ID: 914675420

View in Genome Browser
Species Human (GRCh38)
Location 1:149904217-149904239
Sequence CTCAACACAGAAACCAGATT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675412_914675420 9 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675413_914675420 8 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675407_914675420 30 Left 914675407 1:149904164-149904186 CCTAGACTGTGGGACTCTTATCC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675415_914675420 -1 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179
914675416_914675420 -10 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG 0: 1
1: 0
2: 0
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675420 Original CRISPR CTCAACACAGAAACCAGATT AGG Exonic
900366363 1:2313471-2313493 CTCAGCCCAGAAACCAGGATTGG + Intergenic
900554549 1:3273209-3273231 CCCAACAAAGAAACCAGCGTTGG - Intronic
901501238 1:9653627-9653649 CTCAACACATCAATCAAATTGGG - Exonic
901627360 1:10631669-10631691 CGCAGGCCAGAAACCAGATTGGG - Intergenic
906412417 1:45589418-45589440 TTAAACCCAGAAACCAGACTGGG - Intronic
908238202 1:62167551-62167573 CTCAACACAACCACAAGATTTGG + Intergenic
910072402 1:83233024-83233046 CTCAAGACAAAGACCAAATTGGG - Intergenic
910198113 1:84667272-84667294 CTCAAGGCAGAAACCTGAATGGG + Intronic
910393888 1:86772582-86772604 GTGAACACAGAAACTGGATTTGG + Intergenic
910852396 1:91661632-91661654 GTCACCACACAAACCAAATTTGG - Intergenic
913580069 1:120217625-120217647 CTCAAGACAGATACAAGATGGGG + Intergenic
913628105 1:120680769-120680791 CTCAAGACAGATACAAGATGGGG - Intergenic
914385236 1:147162768-147162790 CTCAACATAGCAACATGATTTGG + Intronic
914561996 1:148829065-148829087 CTCAAGACAGATACAAGATGGGG + Intronic
914610835 1:149301156-149301178 CTCAAGACAGATACAAGATGGGG - Intergenic
914675420 1:149904217-149904239 CTCAACACAGAAACCAGATTAGG + Exonic
919525916 1:198650279-198650301 TTCAACACAGAAAGAAGATTAGG - Intronic
919776419 1:201197049-201197071 CCCAAAACAGAAACCTGGTTTGG - Intronic
921124414 1:212164328-212164350 CTCAGCACAGGATCCAGAGTAGG + Intergenic
922243105 1:223769615-223769637 ATCAAAACAGCAACCAGATTCGG + Intronic
923017109 1:230135507-230135529 TTCCACACAGAAACCTGATTCGG - Intronic
923465276 1:234242651-234242673 CTCAACAAAGAATCCAGCCTAGG - Intronic
1063043417 10:2367847-2367869 CTCAAAACAGAAGCCAGGGTAGG - Intergenic
1064154850 10:12895569-12895591 CTCAACTCATAAACCCTATTGGG - Intergenic
1064243825 10:13653917-13653939 CTCAACACACAAAAGAGATCAGG - Intronic
1065208764 10:23382336-23382358 CTCCACACAGAAACAAGGTGAGG + Intergenic
1066049521 10:31620885-31620907 TCCAACACACAAATCAGATTAGG + Intergenic
1066362706 10:34746707-34746729 CTTAACACAGAAAGGAAATTGGG - Intronic
1067374932 10:45719197-45719219 CTTAACACAGAAACAAGGCTTGG + Intergenic
1067818917 10:49509225-49509247 CTTAGCACAGAACCTAGATTAGG + Intronic
1067882747 10:50060841-50060863 CTTAACACAGAAACAAGGCTTGG + Intergenic
