ID: 914675421

View in Genome Browser
Species Human (GRCh38)
Location 1:149904218-149904240
Sequence TCAACACAGAAACCAGATTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675416_914675421 -9 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
914675415_914675421 0 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
914675413_914675421 9 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222
914675412_914675421 10 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG 0: 1
1: 0
2: 3
3: 23
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675421 Original CRISPR TCAACACAGAAACCAGATTA GGG Exonic
901367458 1:8765299-8765321 TAAAGACAGAAAGAAGATTAAGG + Intronic
902123969 1:14192993-14193015 TCAAAAGAGAGACCAGATGAAGG + Intergenic
905154598 1:35965189-35965211 TCACCTAAGAAACCAGATTTTGG + Intronic
907286301 1:53382558-53382580 TCAACACAAAAACCAGCCTCTGG - Intergenic
907340976 1:53736134-53736156 TCACCAGAGAGACCAGCTTAAGG + Intergenic
907543431 1:55237866-55237888 TCAAGACAGAAATGATATTATGG + Intergenic
907711438 1:56886201-56886223 TCAACACAGACACCAGGTCATGG + Intronic
909174471 1:72338661-72338683 TCAAAACAAAAAACAGATTCTGG + Intergenic
910359167 1:86397164-86397186 TCAAGAGAGAAACCAGGTGAAGG + Intergenic
910359177 1:86397225-86397247 TCAAGAGAGAGACCAGATGAAGG + Intergenic
910929438 1:92428320-92428342 TCAAAACAGAATTCAAATTAGGG + Intergenic
911949213 1:104151471-104151493 AAAACACAGAAATCAGTTTAAGG - Intergenic
912450323 1:109764222-109764244 TCACCACAGAACCCAGACTCTGG - Intronic
913327901 1:117643597-117643619 TCCACACAGAAACCTGCATATGG - Intergenic
914376142 1:147075661-147075683 TCAGCACAGAGTCCAGATTTTGG + Intergenic
914505597 1:148286548-148286570 TCAGCACAGAGTCCAGATTTTGG + Intergenic
914506966 1:148297603-148297625 TCAGCACAGAGTCCAGATTTTGG - Intergenic
914675421 1:149904218-149904240 TCAACACAGAAACCAGATTAGGG + Exonic
921124415 1:212164329-212164351 TCAGCACAGGATCCAGAGTAGGG + Intergenic
921128040 1:212195573-212195595 TCAAGACAGAAGCCTGCTTATGG + Intergenic
921359985 1:214322504-214322526 TCAACACAAAAAGCAGAAAATGG - Intronic
921603240 1:217129763-217129785 TAGAGACAGAAAGCAGATTAAGG + Intronic
921824534 1:219657604-219657626 TCAAAACATAAGCAAGATTATGG - Intergenic
922727986 1:227933881-227933903 TCAAGACAGAAAGCGGATCAGGG - Intronic
924764935 1:247023733-247023755 TAAATACAGAAAGCAGATCAGGG - Intergenic
1064151748 10:12871418-12871440 ACAAGACAGAAACCAGAATCCGG + Intergenic
1064184390 10:13148330-13148352 TCAACAGAGAAACCAGAAGCTGG + Intergenic
1065208765 10:23382337-23382359 TCCACACAGAAACAAGGTGAGGG + Intergenic
1068364761 10:56033155-56033177 TCAACACTGAAAACAGGCTATGG + Intergenic
1070063375 10:73008398-73008420 TCAACACCAAAACCGGATAAAGG + Intronic
1070439429 10:76428775-76428797 TGAACAAAGAAACCATATTCAGG + Intronic
1071250113 10:83809279-83809301 TCAGCAAAGAAACCAGAGTCAGG + Intergenic
1072811017 10:98461898-98461920 CCAATAAAGAAACCAGAATAGGG - Intronic
1073581859 10:104675539-104675561 TCAACACATAAAACAAATTCTGG - Intronic
