ID: 914675422

View in Genome Browser
Species Human (GRCh38)
Location 1:149904219-149904241
Sequence CAACACAGAAACCAGATTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 661}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675412_914675422 11 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661
914675416_914675422 -8 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661
914675415_914675422 1 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661
914675413_914675422 10 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG 0: 1
1: 0
2: 6
3: 66
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675422 Original CRISPR CAACACAGAAACCAGATTAG GGG Exonic
900554546 1:3273207-3273229 CAACAAAGAAACCAGCGTTGGGG - Intronic
901386886 1:8916242-8916264 CAAGACAGAAAGCAGATCAGTGG + Intergenic
901417368 1:9127209-9127231 CAACACAGAAACCCCCCTAGAGG + Intronic
901457855 1:9373682-9373704 CGAGACAGAAAGTAGATTAGTGG - Intergenic
901505179 1:9680546-9680568 AGAGACAGAAAGCAGATTAGTGG - Intronic
902047235 1:13534635-13534657 AGAGACAGAAATCAGATTAGTGG - Intergenic
902095804 1:13944331-13944353 AGAAACAGAAAGCAGATTAGTGG + Intergenic
902441672 1:16434036-16434058 TAAGACAGAAAGTAGATTAGTGG - Intronic
903254388 1:22083832-22083854 AAACAAAGAAAGCAGATCAGTGG - Intronic
903644304 1:24884436-24884458 GGAGACAGAAAGCAGATTAGTGG - Intergenic
903745454 1:25583817-25583839 AGAGACAGAAAGCAGATTAGTGG - Intergenic
903948263 1:26978110-26978132 AAACAGAGAAACCAGATGAGTGG - Intergenic
904105029 1:28073004-28073026 AAGGACAGAAAACAGATTAGTGG + Intronic
904628837 1:31826312-31826334 CAACACAGGATTCATATTAGGGG - Intergenic
904668532 1:32143789-32143811 AAACTCAGAAAGTAGATTAGAGG - Intronic
905316648 1:37085933-37085955 AGAGACAGAAAGCAGATTAGTGG - Intergenic
905501674 1:38444577-38444599 AAACACAGAAACCAGATGTGTGG - Intergenic
905642272 1:39598747-39598769 AGAGACAGAAAGCAGATTAGTGG + Intergenic
905704957 1:40048402-40048424 TAACACAGAAACCAAATAACAGG - Intronic
906470237 1:46123625-46123647 AAACAGAGCAACCAGTTTAGAGG + Intronic
906861726 1:49367949-49367971 AGAGACAGAAAGCAGATTAGTGG - Intronic
907429460 1:54403862-54403884 CAACACAGAGACCAGACCTGCGG + Intronic
907535128 1:55145470-55145492 AAAGACAGAAAATAGATTAGAGG + Intronic
907568850 1:55464577-55464599 CAACACAGAGACCAGGAAAGAGG - Intergenic
907693766 1:56699786-56699808 AAACACAGAAAGTAGATTAGTGG - Intronic
908172467 1:61519675-61519697 AGACACAGAAAGAAGATTAGAGG - Intergenic
908582703 1:65532784-65532806 AAACACAGAAAGCAGATCAGTGG + Intronic
908677484 1:66621629-66621651 TAATACAGAAAGCAGATTGGAGG - Intronic
909491528 1:76232294-76232316 CAACACAGAAATAAGCTCAGAGG - Intronic
911215606 1:95189583-95189605 CAAGACAGAAAACAGAATAGTGG - Intronic
911593086 1:99770199-99770221 CAGGACATAAACCAGAATAGTGG - Intergenic
912264469 1:108142576-108142598 AGACATAGAAAGCAGATTAGAGG + Intronic
912782878 1:112569493-112569515 AAAGACAGAAAGTAGATTAGTGG + Intronic
912819184 1:112853633-112853655 AGAGACAGAAAGCAGATTAGTGG + Intergenic
912985679 1:114427554-114427576 AATGACAGAAATCAGATTAGTGG + Intronic
913298059 1:117341305-117341327 CAACAAACAAACCAGCTTACTGG - Intergenic
913676880 1:121149313-121149335 AAAGACAGAAAATAGATTAGTGG + Intergenic
914028773 1:143937265-143937287 AAAGACAGAAAATAGATTAGTGG + Intergenic
914675422 1:149904219-149904241 CAACACAGAAACCAGATTAGGGG + Exonic
914956140 1:152164365-152164387 AGAGACAGAAAACAGATTAGTGG - Intergenic
915219967 1:154366892-154366914 AGAAACAGAAAGCAGATTAGCGG + Intergenic
915386460 1:155498188-155498210 AAAGACAGAAAACAGAATAGTGG + Intronic
916141511 1:161703585-161703607 CATGACACAAAACAGATTAGTGG + Intergenic
916222529 1:162459293-162459315 CATGATAGAAAGCAGATTAGTGG + Intergenic
917234145 1:172872667-172872689 GGACACAGAAGCCAGATTAAAGG - Intergenic
917992576 1:180397245-180397267 AGAAACAGAAAGCAGATTAGTGG + Intronic
918055280 1:181015958-181015980 CTACAAAGAAAACAGATTTGTGG - Intronic
918402959 1:184182102-184182124 AAAGACAGAAAGTAGATTAGTGG + Intergenic
919880959 1:201900307-201900329 GAACACAGACACCAGAAAAGAGG - Exonic
920324338 1:205150549-205150571 CAAGGGAGAAACCAGATCAGGGG - Intronic
920464237 1:206168155-206168177 AAAGACAGAAAATAGATTAGTGG + Intergenic
920723174 1:208408699-208408721 AGAGACAGAAAGCAGATTAGCGG + Intergenic
921888533 1:220330449-220330471 AGAAACAGAAAGCAGATTAGTGG - Intergenic
922090387 1:222390054-222390076 CCAAACAGAAACCAGATTCGTGG - Intergenic
922463036 1:225827600-225827622 GGACACAGAAAGTAGATTAGAGG + Intronic
922500353 1:226092868-226092890 CAAAAAAGAAACTAGATTAAAGG + Intergenic
924165668 1:241279743-241279765 AGAAACAGAAAGCAGATTAGTGG - Intronic
924309859 1:242728909-242728931 CTAAACAGAAAGTAGATTAGTGG - Intergenic
924827708 1:247558549-247558571 CAAAACAGAAATCAGATCAGTGG - Intronic
1063156388 10:3383216-3383238 AAAAACAGAAAGTAGATTAGTGG + Intergenic
1063234543 10:4099277-4099299 AAACACAGAAAACTGATGAGGGG - Intergenic