1067886495 10:50094001-50094023 CTTAACACAGAAACAAGGCTTGG - Intronic
1070357066 10:75650664-75650686 GTCAACAGAGAAAACAGACTTGG + Intronic
1070661106 10:78305839-78305861 CTCAAGACAGAAAGCAGAGTTGG - Intergenic
1071125225 10:82327179-82327201 CTCATCTCAGAAGCAAGATTAGG + Intronic
1075476375 10:122738299-122738321 CTCATCACAGAAACTAGAGCAGG + Intergenic
1075510156 10:123065742-123065764 CTCCACTCTGAAACCACATTTGG - Intergenic
1077477385 11:2796912-2796934 CTCCACACAGAAACCATTTACGG - Intronic
1079247929 11:18766832-18766854 CTGAACACACAAACCAGCCTGGG + Intronic
1079261417 11:18885793-18885815 ATGAACACAGAAAATAGATTAGG - Intergenic
1085800651 11:79586143-79586165 ATCAACACAGAAGACAGATGAGG + Intergenic
1085889278 11:80558524-80558546 CACCACACAGAAACAAGAATGGG - Intergenic
1086294085 11:85345888-85345910 CGAAGCACACAAACCAGATTTGG - Intronic
1087715265 11:101601638-101601660 CTCAAGACAAAAAGCAGATAGGG - Intronic
1087895476 11:103581027-103581049 TCAAACAGAGAAACCAGATTAGG - Intergenic
1088781135 11:113135378-113135400 CTTGACACAGAAAACAGACTTGG + Intronic
1090962483 11:131569446-131569468 ATAAAGACAGAAAGCAGATTAGG - Intronic
1092180523 12:6443666-6443688 CTCAAGTCAGAAGCCACATTTGG - Intergenic
1092669531 12:10847335-10847357 CTCAAGTCAGAGACCAGATCAGG - Exonic
1093166261 12:15807390-15807412 GTCAAGACAGAAGACAGATTTGG + Intronic
1093769317 12:23000985-23001007 CCCTACAGAGGAACCAGATTGGG + Intergenic
1094248143 12:28326823-28326845 CTCAACAGAGAAACCCATTTTGG - Intronic
1096685118 12:53283214-53283236 CTCAACTCAGAAAGCAGCTGTGG + Exonic
1098562925 12:71898039-71898061 CTCAAAAGAGAAATCAGAATAGG + Intronic
1099263338 12:80411894-80411916 CGCAACACAGCAACCATAGTTGG + Intronic
1100932673 12:99628348-99628370 TTAGAAACAGAAACCAGATTAGG - Intronic
1102615313 12:114148986-114149008 CTCAAGACAAACACCAGAGTGGG - Intergenic
1102817951 12:115883601-115883623 CTGTACAGAGAGACCAGATTTGG - Intergenic
1108740315 13:53330781-53330803 CTCCACACAGCAGCAAGATTTGG - Intergenic
1110934181 13:81263342-81263364 CTGAACTCAGATATCAGATTGGG - Intergenic
1113502283 13:110785787-110785809 ATAGACACAGAAAGCAGATTAGG + Intergenic
1114405314 14:22450917-22450939 CTCAACACAGAAGGCATCTTTGG + Intergenic
1115959316 14:38817086-38817108 CTCAAGTAAGAAACCATATTGGG + Intergenic
1116095324 14:40359836-40359858 CTCCACACAGAGCCCAGACTGGG + Intergenic
1116217739 14:42041699-42041721 CTCAACAAAGAAAAAAGCTTGGG - Intergenic
1123004962 14:105316679-105316701 CTCCCCACAGACACCAGAGTGGG - Intronic
1123173425 14:106396075-106396097 CTCAAGAAAGAACACAGATTGGG + Intergenic
1124396253 15:29304583-29304605 CTCAACTCACCAACCAGAGTGGG + Intronic
1125162504 15:36662324-36662346 CTCCACACACACACCAGAATGGG + Intronic
1126033901 15:44529731-44529753 CTCATCACAGAAACTAGTGTGGG - Intergenic
1137346751 16:47668873-47668895 CTCCCCAGAGAAACCAGAATAGG - Intronic
1138084652 16:54122454-54122476 TCCAACATGGAAACCAGATTTGG - Intergenic
1140102903 16:71933816-71933838 CACAACACAGAAACCCGAGGTGG - Intronic