1074233115 10:111557373-111557395 TCAAGACAGCAACCAGCTTGAGG - Intergenic
1074792886 10:116909686-116909708 TCAACTCAGAAAATAGAATAGGG + Intronic
1078556603 11:12332108-12332130 TCAACAAAGATAGCAGACTATGG + Intronic
1078876033 11:15398308-15398330 TCATCACAGAAACAGAATTAAGG - Intergenic
1081046126 11:38275927-38275949 TAAACACAAAAACAAGATAATGG - Intergenic
1087707948 11:101516478-101516500 TTAACATAAAAACCAGATAATGG - Intronic
1087895475 11:103581026-103581048 CAAACAGAGAAACCAGATTAGGG - Intergenic
1088559868 11:111103264-111103286 TTAACATAGAAACAAGATAAAGG - Intergenic
1088659439 11:112030786-112030808 TCTACAAATAAACTAGATTAAGG - Intronic
1089246102 11:117121276-117121298 TAAAAACAGAAAGTAGATTAGGG + Intergenic
1090114795 11:123957118-123957140 TCAACCCAGAAATCCCATTATGG - Intergenic
1090479686 11:127057140-127057162 ACAACAAAGAACCCAGATTCTGG - Intergenic
1090686075 11:129121497-129121519 TAAACACAGAAAGAAGATTCTGG + Intronic
1090962482 11:131569445-131569467 TAAAGACAGAAAGCAGATTAGGG - Intronic
1092669530 12:10847334-10847356 TCAAGTCAGAGACCAGATCAGGG - Exonic
1092873665 12:12830126-12830148 TCAACAAGGAAACGAGATGATGG + Intergenic
1092932441 12:13329015-13329037 TCAAGACAGACCCCAGTTTAAGG - Intergenic
1093991780 12:25597039-25597061 TCAAAACAAAAAACAGATAATGG + Intronic
1094003386 12:25720684-25720706 TCAACCCAGCAACTAGACTAGGG + Intergenic
1094799680 12:34018786-34018808 TCAACAGAGAGACCAGATGGAGG - Intergenic
1096442272 12:51653359-51653381 TAAAGACAGAAAGCAGAATAGGG - Intronic
1096470486 12:51872320-51872342 GCAGCACAGGAACAAGATTAAGG - Intergenic
1096591462 12:52662656-52662678 TTAGCACAGATACCAGAGTAGGG - Intergenic
1097356428 12:58607477-58607499 TCAACACAGCAGCCAGAGTGAGG + Intronic
1098890207 12:76002636-76002658 TTGACTCAGAAATCAGATTATGG + Intergenic
1099083678 12:78218403-78218425 GCTACACAGAAGCCAGATTTTGG + Intergenic
1100649520 12:96569718-96569740 TCAACACAGAATCTAATTTATGG + Intronic
1100662367 12:96714042-96714064 TCAATACAGAAACCAGAGTTAGG - Intronic
1101294597 12:103408188-103408210 TGAACATAGAAACTAGATTCTGG + Intronic
1102107480 12:110337703-110337725 TCACCACATTAACCAAATTAAGG + Intronic
1103707393 12:122884664-122884686 TCAAAAAAAAAACCAGCTTACGG + Intronic
1104120964 12:125799699-125799721 TGAACAAAGAAACCAGATTTAGG + Intergenic
1105774966 13:23650549-23650571 TAGAGACAGAAAACAGATTAGGG + Intronic
1110732176 13:78891368-78891390 TAGAGACAGAAAGCAGATTAGGG + Intergenic
1113502284 13:110785788-110785810 TAGACACAGAAAGCAGATTAGGG + Intergenic
1114379652 14:22188446-22188468 TAGAGACAGAAAGCAGATTAAGG - Intergenic
1115831188 14:37343468-37343490 TCAAAACAGAAACCAAACTTTGG - Intronic
1116898800 14:50342236-50342258 TCAAAACAAAAACAATATTAAGG + Intronic
1118551967 14:66962205-66962227 TCAACACAGATACTAGAAAAAGG - Intronic
1120389205 14:83883863-83883885 TGAACACAGGAACCAGTTCAAGG + Intergenic
1120647053 14:87086789-87086811 TCAACACAGAAAACAGATTTTGG - Intergenic
1120660780 14:87248715-87248737 GCAACACTGAAACCAAAATAGGG + Intergenic