1064494087 10:15889403-15889425 CAACACATAAAGCATATGAGAGG + Intergenic
1065208767 10:23382338-23382360 CCACACAGAAACAAGGTGAGGGG + Intergenic
1065632240 10:27692067-27692089 CAACACAGCAATCCCATTAGTGG - Intronic
1065786642 10:29221928-29221950 CGACTCAGCAACCAGATGAGAGG - Intergenic
1066016321 10:31247652-31247674 AAACACAGAAAGAAGAATAGTGG - Intergenic
1066108406 10:32175741-32175763 CAAGACAGAAAGTGGATTAGAGG + Intergenic
1067411372 10:46067647-46067669 AAAGACAGAAAGTAGATTAGTGG + Intergenic
1067453901 10:46400003-46400025 AAACAGTGAAAACAGATTAGTGG + Intergenic
1067583295 10:47459271-47459293 AAACAGTGAAAACAGATTAGTGG - Intergenic
1067633300 10:47984624-47984646 AAACAGTGAAAACAGATTAGTGG - Intergenic
1067770835 10:49123181-49123203 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1067981502 10:51091406-51091428 AAATACAGAAAGCAGATTAGTGG - Intronic
1068108528 10:52651023-52651045 CAATACAGAATCCAGTTCAGAGG - Intergenic
1068132400 10:52911052-52911074 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1068448533 10:57155705-57155727 GAAGACAGAAATAAGATTAGTGG - Intergenic
1068686475 10:59875199-59875221 AAGCACATAAACCAGAATAGAGG + Intronic
1068737908 10:60435694-60435716 AAAGACAGAAAGTAGATTAGTGG - Intronic
1068931946 10:62599844-62599866 GCACACAGAAAGTAGATTAGTGG + Intronic
1069083694 10:64115236-64115258 CAAGACAAGAACCAGATCAGAGG + Intergenic
1069257901 10:66357519-66357541 AAGCACAGAAAGCAGATTAGTGG - Intronic
1069540091 10:69287565-69287587 AGACACAGAAAGTAGATTAGTGG + Intronic
1069671836 10:70212656-70212678 AAAGACAAAAAGCAGATTAGTGG + Intronic
1070072851 10:73106087-73106109 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1070099142 10:73368481-73368503 AGAGACAGAAACTAGATTAGTGG + Intergenic
1070186470 10:74067792-74067814 TGAGACAGAAAGCAGATTAGCGG + Intronic
1070344352 10:75527059-75527081 AGAGACAGAAAGCAGATTAGTGG - Intronic
1070572003 10:77646965-77646987 GAACCCAGAAACCAGTTTATTGG - Intergenic
1070625960 10:78051273-78051295 AAAAACAGAAAACAGATTTGTGG - Intronic
1071219671 10:83450560-83450582 CAACTAAGAGACCAAATTAGTGG + Intergenic
1071537283 10:86444628-86444650 AGACACAGAAAGTAGATTAGTGG + Intronic
1071798638 10:89032553-89032575 TAAGACAGAAATCAGATTAGTGG - Intergenic
1072089314 10:92111636-92111658 CAAGACAAAAAATAGATTAGTGG + Intronic
1073914486 10:108386381-108386403 CACCACAGGAACCAGTTTCGTGG - Intergenic
1074139143 10:110656399-110656421 AAACAAAGAAAGCAGATCAGTGG - Intronic
1074225829 10:111483498-111483520 GTACACAGAAAGCAGATAAGGGG - Intergenic
1074792887 10:116909687-116909709 CAACTCAGAAAATAGAATAGGGG + Intronic
1075224989 10:120620752-120620774 AAACACAAAACCCAGGTTAGAGG - Intergenic
1075716061 10:124556093-124556115 GAACACAGACACAAGTTTAGGGG - Intronic
1076002218 10:126921514-126921536 AGGCACAGAAAGCAGATTAGTGG + Intronic
1076017636 10:127040938-127040960 CGAGACAGGAAGCAGATTAGTGG - Intronic
1076501577 10:130941025-130941047 CAACACAGACACAAGACGAGAGG + Intergenic
1076908548 10:133376012-133376034 AGAGACAGAAACTAGATTAGCGG + Intergenic
1077810949 11:5636326-5636348 TAATATAGAAACTAGATTAGTGG + Intronic
1078279777 11:9889797-9889819 AGAGACAGAAAGCAGATTAGTGG + Intronic
1078371054 11:10745506-10745528 TCACACAGAAACAGGATTAGAGG - Intergenic
1079373987 11:19875593-19875615 AGAAACAGAAAGCAGATTAGTGG + Intronic
1079646979 11:22876915-22876937 CATGAAAGAAAACAGATTAGAGG - Intergenic
1080003514 11:27379121-27379143 AAAGACAGAAACAAGATTTGGGG - Intronic
1081107883 11:39094672-39094694 AAAAAAAGAAACCAGATTAATGG - Intergenic
1082892314 11:58153185-58153207 GGAAACAGAAACCAAATTAGAGG + Intronic
1082995743 11:59253759-59253781 CAAGACAGAAAGAGGATTAGTGG - Intergenic
1084152145 11:67292843-67292865 AGACACAGAAAGTAGATTAGTGG - Intronic
1084159430 11:67337876-67337898 ATAGACAGAAAGCAGATTAGTGG + Intronic
1084732142 11:71080490-71080512 CAGCACAGCAACCAGAGCAGCGG + Intronic
1084914364 11:72417393-72417415 AGAAACAGAAAGCAGATTAGTGG + Intronic
1084994955 11:72967571-72967593 AGAGACAGAAAGCAGATTAGTGG + Intronic
1085586158 11:77708616-77708638 CAAGACAGAAACAAGAATAAAGG + Intronic
1086563543 11:88197226-88197248 CAACAGAAAAATCATATTAGAGG - Intergenic
1087621301 11:100546027-100546049 AAACACAGAAGGCTGATTAGTGG - Intergenic
1087803984 11:102535741-102535763 CACTATAGAAACCAGTTTAGTGG - Intergenic
1088752174 11:112853225-112853247 TAACACAGATACCAGAGTTGGGG - Intergenic
1090060413 11:123459858-123459880 GTACACAGAAAACAGATGAGAGG - Intergenic
1090156981 11:124448731-124448753 CTACACAGAAACCACACTATTGG + Intergenic
1090743541 11:129689223-129689245 AGAGACAGAAAGCAGATTAGAGG + Intergenic
1090819192 11:130325826-130325848 AAAGGCAGAAAGCAGATTAGTGG - Intergenic
1090962481 11:131569444-131569466 AAAGACAGAAAGCAGATTAGGGG - Intronic
1091481885 12:841290-841312 AGAGACAGAAAGCAGATTAGTGG - Intronic
1093263414 12:16969654-16969676 TAACACAGAAAGCAGCTGAGAGG - Intergenic
1093698968 12:22196263-22196285 CACCAGAGAAAACAAATTAGAGG + Exonic
