X:40562908-40562930 TTTATGTGTAGTGCCTGGGCTGG + Intergenic
1191877186 X:65809037-65809059 GCTCTGTGTTGATCCTGGGTGGG - Intergenic
1192200940 X:69066354-69066376 TTTCTGTCTTTAACCTGGGCAGG + Intergenic
1192536790 X:71935277-71935299 CTTCTGTTTTGTCCCTGGGAGGG + Intergenic
1193236676 X:79114872-79114894 TTTCTGCCTTGACCCTGTGATGG + Intergenic
1193745275 X:85271057-85271079 TGTTTGTGTTGAGTGTGGGAAGG + Exonic
1194329300 X:92560975-92560997 TTTCTGTGTTGAGCCATGTGAGG - Intronic
1194679564 X:96835746-96835768 TCTCTGTGTTGTACATGGGAGGG + Intronic
1194885041 X:99304158-99304180 TTTTTGTCCTGAGCCTGGCATGG - Intergenic
1195365686 X:104123160-104123182 TCTCTGTGAAGAGTCTGGGAGGG - Intronic
1196612164 X:117727529-117727551 TTTCTGCCTTGAGCCAGGGCTGG - Intergenic
1198538542 X:137611566-137611588 TTTTTGAGTTGATCCTGGGTGGG - Intergenic
1200637999 Y:5680164-5680186 TTTCTGTGTTGAGCCATGTGAGG - Intronic