1120891280 14:89493530-89493552 TCAACACAGATACCAGCAAATGG + Intronic
1123485627 15:20735183-20735205 TCATCACAGATACCAGAATCTGG - Intergenic
1123542112 15:21304234-21304256 TCATCACAGATACCAGAATCTGG - Intergenic
1125672362 15:41483290-41483312 TCAACACTGAAACCACACTGTGG - Exonic
1128707621 15:69849107-69849129 TGCACACAGAATCCAGATAAGGG + Intergenic
1131510494 15:93047253-93047275 CCAACCCAGAAACCTGCTTAGGG - Intronic
1132035881 15:98484099-98484121 TAGAGACAGAAAGCAGATTATGG + Intronic
1202950430 15_KI270727v1_random:31374-31396 TCATCACAGATACCAGAATCTGG - Intergenic
1133087641 16:3377446-3377468 TCTACCCAGAAACCAAGTTACGG + Intronic
1133535386 16:6697583-6697605 CCAACACAGAAACCAGTTCCAGG - Intronic
1135376399 16:21951064-21951086 TCTACGCAGAAACCAGTTCAAGG + Intergenic
1138035334 16:53599603-53599625 GCCACACAGATACCAGCTTAAGG - Intronic
1138464605 16:57179717-57179739 AGAACACAGAAACCTGATTCTGG - Intronic
1140072793 16:71666946-71666968 ACAACACAGAAACCTCTTTAAGG + Intronic
1140303297 16:73779124-73779146 GGAACACAGAAACCAGCATATGG + Intergenic
1143687108 17:8526268-8526290 TCAAAGCAGAAACCAGAGAAAGG + Intronic
1143720695 17:8807054-8807076 TAAAAACAGAAACCACTTTAAGG + Intronic
1143964009 17:10743227-10743249 TCACAAAGGAAACCAGATTAGGG - Intergenic
1145877762 17:28332590-28332612 ACAACACAAAAACCAAATAAAGG + Intronic
1146260970 17:31420617-31420639 TCAAAAAAAAAACCAGATTTGGG + Intronic
1146589293 17:34114654-34114676 TCAACACAGAAACATTATTCTGG - Intronic
1148585201 17:48773378-48773400 TCTAAAGAGAAACCAGAGTATGG - Intronic
1151243754 17:72778517-72778539 TCAATACAGAAATTAAATTAAGG - Intronic
1151968719 17:77445974-77445996 CCAACACAGAACCCCGAGTAGGG + Intronic
1154037344 18:10816008-10816030 ACAACACAGGTACCGGATTACGG + Intronic
1154282556 18:13017996-13018018 TCAGGAGAGAAAACAGATTATGG - Intronic
1155255179 18:23990362-23990384 TAATGACAGAAAGCAGATTAGGG + Intergenic
1156758226 18:40554694-40554716 TCAAGACAGAAACAAGAATATGG + Intergenic
1157732675 18:50017936-50017958 TAAACACAGAAACGAATTTAGGG + Intronic
1158740951 18:60141375-60141397 TGAACACAGACACAAGTTTAAGG - Intergenic
1158922790 18:62212462-62212484 TCAAAACAGAAATCACATTATGG - Intronic
1159826801 18:73222953-73222975 TGAACACAGAAGACAGATTGAGG - Intronic
1159983482 18:74813984-74814006 CCAACACAGAAAGCAGATAATGG - Intronic
1160048518 18:75409519-75409541 TTCACAAAGAAACCAGCTTATGG - Exonic
1163985714 19:20948314-20948336 TCAAGACAGAAACCAGTGTCTGG + Intronic
1164194283 19:22941425-22941447 TCAAAACTGAAGCCTGATTAAGG + Intergenic
1165376449 19:35446162-35446184 TAGGCACAGAACCCAGATTAGGG + Intronic
1166335602 19:42104954-42104976 TCATCTCAGAATCCAGCTTAAGG + Intronic
1167216328 19:48167939-48167961 TTCACACAGAAAGCAGGTTAGGG + Intronic
931412277 2:62044436-62044458 TCAACACAGAAATCAGTAAAAGG - Intronic
931417787 2:62097909-62097931 ACAACTCAAAAACCAGAATAGGG - Intronic
931647526 2:64438129-64438151 ACAAAACAGAAACCTGACTATGG + Intergenic
934792397 2:97072575-97072597 TCAATATAGAAACCAGTTTCTGG + Intergenic
934814222 2:97311134-97311156 TCAATATAGAAACCAGTTTCTGG - Intergenic