1093726167 12:22511367-22511389 CAAAACAGAAACCATACTAATGG + Intronic
1093796914 12:23323317-23323339 GGAGACAGAAAGCAGATTAGTGG + Intergenic
1094215513 12:27937178-27937200 AAAGACAGAAAGTAGATTAGTGG + Intergenic
1094332318 12:29307842-29307864 AAACACAGAATCCAGGTAAGTGG - Intronic
1095546875 12:43382440-43382462 AGATACAGAAAGCAGATTAGTGG + Intronic
1095691782 12:45097910-45097932 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1095789925 12:46154838-46154860 GAAGACAGAAAGTAGATTAGTGG + Intergenic
1096132492 12:49171115-49171137 AGAGACAGAAACTAGATTAGTGG + Intergenic
1096442271 12:51653358-51653380 AAAGACAGAAAGCAGAATAGGGG - Intronic
1097856240 12:64465738-64465760 AGAGACAGAAAACAGATTAGTGG + Intronic
1097970043 12:65623725-65623747 TCAAACAGAAACCAGATGAGAGG - Intergenic
1098443413 12:70541646-70541668 AGACACAGAAAGTAGATTAGTGG - Intronic
1098565906 12:71935319-71935341 ACACACAGAAAGTAGATTAGTGG - Intergenic
1099264813 12:80431995-80432017 AAACAGAGAAACCAGTTAAGAGG - Intronic
1100107185 12:91190193-91190215 GAAGACAGAAAGCAGAATAGAGG - Intergenic
1100146662 12:91686745-91686767 CAACACAGAAGGCAGAGGAGAGG + Intergenic
1100184194 12:92121278-92121300 CAACACTGAAAACAAATCAGAGG - Intronic
1100234224 12:92642542-92642564 AGAGACAGAAACTAGATTAGTGG + Intergenic
1100684797 12:96975892-96975914 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1100999163 12:100338952-100338974 CACAACAGAAACCAAATCAGTGG + Exonic
1101438115 12:104681396-104681418 AGAGACAGAAACTAGATTAGTGG + Intronic
1101928447 12:108992697-108992719 GGAGACAGAAAGCAGATTAGTGG + Intronic
1101946153 12:109139062-109139084 AGAGACAGAAAACAGATTAGTGG - Intronic
1101987257 12:109457228-109457250 CAAGACAGAAAACAGATTAGTGG + Intronic
1102139882 12:110605862-110605884 CAACACAGAAACAGAAATAGCGG + Intergenic
1102464043 12:113117746-113117768 CGACACAGAAAATAGATTCGTGG - Intronic
1102623025 12:114211789-114211811 CAACACAGAACACAGACTTGAGG + Intergenic
1102886137 12:116523361-116523383 CAAAACAAAAAACAGAGTAGAGG + Intergenic
1103458220 12:121083989-121084011 GCAGACAGAAAGCAGATTAGAGG + Intergenic
1103510979 12:121474039-121474061 AGAGACAGAAAGCAGATTAGCGG + Intronic
1103520606 12:121535372-121535394 AGAGACAGAAAGCAGATTAGTGG + Intronic
1103616904 12:122159526-122159548 CGAGACAGAAAGTAGATTAGTGG + Intergenic
1103733946 12:123046623-123046645 CAAAACAGAAAGCAGCTTAGTGG - Intronic
1104085182 12:125467787-125467809 AGAGACAGAAAGCAGATTAGAGG - Intronic
1104120965 12:125799700-125799722 GAACAAAGAAACCAGATTTAGGG + Intergenic
1105465620 13:20637097-20637119 GGAGACAGAAAACAGATTAGTGG + Intronic
1105659650 13:22479834-22479856 AGATACAGAAAACAGATTAGTGG + Intergenic
1106353901 13:28960661-28960683 AAAGACAGAAAATAGATTAGTGG + Intronic
1106388635 13:29313615-29313637 CAACAGAGAAATCAGAGGAGAGG + Intronic
1107241746 13:38243635-38243657 AAAGACAGAAAATAGATTAGTGG + Intergenic
1107310799 13:39075025-39075047 CAACTTAGAAAACATATTAGAGG + Intergenic
1107354292 13:39549932-39549954 AGACACAGAAAGTAGATTAGTGG + Intronic
1107376117 13:39806607-39806629 CAAGACAGAAAGTAGAATAGTGG + Intergenic
1108248524 13:48541905-48541927 CAACAAAGAAACTCAATTAGTGG - Intergenic
1108738511 13:53310338-53310360 CAAGGCAGAAAGCAGATGAGTGG + Intergenic
1108807486 13:54176905-54176927 CAACTGAGAAAACAGATTTGGGG - Intergenic
1109010156 13:56930180-56930202 CAAAACAGAAACAAAATTAGTGG - Intergenic
1109953600 13:69535399-69535421 CAAATCTGAAAACAGATTAGGGG - Intergenic
1110157610 13:72337461-72337483 AAAGACAGAAAGCAGATTAGTGG + Intergenic
1111208696 13:85048294-85048316 AAAGACAGAAAGCAGATTTGTGG + Intergenic
1111743698 13:92237849-92237871 TAAGACAGAAAGTAGATTAGTGG - Intronic
1112469492 13:99674645-99674667 TAAGACAGAAAATAGATTAGTGG - Intronic
1112521225 13:100097208-100097230 GAAGACAGAAAGTAGATTAGTGG + Intronic
1112740196 13:102464376-102464398 ACACACAGAAAGCAGATTAGTGG + Intergenic
1112822396 13:103352107-103352129 AAAGACAGAAGGCAGATTAGTGG - Intergenic
1113103352 13:106745401-106745423 CAATACAGAAATGAAATTAGAGG + Intergenic
1113452064 13:110417647-110417669 AAAGACAGAAAACAGATGAGTGG - Intronic
1113502285 13:110785789-110785811 AGACACAGAAAGCAGATTAGGGG + Intergenic
1113539880 13:111098253-111098275 CACCACACAAACCAGAACAGGGG - Intergenic
1114120492 14:19666280-19666302 AAACACAGAATCCAGGTGAGTGG + Intergenic
1114644588 14:24247811-24247833 CAACATAGAAAAGAAATTAGAGG - Intergenic
1115177752 14:30584047-30584069 ACACACAAAAAGCAGATTAGTGG - Intronic
1115588441 14:34839111-34839133 CAGGACAGAAAACAGATCAGTGG + Intronic
1115704001 14:35979288-35979310 AATGACAGAAAGCAGATTAGTGG + Intergenic
1118250461 14:64155415-64155437 AAAGACAGAAGGCAGATTAGTGG + Intronic
1118268717 14:64321243-64321265 ACACACAGAAAGCAGATTGGTGG + Intronic
1118416491 14:65542507-65542529 TAACACATAGGCCAGATTAGTGG - Intronic
1118622563 14:67627025-67627047 AAAGACAGAAAGGAGATTAGTGG + Intronic
1118885446 14:69861885-69861907 CATCACAGAAAATAGAATAGTGG - Intronic