1140673703 16:77305197-77305219 CTCAACACAGAATAAAGATGGGG - Intronic
1143460663 17:7101513-7101535 CTCAACAGAGAAGCCAGAGCTGG + Exonic
1146260969 17:31420616-31420638 TTCAAAAAAAAAACCAGATTTGG + Intronic
1146678431 17:34789974-34789996 CTGAACACAGAACCGAGAATTGG + Intergenic
1151877901 17:76877659-76877681 CTCACCGCAGAAACCAGCTGAGG - Intronic
1152680908 17:81667278-81667300 CGCACCACAGAAGCCAGATGTGG + Intronic
1153875920 18:9370448-9370470 CTGAACACATATACCAGAATTGG + Intronic
1156508582 18:37615903-37615925 TTTAACACAGAAAACAGTTTCGG + Intergenic
1156733313 18:40222681-40222703 CTCAAAATAAAAACCAGATAAGG - Intergenic
1158340454 18:56460389-56460411 CTAAACACAGAAACTAGAATGGG + Intergenic
1158850044 18:61486506-61486528 CTCAAGAGAGAAACTTGATTGGG + Intronic
1159047789 18:63385814-63385836 CCCAACACAGGAACCAAAGTGGG - Intergenic
1159205156 18:65240874-65240896 CTAAACAAAGAAAGCAGCTTGGG - Intergenic
1162696251 19:12478376-12478398 CTAAACATAGAACCCAGACTTGG + Intronic
1166056754 19:40294630-40294652 CCCAAGACAAAAACCAGATGAGG + Intergenic
1167712921 19:51123397-51123419 CTCAAGACAGAACTCAGATGTGG + Intergenic
1167715246 19:51138645-51138667 CTCAAGACAGAACTCAGATGAGG + Intergenic
1168549906 19:57284144-57284166 CTTAACACAGAAATAAGGTTAGG - Intronic
927011740 2:18911397-18911419 CTCAACACACACACCACAGTGGG - Intergenic
927361080 2:22234699-22234721 CTCAATACAGGTACCAGAGTTGG - Intergenic
927435823 2:23065249-23065271 CTCAAAAAAAAAACCAGAATGGG + Intergenic
928482233 2:31694223-31694245 CACTACACAACAACCAGATTTGG + Intergenic
928748040 2:34438131-34438153 CTCAACACAGCATGCAGCTTTGG - Intergenic
929170989 2:38933347-38933369 CTCAATACAGAAGCCACAGTGGG + Intronic
929275182 2:40017454-40017476 CTCAACACAAAAGCTAGGTTTGG - Intergenic
930144968 2:47992469-47992491 CTCCACACAGCACCCAGTTTAGG - Intergenic
932390904 2:71390008-71390030 CTCCACACAGAAAACAATTTGGG - Intronic
936175424 2:110215784-110215806 CTCAATACAGCAGCCAGAATGGG + Intergenic
936394230 2:112108367-112108389 ATCTAAACAGAAACCAGATGGGG - Intronic
936987186 2:118322672-118322694 CTAGAGACAGAAACCATATTAGG - Intergenic
938046822 2:128129024-128129046 CTCAACACATCAAACAGACTGGG - Exonic
939597893 2:144150133-144150155 TTTAACACAGACACCAGTTTGGG + Intronic
939994706 2:148909073-148909095 GCCAAAACAGAAACCAGATCAGG + Intronic
940905780 2:159168116-159168138 CTTAACCCATAAACCAAATTAGG + Intronic
941758690 2:169216890-169216912 TTCATCACAGAAATCAGGTTAGG - Intronic
942905491 2:181175380-181175402 CTGAACACTGAAACCACATCAGG - Intergenic
944191593 2:197009824-197009846 CTCAACACAGGAACTAGAAAAGG - Intronic
947265285 2:228272834-228272856 CTCAATAGAGAGACCACATTTGG - Intergenic
947983424 2:234428808-234428830 CTCAACACAGAAACCAGCAAGGG + Intergenic
1169192891 20:3669197-3669219 CTGAGCCCAGAAACCTGATTAGG + Intronic
1170592776 20:17783546-17783568 CTCAAAACACAAAACAGATGAGG - Intergenic
1172327889 20:34051299-34051321 CCCAAAACAGAACCAAGATTTGG + Intronic