934823472 2:97397349-97397371 TCAATATAGAAACCAGTTTCTGG + Intergenic
935517959 2:104067218-104067240 TAAATACAGAAAGTAGATTAAGG + Intergenic
936394229 2:112108366-112108388 TCTAAACAGAAACCAGATGGGGG - Intronic
936987185 2:118322671-118322693 TAGAGACAGAAACCATATTAGGG - Intergenic
940125439 2:150317757-150317779 AGAACACAGAAACCATACTAGGG + Intergenic
940657504 2:156506790-156506812 TCAGCTGAGAAATCAGATTAAGG - Intronic
942296847 2:174526133-174526155 TCAACACAAAAAAAAGTTTAAGG + Intergenic
942855602 2:180543204-180543226 TCACAAAAGAAACCAAATTATGG + Intergenic
943107689 2:183567000-183567022 TAAAAACAGAAAACAGATCATGG - Intergenic
943424895 2:187719206-187719228 TCAAAACATACACCAGTTTATGG + Intergenic
944610144 2:201395175-201395197 TTAAAACAGCAATCAGATTAGGG + Intronic
945722297 2:213432973-213432995 TCATCACACAAACAAAATTAAGG + Intronic
946507145 2:220313930-220313952 TCTTCACTGAAACCAGATTGAGG + Intergenic
947367289 2:229409763-229409785 TCTTCACAGAAACCTGATTACGG + Intronic
948644309 2:239394064-239394086 GCAACACATAAACCAGATGATGG + Intronic
1169192892 20:3669198-3669220 TGAGCCCAGAAACCTGATTAGGG + Intronic
1169665353 20:8028348-8028370 TCAACACAGTAACCATTTGAAGG - Intergenic
1173023916 20:39290092-39290114 TCAAGACAGAAACCTCATTTGGG - Intergenic
1174935240 20:54860705-54860727 ACAACAGAGAAACAAGATCAGGG - Intergenic
1175541218 20:59748921-59748943 TCAGCACACAAACCCGATTGTGG + Intronic
1175846290 20:62060685-62060707 TCAAAAGAAACACCAGATTAAGG + Intronic
1177217180 21:18145747-18145769 GGGACAAAGAAACCAGATTATGG + Intronic
1178465863 21:32847124-32847146 TCAAAAGATAAACCAGGTTACGG + Intergenic
1178784047 21:35635822-35635844 TAGAGACAGAAAACAGATTAGGG + Intronic
1184482177 22:44754108-44754130 TCTACACAGAAGCCAGACTCTGG - Intronic
951784670 3:26404176-26404198 TCTACAGAGAAAGCAGATAATGG - Intergenic
952214539 3:31264358-31264380 CCAACATAGTAACAAGATTATGG - Intergenic
955280703 3:57591869-57591891 TAGAAACAGAAAACAGATTACGG + Intronic
955934967 3:64094035-64094057 TCAACACAGAACACAGACTCTGG + Exonic
956258727 3:67313294-67313316 TCAACTCAGAAAACAGTTCAGGG - Intergenic
956533274 3:70245619-70245641 TCTACAAAGAAATCAGAATATGG + Intergenic
957878259 3:86176782-86176804 TAAACACAGAAAAAAGATGATGG - Intergenic
962571474 3:136717707-136717729 ACAACACAGAAAAGAGATGATGG + Intronic
963046851 3:141108962-141108984 TCAGCAAAGAGACCAGATCATGG + Intronic
963183198 3:142382503-142382525 TAAACACAGGAACCAGGTTGAGG - Intronic
964361190 3:155898703-155898725 TCATCACAGAAACCAAAGTTGGG - Intronic
964649769 3:158997454-158997476 CCAACACAGAAGGAAGATTAAGG - Intronic
964935484 3:162079956-162079978 TCAATTCAGAAACTAGATTGTGG + Intergenic
967001665 3:185341549-185341571 TTAACACAGAAAGCAGAATGTGG - Intronic
971165348 4:24176862-24176884 TCTGCACAGAAACCAGTTAAAGG + Intergenic
972135494 4:35887931-35887953 TCAAGACATAAATCAGATTATGG + Intergenic
973269626 4:48249103-48249125 TCCAAAGAGAAACCAGTTTATGG + Intronic
974920539 4:68233827-68233849 TCATGACAGAAAGCAGATTTAGG - Intronic