1119345299 14:73918632-73918654 AGACACAGAAAGCAGATTAATGG - Intronic
1119634912 14:76266040-76266062 CAATACAGAAAGTAGATTAGTGG + Intergenic
1119870115 14:78009618-78009640 GGAGACAGAAAGCAGATTAGTGG - Intergenic
1120134405 14:80848721-80848743 GAATTCAGAAACCAGATCAGAGG + Intronic
1120191085 14:81440167-81440189 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1120241590 14:81956086-81956108 CAAAACACAAAACAGATTGGAGG + Intergenic
1121055040 14:90845465-90845487 CAAGACAGAAACTAGATTCATGG - Intergenic
1121527744 14:94631344-94631366 AGACACTGAAAGCAGATTAGTGG + Intergenic
1121742467 14:96263924-96263946 CAAGACAAACACCAGATCAGAGG - Exonic
1122453162 14:101828201-101828223 AGAGACAGAAAGCAGATTAGAGG + Intronic
1124183077 15:27496490-27496512 CATCACATAACCCAGAATAGGGG - Intronic
1124873656 15:33568872-33568894 TGAGACAGAAAGCAGATTAGTGG - Intronic
1125254409 15:37746288-37746310 CAACTCAGAAAACATATTTGGGG + Intergenic
1125525450 15:40371278-40371300 CACCAGAGAAAGCAGATTGGAGG - Intergenic
1125889038 15:43252126-43252148 CAAGACAGAAATGAGATGAGAGG - Intronic
1125897351 15:43313787-43313809 AGATACAGAAAACAGATTAGTGG - Intergenic
1125935138 15:43628487-43628509 GAAGACAGAAAGTAGATTAGTGG - Intronic
1125947897 15:43724799-43724821 GAAGACAGAAAGTAGATTAGTGG - Intergenic
1125988956 15:44086515-44086537 AGAGACAGAAAGCAGATTAGTGG + Intronic
1126011627 15:44308247-44308269 AGACACAGAAACTAGAATAGAGG - Intronic
1126367269 15:47907943-47907965 AAAAACAGAAAGTAGATTAGCGG + Intergenic
1126535514 15:49758353-49758375 AAATATAGAAAACAGATTAGTGG + Intergenic
1126833167 15:52630981-52631003 CAACACAGAATTCAGAACAGTGG + Intronic
1127229386 15:56971860-56971882 AAAGACAGAAAGTAGATTAGTGG + Intronic
1127356238 15:58203285-58203307 GAAGACAGAAAATAGATTAGTGG + Intronic
1127718810 15:61679471-61679493 CAAGACTGAAATCAGATAAGTGG - Intergenic
1127850293 15:62906215-62906237 AAAGACAGAAAGCAGAATAGTGG + Intergenic
1127904230 15:63364448-63364470 TAACTCAGAAACCAGCTGAGAGG + Intronic
1127940841 15:63694218-63694240 AAATACATAAAGCAGATTAGAGG + Intronic
1128141530 15:65304224-65304246 TAACACAGAATTCAGAATAGTGG - Intergenic
1128292194 15:66486410-66486432 GGACACAGAAAGTAGATTAGTGG - Intronic
1128465982 15:67911767-67911789 AAAGACAGAAAACAGATTAGTGG - Intergenic
1128707622 15:69849108-69849130 GCACACAGAATCCAGATAAGGGG + Intergenic
1129024713 15:72559721-72559743 AAAGACAGAAAGCAGATGAGTGG - Intronic
1129031967 15:72625597-72625619 AAAGACAGAAAGCAGATTAGTGG - Intergenic
1129204873 15:74031166-74031188 AGACACAGAAAGCAGATTGGTGG - Intronic
1129406735 15:75324345-75324367 AAAGACAGAAAGCAGATTAGTGG - Intergenic
1129735085 15:77955919-77955941 AAAGACAGAAAGCAGATTAGTGG + Intergenic
1129832185 15:78678144-78678166 AGAGACAGAAAGCAGATTAGTGG - Intronic
1130113348 15:80984942-80984964 CAAAACTGAAACCAGATTCCAGG - Intronic
1130522751 15:84675957-84675979 AAAGACAGAAAGCAGATTAGTGG + Intronic
1130817782 15:87457501-87457523 AGACACAGAAAACAGGTTAGTGG - Intergenic
1130819871 15:87483609-87483631 GAACACAGAGCCCAGATCAGGGG + Intergenic
1131244474 15:90778559-90778581 ATACATAGAAAGCAGATTAGTGG - Intronic
1131798238 15:96042736-96042758 ACAGACAGAAAGCAGATTAGTGG + Intergenic
1132223212 15:100120410-100120432 GAACACAGAAACCAGATATTTGG - Intronic
1132475044 16:130836-130858 CAAGACAGAAAGTAGATTAGAGG + Intronic
1132919888 16:2381914-2381936 AGAAACAGAAAGCAGATTAGTGG - Intergenic
1133176218 16:4016786-4016808 AGACACAGAAAGCAGATGAGTGG + Intronic
1133204480 16:4225050-4225072 AGACACAGAAAGCAGATTAGTGG + Intronic
1133262440 16:4559783-4559805 TAAGACAGAAAGCAGATTAGTGG - Intronic
1133796323 16:9049435-9049457 ATATACAGAAAGCAGATTAGTGG - Intergenic
1133840818 16:9407718-9407740 AAAGACAGAAAACAGATTAGTGG + Intergenic
1134050276 16:11132271-11132293 AGAGACAGAAAGCAGATTAGTGG - Intronic
1134196128 16:12160517-12160539 AGAGACAGAAACGAGATTAGTGG + Intronic
1135253236 16:20918801-20918823 CAACACAGACAGCAAATCAGTGG + Intronic
1135635029 16:24068204-24068226 CAAAACAGAAATCAGCTGAGAGG - Intronic
1135927088 16:26704997-26705019 AGACACAGAAACCAGATTAATGG + Intergenic
1137651899 16:50127694-50127716 CAAGATAGAAAGTAGATTAGTGG + Intergenic
1138050796 16:53775229-53775251 CAGCACAGCAACTAGCTTAGTGG + Intronic
1138557846 16:57783248-57783270 AAAAACAGAAAGCAGATTAAAGG + Intronic
1138995466 16:62446690-62446712 TAATAAAGAAAACAGATTAGTGG + Intergenic
1139249293 16:65479627-65479649 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1140144638 16:72294734-72294756 AAAGACAGAAAGTAGATTAGTGG - Intergenic
1140319280 16:73932436-73932458 CAAAATTGGAACCAGATTAGAGG + Intergenic
1140793985 16:78418199-78418221 AAATACAAAAACAAGATTAGTGG + Intronic
1141915352 16:87092857-87092879 ATAGACAGAAAGCAGATTAGTGG - Intronic
1142371509 16:89685562-89685584 CAACAGTGAAGCCAGATTAGAGG + Exonic
1143436677 17:6933588-6933610 AGAGACAGAAAGCAGATTAGTGG + Intronic
1143774330 17:9187973-9187995 AGAGACAGAAAGCAGATTAGAGG + Intronic