1173023917 20:39290093-39290115 TTCAAGACAGAAACCTCATTTGG - Intergenic
1174884215 20:54314357-54314379 CACAAAACAGGAACCAGATAAGG - Intergenic
1174954481 20:55081896-55081918 CCCAGAAGAGAAACCAGATTTGG - Intergenic
1176678883 21:9806951-9806973 CTCCACACAGAAACCAGTCATGG - Intergenic
1178591709 21:33916395-33916417 CTCAACTCCGAAAGCAGAATGGG + Intergenic
1178940398 21:36900612-36900634 CTCAACACAGGAGTCAGAGTGGG - Intronic
1178995886 21:37399221-37399243 ATCCACACACAATCCAGATTTGG - Intronic
1182189202 22:28442135-28442157 CTCAACAAAGGAGCCATATTAGG + Intronic
1183184740 22:36285485-36285507 CCCAACACAGAAGCCAGAGGGGG + Intronic
953609460 3:44435403-44435425 CTCAGCACTGAAACCACATGTGG + Intergenic
954622955 3:52006084-52006106 CCCAGCACAGACACCGGATTTGG + Intergenic
955948798 3:64221546-64221568 ATCAACAAAGAAAACAGATTTGG + Intronic
956983507 3:74668705-74668727 ACCATCACAGAAACCAGGTTTGG + Intergenic
959682396 3:109110325-109110347 GTCAGCAAAGAAAACAGATTTGG + Intronic
960150675 3:114245836-114245858 CTCCACACAGAATCCACACTGGG + Intergenic
961153399 3:124658726-124658748 CTCAAATCAGAACCCAGACTGGG - Intronic
962810295 3:138953713-138953735 CTCAAAAGGGAAACCATATTTGG + Intergenic
963730706 3:148968406-148968428 CTCAACACATCAACCATATGTGG - Intergenic
964054002 3:152429646-152429668 CTAATCAGAGAAATCAGATTAGG - Intronic
964361191 3:155898704-155898726 ATCATCACAGAAACCAAAGTTGG - Intronic
967683312 3:192390883-192390905 CTCAAGACACAAAGCAGATTGGG + Intronic
970683900 4:18543412-18543434 CAGAACACAAAAACCATATTGGG + Intergenic
972070150 4:35009131-35009153 CTCCACACATAAACCTGAGTAGG - Intergenic
972160735 4:36223696-36223718 CTAAAAACAGAAACCAGAGATGG + Intronic
974807949 4:66905692-66905714 CTCAACACAGAAAGAAGGTCTGG + Intergenic
975960199 4:79893956-79893978 CTCAACAAAGAAACTAAAATGGG - Intergenic
978832690 4:113107854-113107876 CCCAACATAGAACCCAAATTAGG + Intronic
983308103 4:166019935-166019957 CTCAATACAGAAATAAGGTTAGG + Intronic
985363000 4:189195207-189195229 CTCAACACAGAGATTAGTTTTGG - Intergenic
985396665 4:189551993-189552015 CTCCACACAGAAACCAGTCATGG + Intergenic
986851211 5:11816348-11816370 GAGAACACAGAAACCAGATGTGG + Intronic
989544099 5:42652448-42652470 CTTAACACAGTAACCAATTTTGG - Intronic
992318881 5:75590608-75590630 CTCATCACAGACTCCAGATATGG - Intronic
992483719 5:77175985-77176007 CTCATCAGTGAAACCAGAATGGG + Intergenic
993289877 5:86053214-86053236 CTCAAAACAGAAAGCAGAAGGGG - Intergenic
994280505 5:97896881-97896903 CTCAACTAAGAAACAAGATCTGG + Intergenic
996618454 5:125470186-125470208 CTCAACAGACAAAGCAGATTTGG + Intergenic
998983768 5:147732460-147732482 ATCAACACAGAAAACAGAGATGG + Intronic
999711980 5:154326697-154326719 ATGAACACAGAAAGCAGATTAGG + Intronic
1000375285 5:160575278-160575300 TTCAGCACAGAATCCAGTTTAGG + Intronic
1001244104 5:170092877-170092899 CTCCACCCAGCAACCAGAATCGG - Intergenic
1001393474 5:171399567-171399589 TTCTACAGAGAAACCAGCTTGGG + Intronic