975005999 4:69286944-69286966 TCTACACAGAAAGAATATTAAGG + Intronic
977176087 4:93821496-93821518 TCTCCACAGTAACCATATTATGG - Intergenic
978290236 4:107129290-107129312 TGAACAGAGAATCCTGATTAAGG - Intronic
978685821 4:111441965-111441987 TCAACACAAAAACCTGCATATGG + Intergenic
980597650 4:134975679-134975701 TCAAAATAGAAACAACATTATGG + Intergenic
980857949 4:138463135-138463157 TCCCCACTGAAACCAGAATAAGG + Intergenic
982088375 4:151859503-151859525 TCTACACTAAAACCTGATTATGG - Intergenic
982486522 4:155972683-155972705 TCAACACAGTAGCCAGAGTCTGG - Intergenic
982492291 4:156044425-156044447 ACAACACAGGAAACAGATGATGG + Intergenic
983168045 4:164501565-164501587 ACAGCAGAGAAACAAGATTAAGG + Intergenic
983615035 4:169694389-169694411 TCAACACAGCAGCCTGACTATGG + Intronic
986277701 5:6293716-6293738 TCAACACAGATACCAAACAATGG - Intergenic
987074005 5:14363514-14363536 TGGACACAGAAGCCAGATGAAGG - Intronic
988497091 5:31754492-31754514 TCTCCACAGAAACCAAATTGTGG - Intronic
989447644 5:41549385-41549407 TCAACAATGAAACAAGATTTTGG + Intergenic
990457987 5:56006322-56006344 TGCACACAGAAATCAGATTAAGG - Intergenic
993569374 5:89518176-89518198 TCAGCACATAAACCAACTTACGG + Intergenic
997878079 5:137566764-137566786 TAAACACAGAAACATGATTTAGG - Intronic
998029273 5:138851139-138851161 TCTACACAGAAACCATTTTGTGG - Intronic
999517426 5:152315144-152315166 TTAAAACACAAATCAGATTATGG - Intergenic
999711981 5:154326698-154326720 TGAACACAGAAAGCAGATTAGGG + Intronic
999911169 5:156201534-156201556 TTAACAGAGAAACCAGTTTATGG + Intronic
1000375286 5:160575279-160575301 TCAGCACAGAATCCAGTTTAGGG + Intronic
1001300813 5:170532381-170532403 TCAACACAGAAAGAAGACTGAGG - Intronic
1001393475 5:171399568-171399590 TCTACAGAGAAACCAGCTTGGGG + Intronic
1002651255 5:180697218-180697240 TCAACACAGCAATCCCATTATGG + Intergenic
1003516988 6:6825862-6825884 TCAACCCAGGAACGGGATTAGGG + Intergenic
1004115880 6:12767625-12767647 TACACCAAGAAACCAGATTAGGG + Intronic
1005027658 6:21478920-21478942 TCAGCCCAGAAAACAAATTACGG + Intergenic
1005812866 6:29529980-29530002 GCACCATAGAAACCAGTTTAAGG - Intergenic
1008138506 6:47804977-47804999 GCAACACAGAAAACAGCTTTTGG + Intronic
1008502961 6:52201683-52201705 TCAACACAGGAAGGAGAATAAGG + Intergenic
1009299521 6:61997113-61997135 TTAACACAGAAAACAAATAATGG - Intronic
1011035156 6:82966213-82966235 TAAAGACAGAAAGCAGATTAGGG + Intronic
1013941287 6:115666384-115666406 TCAACACAGAATACATATTGTGG - Intergenic
1014173258 6:118303002-118303024 TCAAAAAAGAAATCATATTATGG - Intronic
1014778283 6:125534807-125534829 TCAACACATAAACCAGGCTTTGG - Intergenic
1015941966 6:138461852-138461874 TCAAGACAGAAAATTGATTAGGG + Intronic
1018628189 6:165800548-165800570 TCATCACTGTAACCAGATTCTGG - Intronic
1020858465 7:13458177-13458199 TCACTACAGAAACGAGGTTAGGG - Intergenic
1021121470 7:16800573-16800595 TCCACACAGAAGCCAGAGTGAGG - Intronic
1023259391 7:38343323-38343345 TCTACACAGAAACTTCATTAAGG - Intergenic
1023259849 7:38347649-38347671 TCTACACAGAAACTTCATTAAGG - Intergenic