1144661664 17:17074667-17074689 CAGCACAGAAAGCAGATTAGTGG - Intronic
1144696712 17:17308782-17308804 AAAGACAGAAAGTAGATTAGTGG - Intronic
1144939676 17:18929540-18929562 AGAGACAGAAAGCAGATTAGTGG - Intronic
1146129718 17:30260925-30260947 GAACCCAGAATCCAGATTAATGG + Intronic
1146206475 17:30909269-30909291 AAACACAGAAACTAGATAACAGG - Intronic
1146207188 17:30914936-30914958 AGAGACAGAAAGCAGATTAGCGG - Intronic
1146238574 17:31191574-31191596 CAGGACAGAAAGCAGATCAGTGG + Intronic
1146625064 17:34428831-34428853 AGAGACAGAAAGCAGATTAGGGG - Intergenic
1146960263 17:36968967-36968989 CAACAAAAAAAGCAGCTTAGAGG - Intronic
1146994129 17:37303187-37303209 AAAGACAGAAAGTAGATTAGTGG - Intronic
1147451974 17:40511386-40511408 AAAGACAGAATACAGATTAGTGG - Intergenic
1148345332 17:46899574-46899596 AGACACAGAAAACAGATTAGTGG + Intergenic
1149314346 17:55424223-55424245 AAAGACAGAAAGTAGATTAGTGG + Intergenic
1149804287 17:59600187-59600209 CATGACAGAAAGCAGATTAGTGG - Intronic
1150029404 17:61716461-61716483 CAAAACAGAAAGCAGATCAGTGG - Intronic
1150526518 17:65929008-65929030 AGAAACAGAAAACAGATTAGTGG + Intronic
1150663298 17:67105416-67105438 AGACACAGAAAGTAGATTAGTGG + Intronic
1151318838 17:73340391-73340413 GGAGACAGAAAACAGATTAGTGG - Intronic
1151968720 17:77445975-77445997 CAACACAGAACCCCGAGTAGGGG + Intronic
1153422584 18:4924822-4924844 GAAGACAGAAAGCAGATTAGAGG + Intergenic
1153466192 18:5390342-5390364 CAAAACAAAAACCAGAATCGTGG + Intergenic
1153703597 18:7722183-7722205 GGAGACAGAAAGCAGATTAGTGG - Intronic
1154259652 18:12819447-12819469 AGAAACAGAAACCAGATTACTGG + Intronic
1154414433 18:14168282-14168304 CAGGACAGAAAGCAGATCAGTGG - Intergenic
1155357954 18:24971890-24971912 CAACATAAAAACCAAATCAGAGG + Intergenic
1156262169 18:35455344-35455366 AGAGACAGAAAACAGATTAGTGG + Intronic
1157009526 18:43629746-43629768 AAAGACAGAAAATAGATTAGTGG + Intergenic
1157545419 18:48543117-48543139 CAAAACAGAAATGAAATTAGAGG - Intronic
1157744521 18:50123243-50123265 ATAGACAGAAAGCAGATTAGTGG + Intronic
1158376723 18:56878743-56878765 AGAGACAGAAAGCAGATTAGTGG - Intronic
1158393165 18:57059839-57059861 CAACAGAGGAAACAGCTTAGTGG + Intergenic
1158922789 18:62212461-62212483 CAAAACAGAAATCACATTATGGG - Intronic
1159426955 18:68301672-68301694 GAAGACAGAAGCCAGATTACAGG + Intergenic
1159983481 18:74813983-74814005 CAACACAGAAAGCAGATAATGGG - Intronic
1161742384 19:6030558-6030580 AGAGACAGAAAGCAGATTAGTGG + Intronic
1161955367 19:7491214-7491236 CAGCAGAGAATGCAGATTAGTGG - Intronic
1162174420 19:8820881-8820903 AAAGACAGACACCAGATGAGTGG + Intronic
1163009345 19:14415155-14415177 AGAAACAGAAAGCAGATTAGTGG - Intronic
1163052702 19:14696371-14696393 AGAGACAGAAAGCAGATTAGTGG - Intronic
1163061087 19:14762444-14762466 GGAAACAGAAAGCAGATTAGCGG + Intronic
1163169932 19:15524258-15524280 AGAGACAGAAAGCAGATTAGTGG + Intronic
1163272942 19:16265157-16265179 AAAGACAGAAAGCAGATTTGTGG - Intergenic
1163779054 19:19236203-19236225 AGAGACAGAAAGCAGATTAGTGG - Intronic
1164484974 19:28647739-28647761 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1165803369 19:38566125-38566147 AAACCCAGAGACCAAATTAGAGG + Intronic
1166080685 19:40442508-40442530 CAATACAGAATTCAGATTTGGGG - Intronic
1166961592 19:46499866-46499888 AGAGACAGAAAGCAGATTAGTGG - Intronic
1166989949 19:46686167-46686189 AAACACAGAAACCACACAAGGGG + Intronic
1167167225 19:47806744-47806766 AGAGACAGAAAGCAGATTAGTGG + Intronic
1167441444 19:49511675-49511697 CAAGACAGAAAGCAGATGAATGG + Intronic
1167569677 19:50279168-50279190 AAAGACAGAAAGGAGATTAGTGG - Intronic
1167845876 19:52163651-52163673 CAAGACAGAAACCAGTTGATAGG - Intronic
925377486 2:3398615-3398637 CAAAACAGAAGCCAGAGCAGTGG - Intronic
925417772 2:3683576-3683598 CAAGACAAAAAGCAAATTAGTGG - Intronic
925973837 2:9126886-9126908 AGAGACAGAAAGCAGATTAGGGG + Intergenic
926854658 2:17241455-17241477 AAACACAGACAGCAGATTACCGG + Intergenic
927269833 2:21194404-21194426 CAACAAAGAAAGCAGAGAAGAGG - Intergenic
928183213 2:29084769-29084791 AGAGACAGAAACCAAATTAGTGG + Intergenic
928413034 2:31068957-31068979 GGAGACAGAAAGCAGATTAGTGG + Intronic
928895363 2:36256066-36256088 CAACACAGAAATCCCATTACTGG - Intergenic
931473304 2:62562261-62562283 AGACACAGAAAGTAGATTAGAGG - Intergenic
932267417 2:70379933-70379955 CAAGACAGAAAGCAGACTAGTGG - Intergenic
932473095 2:71976903-71976925 AGAGACAGAAATCAGATTAGTGG + Intergenic
933192846 2:79355627-79355649 AAACACAGAAAGCAGATTAGAGG - Intronic
933860596 2:86463102-86463124 CAAAACAGAAAACCTATTAGTGG + Intronic
933878492 2:86644328-86644350 AGAGACAGAAAGCAGATTAGTGG - Intronic
933918485 2:87020597-87020619 AAATACAGAAAGTAGATTAGTGG + Intronic
934004511 2:87749316-87749338 AAATACAGAAAGTAGATTAGTGG - Intronic
934971198 2:98765914-98765936 AAAGACAGAAAGTAGATTAGTGG + Intergenic
935723541 2:106000639-106000661 AGAGACAGAAAGCAGATTAGTGG - Intergenic
935767469 2:106383332-106383354 AAATACAGAAAGTAGATTAGTGG - Intergenic