1003516987 6:6825861-6825883 CTCAACCCAGGAACGGGATTAGG + Intergenic
1005691569 6:28311680-28311702 CACAACACAGAAACCACATCAGG - Intergenic
1008455925 6:51710762-51710784 CTCATCACAAAAACCAAATGAGG + Intronic
1011035155 6:82966212-82966234 ATAAAGACAGAAAGCAGATTAGG + Intronic
1014278100 6:119410184-119410206 CTCCAAACAGAAACCTGATTTGG - Intergenic
1014955665 6:127612613-127612635 CTCAACAGAGAAGCTGGATTTGG + Intergenic
1019410111 7:903039-903061 CTCCACCCAGGAACCAGATGAGG + Intronic
1019526050 7:1480994-1481016 CTCTCCACAGAAACCAGAGTTGG + Intronic
1020585307 7:10058466-10058488 CTAAACACAGAGGGCAGATTCGG + Intergenic
1021543614 7:21788700-21788722 CTCAACACAGAAAGGAGGGTGGG - Intronic
1022990339 7:35701011-35701033 CTCAACTGCTAAACCAGATTAGG - Intergenic
1023591755 7:41787906-41787928 AGCAACTCAGAAACCAGTTTAGG - Intergenic
1027290115 7:76697993-76698015 CTCAAGACAAAGACCAAATTGGG - Intergenic
1027847768 7:83405231-83405253 CTATAAACAGAAACAAGATTTGG + Intronic
1030306621 7:108025768-108025790 TTCAACATTGAAACCATATTTGG + Intronic
1030614063 7:111719262-111719284 CTCAACAAAGTAAACAGAATGGG - Intergenic
1032587452 7:133160384-133160406 CTCAGCACAGAACCCAGTATGGG + Intergenic
1035172222 7:157023188-157023210 CTGGACACAGAGACCAGAGTGGG + Intergenic
1036520468 8:9487017-9487039 CTCAAAACAAAATCCAGGTTTGG + Intergenic
1037363682 8:18100137-18100159 CTCTGCTCAGAAGCCAGATTAGG + Intergenic
1039046537 8:33455521-33455543 CTCAACAAAAAAACAAGATTTGG + Intronic
1041829071 8:62132393-62132415 CTCAACACAACAACCTTATTAGG - Intergenic
1051175361 9:14354683-14354705 CTCACCTCAGAAACTAGATTTGG - Intronic
1052232412 9:26169866-26169888 CTCAGCACAGAATCCAGAATAGG + Intergenic
1052688682 9:31786379-31786401 ATGAACACAGAAAATAGATTAGG - Intergenic
1055273659 9:74589816-74589838 CTAACCACAGACACCAGGTTGGG + Intronic
1055439260 9:76322659-76322681 TTCAACACAGAAAGCAGTTTAGG - Intronic
1058605148 9:106713403-106713425 TTCACCACAGAAACCAGAGACGG - Intergenic
1059406843 9:114104973-114104995 CTCATCAAAGAAACAAGTTTTGG - Intergenic
1203664054 Un_KI270754v1:9487-9509 CTCCACACAGAAACCAGTCATGG - Intergenic
1188346572 X:29073929-29073951 CTTAAAACTGAAACCAGATTTGG - Intronic
1190558850 X:51667587-51667609 CTTGACACAGAAACTAGATAAGG + Intergenic
1193328145 X:80206490-80206512 CTCAAAACAGAAACCCGTTTGGG + Intergenic
1193588486 X:83357671-83357693 CTCAACATTCAAACCACATTTGG - Intergenic
1195006885 X:100693991-100694013 ATCAAGACAGAAAGCATATTAGG + Intronic
1196925008 X:120624971-120624993 CTCCACACTGAAAACAGATATGG + Intergenic
1197378442 X:125710081-125710103 CTCAACACAGAAAGCACCCTGGG - Intergenic
1197948232 X:131863571-131863593 ATCAACACAGAAAACACAGTAGG - Intergenic
1200255203 X:154577819-154577841 CTCAAATCAGACACTAGATTTGG - Intergenic
1200262566 X:154626585-154626607 CTCAAATCAGACACTAGATTTGG + Intergenic
1200701883 Y:6409479-6409501 CTCTACATAGAAATCAGAGTAGG + Intergenic
1201032228 Y:9755219-9755241 CTCTACATAGAAATCAGAGTAGG - Intergenic