1023260321 7:38351980-38352002 TCTACACAGAAACTTCATTAAGG - Intergenic
1023260833 7:38356811-38356833 TCTACACAGAAACTTCATTAAGG - Intergenic
1023261814 7:38365935-38365957 TCTACACAGAAACTTCATTAAGG - Intergenic
1023319612 7:38979155-38979177 TTAACTCATAAACCAGACTATGG + Intronic
1023591754 7:41787905-41787927 GCAACTCAGAAACCAGTTTAGGG - Intergenic
1026347506 7:69487267-69487289 ACAATAAAGAAACCAAATTAAGG + Intergenic
1030355482 7:108537951-108537973 TCAACAGAAAATCCAGATTAAGG + Intronic
1030952330 7:115806471-115806493 TCATCACAGAAGCCAGAATAAGG - Intergenic
1032505903 7:132434485-132434507 TCAAGACACAAACCAGTTTGTGG + Intronic
1034051482 7:147988754-147988776 TCAGCAGAGAAACCAAATTACGG - Intronic
1034197578 7:149260140-149260162 TCTGCTCAGAAACCACATTATGG + Intergenic
1035221357 7:157408289-157408311 TGAACACAGAAACGTGATTTTGG - Intronic
1036659802 8:10700593-10700615 CCAAGACAGAGACCAGATGATGG - Exonic
1039137459 8:34341705-34341727 TCAACACATAAATGAGAGTAGGG - Intergenic
1039636304 8:39170356-39170378 TCAAAACAAAAACCAGATTAAGG + Intronic
1040423088 8:47259284-47259306 TCAACACAGACACCACAGTGAGG - Intergenic
1041817369 8:61989554-61989576 TCTTCACAGTAACCAGAATATGG + Intergenic
1042316746 8:67434124-67434146 AAAACACAGAAAGCACATTAGGG - Exonic
1042446149 8:68887502-68887524 TTTACAAAGAAACCAGAGTATGG - Intergenic
1042458044 8:69028751-69028773 TATACACAGGTACCAGATTAGGG - Intergenic
1042793948 8:72639509-72639531 GCAGAAAAGAAACCAGATTAAGG - Intronic
1044081005 8:87883863-87883885 TTAACACAGAAACTATAATATGG - Intergenic
1045101593 8:98850113-98850135 TCTACACAGAAACCAAAGTGCGG - Intronic
1045685767 8:104710016-104710038 TCAACACTGAAAACAGCTGAAGG - Intronic
1048653945 8:136514390-136514412 TCAACACTTCAGCCAGATTAAGG + Intergenic
1051284540 9:15482837-15482859 TAAGGACAGAAACTAGATTAAGG - Intronic
1052520590 9:29543437-29543459 TCCACATAGAAACCTGAATATGG - Intergenic
1056227618 9:84511395-84511417 CCAACAGAGAAAGCAGATAAAGG + Intergenic
1056263159 9:84869169-84869191 TCTCCACAGACTCCAGATTAAGG - Intronic
1060570618 9:124635828-124635850 TCTACACAGAAACCTGCATATGG - Intronic
1061549112 9:131322711-131322733 TAGAGACAGAAAGCAGATTAGGG - Intergenic
1186369188 X:8929442-8929464 TCAACAGAGAAGGGAGATTAGGG + Intergenic
1186780747 X:12909669-12909691 TGATCACTGAAACCAGATCATGG + Intronic
1187403439 X:18982849-18982871 ACAACAAAGAAAACAGATTAAGG + Intronic
1188187839 X:27137534-27137556 ACATCACAGAAACCAAATAACGG - Intergenic
1193667844 X:84345323-84345345 TGGAGACAGAAAACAGATTAGGG - Intronic
1195006886 X:100693992-100694014 TCAAGACAGAAAGCATATTAGGG + Intronic
1195767182 X:108308150-108308172 TCAAAAGAGAAGCCAGACTAAGG + Intronic
1196201473 X:112890795-112890817 TCAACAGAGAAAACAGAATTTGG - Intergenic
1199388165 X:147247541-147247563 AGAACACAAAAACCAGATTATGG + Intergenic
1199750362 X:150810524-150810546 TCACCTCAGAAACCAGAAAATGG + Intronic
1200701884 Y:6409480-6409502 TCTACATAGAAATCAGAGTAGGG + Intergenic
1201032227 Y:9755218-9755240 TCTACATAGAAATCAGAGTAGGG - Intergenic