935992594 2:108734466-108734488 GCACACAGAAACCAGTTTGGGGG + Intronic
936000625 2:108825496-108825518 AAAGACAGAAAGCAGATTAGTGG - Intronic
936395860 2:112129120-112129142 AAAGACAGAAAGTAGATTAGTGG + Intergenic
936755338 2:115702657-115702679 CAGGACAGAAAGGAGATTAGTGG + Intronic
936987184 2:118322670-118322692 AGAGACAGAAACCATATTAGGGG - Intergenic
937805375 2:126136698-126136720 AGAGACAGAAAGCAGATTAGTGG + Intergenic
938165614 2:129023337-129023359 CAACAAAGAAAACTGATGAGTGG - Intergenic
938277615 2:130040361-130040383 AAACACAGAATCCAGGTAAGTGG + Intergenic
938328577 2:130431164-130431186 AAACACAGAATCCAGGTAAGTGG + Intergenic
938361369 2:130690330-130690352 AAACACAGAATCCAGGTAAGTGG - Intergenic
938437772 2:131297020-131297042 AAACACAGAATCCAGGTAAGTGG - Intronic
938443398 2:131355776-131355798 AAACACAGAATCCAGGTGAGTGG - Intergenic
938649543 2:133368081-133368103 CATCAGAGAAAACAAATTAGAGG + Intronic
938971939 2:136440488-136440510 CAATACAGAAACCAGCACAGAGG - Intergenic
939774259 2:146365009-146365031 CAATACAGAATGCAGACTAGTGG + Intergenic
939821105 2:146958041-146958063 CAGGACAAAAAGCAGATTAGTGG + Intergenic
940039218 2:149342301-149342323 CAACACCCAAACCATATCAGTGG + Intronic
940086845 2:149869343-149869365 AAACATGGAAAACAGATTAGTGG + Intergenic
940227637 2:151416380-151416402 AAACACAAAATTCAGATTAGAGG - Intronic
940261374 2:151783132-151783154 AGTCACAGAAAGCAGATTAGTGG - Intergenic
940461001 2:153962822-153962844 AATCACAAAAACCAGATCAGTGG - Intronic
940633351 2:156265896-156265918 CAAAACAGAAAAAACATTAGTGG + Intergenic
942159377 2:173166116-173166138 CAATAAAGAAAGCAGATTAGAGG - Intronic
942424683 2:175847250-175847272 AGAAACAGAAAGCAGATTAGTGG + Intergenic
942719241 2:178931621-178931643 GGACACAGAAAGCAGATTAGTGG + Intronic
942741000 2:179178004-179178026 AGAGACAGAAAGCAGATTAGTGG + Intronic
943381217 2:187151075-187151097 AAACACAGAATAAAGATTAGGGG + Intergenic
944026493 2:195176056-195176078 AAAGACAGAAAGCAGTTTAGTGG + Intergenic
944277258 2:197853048-197853070 AAAGACAGAAAGCAGAATAGTGG - Intronic
944611265 2:201410742-201410764 CACAACAGAAACCAAATCAGTGG - Intronic
944951656 2:204757276-204757298 CAACCCAGAAACCCCATTACTGG - Intronic
944973308 2:205019165-205019187 CAAGACAGAAAGTAGATTAGTGG - Intronic
945147448 2:206753132-206753154 CAACACAGAGAGCAGAGCAGAGG + Intronic
945267838 2:207908754-207908776 CAACACAGACACCAGAATGGAGG + Intronic
945880939 2:215324195-215324217 CAACTCAGAAACAAGACAAGAGG - Intronic
945898599 2:215513518-215513540 GAACACAGAAACCAGCTTGAAGG - Intergenic
945914743 2:215691418-215691440 ACAAACAGAAAGCAGATTAGAGG + Intergenic
945951976 2:216047872-216047894 CAGCAAAAAGACCAGATTAGGGG - Intronic
947166743 2:227270177-227270199 AGAAACAGAAAGCAGATTAGTGG + Intronic
947272072 2:228347706-228347728 GGAGACAGAAAGCAGATTAGTGG - Intergenic
947319663 2:228902778-228902800 AGACACAGAAAGGAGATTAGTGG + Intronic
947682498 2:232047752-232047774 ACAGACAGAAAACAGATTAGTGG - Intronic
947684976 2:232075555-232075577 GAGGACAGAAATCAGATTAGAGG - Intronic
947881601 2:233519071-233519093 AGAGACAGAAAGCAGATTAGTGG + Intronic
948491790 2:238318202-238318224 AATGACAGAAACCAGATTAGTGG + Intergenic
948644310 2:239394065-239394087 CAACACATAAACCAGATGATGGG + Intronic
1168784920 20:530184-530206 GAAGACAGAAAGCAGATTATTGG - Intronic
1169192893 20:3669199-3669221 GAGCCCAGAAACCTGATTAGGGG + Intronic
1169236983 20:3937639-3937661 CAATAAAGAAAGTAGATTAGTGG - Intronic
1170521825 20:17193970-17193992 AAGAACAGAAACCAGATTACTGG - Intergenic
1171116970 20:22533349-22533371 AAAAACAGAAAACAGAGTAGGGG + Intergenic
1171239699 20:23555287-23555309 CAACCCAGAAACCTTATTATTGG - Intergenic
1172172362 20:32945990-32946012 CAAGACAGAAACCAGTTTCTTGG + Intronic
1172454890 20:35062639-35062661 AAAGACAGAAAGTAGATTAGTGG + Intronic
1172585374 20:36079812-36079834 CAAGACAGAAAGTAGATTAGTGG + Intergenic
1173041934 20:39472545-39472567 AGACACAGAAAGTAGATTAGTGG - Intergenic
1173263338 20:41456036-41456058 AATCACAAAAACCAGATTTGAGG - Intronic
1173535087 20:43803270-43803292 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1173896877 20:46557886-46557908 CAAAACAGACCCCAGATCAGAGG + Exonic
1175089506 20:56490252-56490274 GAACACAGGAACCAGAGGAGAGG - Intronic
1175180663 20:57144576-57144598 AGACACAGAAAGTAGATTAGTGG + Intergenic
1175218766 20:57405197-57405219 CAACCCATAAACCAGAGTGGGGG - Intronic
1175596882 20:60241923-60241945 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1175906851 20:62384673-62384695 CATCAAAAAAAGCAGATTAGAGG - Intergenic
1176086846 20:63299607-63299629 CAAAACAGAAAACAGCTCAGTGG - Intronic
1176110655 20:63409154-63409176 CAACGCACAAACCAGAAGAGGGG + Intronic
1176134225 20:63513675-63513697 AGACACAGAAAGCATATTAGTGG + Intergenic
1176277549 20:64280977-64280999 AGAGACAGAAAGCAGATTAGTGG - Intronic
1176858603 21:13989963-13989985 CAGGACAGAAAGCAGATCAGTGG + Intergenic
1177108986 21:17000606-17000628 AATAACAGAAAGCAGATTAGTGG + Intergenic
1178640511 21:34341668-34341690 AGACACAGAAAGCAGGTTAGTGG + Intergenic
1179713419 21:43275726-43275748 CACCACAGACACCAGGTGAGGGG + Intergenic
1179713429 21:43275756-43275778 CACCACAGACACCAGGTGAGGGG + Intergenic
1179713454 21:43275848-43275870 CACCACAGACACCAGGTGAGGGG + Intergenic
1179713473 21:43275908-43275930 CACCACAGACACCAGGTGAGGGG + Intergenic
1179713483 21:43275938-43275960 CACCACAGACACCAGGTGAGGGG + Intergenic
1180462248 22:15575797-15575819 AAACACAGAATCCAGGTGAGTGG - Intergenic
1180535929 22:16392724-16392746 CAGGACAGAAAGCAGATGAGTGG + Intergenic
1181020232 22:20096698-20096720 AGAGACAGAAAGCAGATTAGTGG - Intronic
1182190600 22:28456285-28456307 AAATACAGAAAGTAGATTAGTGG + Intronic
1182277181 22:29197327-29197349 AGACACAGAAGACAGATTAGCGG - Intergenic
1182867492 22:33616773-33616795 AAAGACAGAAAGCAGATTAGTGG + Intronic
1183051185 22:35262813-35262835 CAACTCAGAAACCATATCTGAGG + Intronic
1183142254 22:35953465-35953487 CAAAAGAGAAAGCAGATTGGTGG + Intronic
1184053191 22:42024020-42024042 AAAGACAGAAAGCAGATTAGAGG - Intronic
1184435860 22:44475337-44475359 AAACAGAGAAACAAAATTAGAGG - Intergenic
949327154 3:2879652-2879674 AGAGACAGAAAGCAGATTAGAGG + Intronic
949479626 3:4481220-4481242 AGAGACAGAAAGCAGATTAGTGG - Intergenic
949630796 3:5924071-5924093 CAACACAGAAAGTAAATTAGTGG - Intergenic
950322087 3:12065945-12065967 AGAGACAGAAAGCAGATTAGTGG + Intronic
950326368 3:12113634-12113656 TAAAACAGAAAGTAGATTAGTGG - Intronic
950635917 3:14314515-14314537 CAAAACAGAAAACAGATTTGTGG - Intergenic
951403530 3:22264920-22264942 TACTACAGAACCCAGATTAGAGG - Intronic
952479845 3:33749984-33750006 CAGGACAGAAATTAGATTAGTGG + Intergenic
952629257 3:35444866-35444888 AAATACATAAATCAGATTAGGGG - Intergenic
952783649 3:37130153-37130175 GGACACAGAAAGTAGATTAGTGG - Intronic
953020240 3:39108354-39108376 CAGCAGAGAAACCAGATGGGAGG - Exonic
953085388 3:39660642-39660664 AGAGACAGAAAACAGATTAGTGG + Intergenic
953338505 3:42114013-42114035 AGAGACAGAAAGCAGATTAGCGG - Intronic
953345064 3:42168575-42168597 AAAAAAAGAAAGCAGATTAGTGG - Intronic
953516548 3:43597941-43597963 CAACAAAAAAAACAGACTAGGGG + Intronic
954638861 3:52086154-52086176 CAACACAGGAGCCAGATAACTGG + Intronic
954913511 3:54129505-54129527 CAACTCAGAAACCAAACTATTGG + Intronic
955107922 3:55917596-55917618 AAAGACAGAAAACAGATTAGTGG + Intronic
955247433 3:57239321-57239343 CCATACAGAAAGAAGATTAGTGG - Intronic
955302424 3:57794619-57794641 AGAGACAGAAAGCAGATTAGTGG - Intronic
955672226 3:61413553-61413575 GGAGACAGAAACTAGATTAGTGG + Intergenic
955682551 3:61517629-61517651 AGAGACAGAAATCAGATTAGTGG + Intergenic
956080893 3:65554903-65554925 CAACACAAAAAGGACATTAGTGG + Intronic
956525747 3:70158236-70158258 AAATACAGAAAATAGATTAGTGG - Intergenic
957578880 3:82044931-82044953 AAACACAGAAACCACTTTAAAGG - Intergenic
959189313 3:103090153-103090175 CAAAACAGAAAATAGATTAATGG - Intergenic
959394047 3:105814273-105814295 CAACATAGAACCCAGATAAGAGG + Intronic
959855654 3:111154206-111154228 CATGACAGAAAGCAGATCAGTGG - Intronic
960099559 3:113726082-113726104 CAACAAATAATACAGATTAGTGG - Intronic
961725866 3:128929729-128929751 CAAGACAGAAAGTAGATCAGTGG + Intronic
961787329 3:129355515-129355537 AGAGACAGAAAGCAGATTAGTGG + Intergenic
962165161 3:133040138-133040160 CTTCACACAAACCAAATTAGTGG + Intronic
962491547 3:135898232-135898254 TCACACAGAAAGCATATTAGAGG + Intergenic
962706471 3:138049479-138049501 AAGCACAGCAACAAGATTAGAGG + Intergenic
962979849 3:140478542-140478564 AGAGACAGAAAGCAGATTAGTGG + Intronic
963401007 3:144798814-144798836 CAACCCAGCAACCACATTACTGG - Intergenic
963506931 3:146198135-146198157 AAACATAGAGAACAGATTAGTGG + Intronic
963536206 3:146531442-146531464 CAGCACAGAAACCAGACCATAGG + Intronic
964397481 3:156260452-156260474 AGAGACAGAAAACAGATTAGTGG - Intronic
964459752 3:156910851-156910873 CAACCCAGCAACCACATTAGTGG - Intronic
964488275 3:157208321-157208343 CACTACAGAAATCAGATCAGTGG + Intergenic
964736164 3:159920713-159920735 AAAGACAAAAAACAGATTAGTGG + Intergenic
965088538 3:164132995-164133017 AGAGACAGAAAACAGATTAGTGG + Intergenic
965623242 3:170661333-170661355 CAAGACAGAAAGCAGATTAGTGG - Intronic
968057865 3:195706433-195706455 CAAGACAGAAAGTATATTAGTGG - Intergenic
968141451 3:196261140-196261162 AGAGACAGAAAGCAGATTAGTGG + Intronic
968174988 3:196541705-196541727 CAAAACAGAAAGCAGCTCAGAGG - Intergenic
969231130 4:5832132-5832154 AGAAACAGAAAGCAGATTAGTGG + Intronic
969975403 4:11095913-11095935 CACGACAAAAAACAGATTAGTGG + Intergenic
970180477 4:13386723-13386745 CAACACAGCAACCCCATTACTGG + Intronic
970275321 4:14393475-14393497 GACCACAGAAACCATTTTAGGGG - Intergenic
970332476 4:15001728-15001750 AAAAACAGAAACAAGCTTAGAGG + Intergenic
970788633 4:19829871-19829893 GAAGACAGAAAGGAGATTAGAGG - Intergenic
971228278 4:24775861-24775883 AGAGACAGAAAACAGATTAGTGG + Intergenic
974587620 4:63900014-63900036 CGACACAGAAACCAGCTTTAAGG - Intergenic
974632779 4:64516017-64516039 AAAGACAGAAAGTAGATTAGTGG - Intergenic
976012089 4:80502550-80502572 CTATACAGAAATCAGATAAGAGG - Intronic
976089675 4:81443448-81443470 CACCACAGAAATCAGAACAGTGG + Intronic
976122542 4:81799326-81799348 CAACACTGAGGCCACATTAGAGG + Intronic
976318940 4:83689416-83689438 CAAGACATAGAACAGATTAGCGG - Intergenic
976340546 4:83942269-83942291 AAACAAACAAACCAGATTATTGG + Intergenic
976505848 4:85846325-85846347 CCTCACAGAAAGCAGATTGGGGG - Intronic
976515407 4:85958848-85958870 AGAGACAGAAATCAGATTAGTGG - Intronic
977259346 4:94780205-94780227 AGAGACAGAAACTAGATTAGTGG - Intronic
977433883 4:96968393-96968415 TCACACAGAACCCAGAGTAGTGG - Intergenic
978175446 4:105726322-105726344 AAACACAGAAAGCCGATCAGTGG + Intronic
979425706 4:120562823-120562845 AGACACAGAAAGTAGATTAGTGG - Intergenic
979813522 4:125069197-125069219 CTATACAGAAAACAGATTAGTGG + Intergenic
982297245 4:153841814-153841836 AAAAACAGAAAGTAGATTAGTGG - Intergenic
982320107 4:154068441-154068463 CACCACAGAAACCAAATTTAAGG - Intergenic
982334860 4:154223410-154223432 AGACATAGAAAGCAGATTAGTGG - Intergenic
982492292 4:156044426-156044448 CAACACAGGAAACAGATGATGGG + Intergenic
982599482 4:157428495-157428517 AAAGACAGAGAACAGATTAGTGG - Intergenic
982895384 4:160915531-160915553 AAAGACAGAAAACAGAATAGTGG + Intergenic
983136037 4:164081750-164081772 AAATACAGAAACCAGATCATTGG + Intronic
983206651 4:164917596-164917618 CAACACAGAAAAAACATTATTGG - Intergenic
983368802 4:166832540-166832562 CAACCCAGTAACCCCATTAGTGG + Intronic
983592422 4:169428529-169428551 AGAGACAGAAAGCAGATTAGTGG + Intronic
984062047 4:175001994-175002016 CAACACATAAACAAAATTAGAGG - Intergenic
985157631 4:187007503-187007525 AGAGACAGAAAACAGATTAGTGG - Intergenic
985787544 5:1906022-1906044 CAACAGAGCAACCACATAAGTGG + Intergenic
987206861 5:15636410-15636432 CAAAACAGCAATCATATTAGAGG - Intronic
987656178 5:20809390-20809412 AAAGACAGAAAGCAGATTGGTGG - Intergenic
987982128 5:25099317-25099339 CATCCTAGAAAACAGATTAGTGG - Intergenic
988202015 5:28080673-28080695 CAACTTAAAAACTAGATTAGGGG - Intergenic
988632049 5:32942073-32942095 AGACACAGAAAGTAGATTAGTGG + Intergenic
988767374 5:34394550-34394572 AAAGACAGAAAGCAGATTGGTGG + Intergenic
988860367 5:35271272-35271294 CAATACAATAACCAGATTTGAGG - Intergenic
989085297 5:37669974-37669996 CTACACAGAAACTAAATTAGTGG + Intronic
989621519 5:43389075-43389097 AAAGACAGAAAGTAGATTAGTGG + Intronic
991298953 5:65109027-65109049 AGAGACAGAAAGCAGATTAGTGG - Intergenic
992245119 5:74813125-74813147 AGAGACAGAAAACAGATTAGTGG + Intronic
992560020 5:77942332-77942354 CCATACAGAAAGCAGATTGGTGG + Intergenic
992628987 5:78662517-78662539 AGAGACAGAAAGCAGATTAGTGG + Intronic
992838049 5:80659433-80659455 ATACACAGAAAGTAGATTAGTGG - Intronic
992875587 5:81051513-81051535 AAACACAGAAAGGAGATTAGTGG - Intronic
993787014 5:92153824-92153846 CAGAACAGAAATCAGATCAGTGG - Intergenic
994868471 5:105312058-105312080 AGAGACAGAAAGCAGATTAGTGG - Intergenic
995503159 5:112830744-112830766 AATGACAGAAAACAGATTAGTGG + Intronic
996350307 5:122532993-122533015 AGACACAGAAAGCGGATTAGTGG - Intergenic
996539370 5:124613033-124613055 CAAAGGAGAAAACAGATTAGGGG - Intergenic
996894813 5:128468124-128468146 AGTCACAGAAACTAGATTAGTGG - Intronic
998109620 5:139491031-139491053 AGATACAGAAAGCAGATTAGTGG - Intergenic
999497913 5:152118287-152118309 CAACACAGAAATTAAATTTGGGG - Intergenic
999828619 5:155298181-155298203 GAAGACAGAAAGCAGATTAGTGG - Intergenic
1000340908 5:160276579-160276601 ACAGACAGAAAGCAGATTAGTGG + Intronic
1000998024 5:167978580-167978602 AGAGACAGAAACCAAATTAGTGG + Intronic
1001370424 5:171194393-171194415 ACAGACAGAAAACAGATTAGTGG - Intronic
1003389756 6:5703615-5703637 CCACACACAGACCAGATTTGGGG + Intronic
1003516989 6:6825863-6825885 CAACCCAGGAACGGGATTAGGGG + Intergenic
1004007197 6:11647947-11647969 GGAGACAGAAAGCAGATTAGTGG - Intergenic
1004009790 6:11672833-11672855 CAACACAGAGACTAGAATTGTGG + Intergenic
1004218807 6:13727117-13727139 AGACACAGAAAGTAGATTAGTGG + Intergenic
1004681363 6:17898230-17898252 CAACACAGCAGCCACATCAGAGG + Intronic
1004710800 6:18168291-18168313 AAACACAGAAAGCAGATTAGCGG - Intronic
1005927349 6:30454401-30454423 AAACACAGAAAGGACATTAGGGG - Intergenic
1005930877 6:30482781-30482803 AAACACAGAAAGGACATTAGGGG - Intergenic
1006190325 6:32203739-32203761 CAACAGAGAAGGCAGATTTGTGG + Intronic
1006486183 6:34344506-34344528 AGAAACAGAAACCAGATTGGTGG + Intronic
1007009704 6:38404038-38404060 AAAGACATAAAGCAGATTAGTGG + Intronic
1007087981 6:39163854-39163876 CAGGACAGAAAACAGATCAGTGG + Intergenic
1007341988 6:41196727-41196749 AGACACAGAAAGTAGATTAGTGG - Intronic
1007903967 6:45440224-45440246 CAGCACAGAATCCAGGTTATAGG - Intronic
1008138507 6:47804978-47805000 CAACACAGAAAACAGCTTTTGGG + Intronic
1009672732 6:66777456-66777478 CGACACAGAAATCCCATTAGTGG + Intergenic
1011035157 6:82966214-82966236 AAAGACAGAAAGCAGATTAGGGG + Intronic
1011102081 6:83733830-83733852 AAAGACAGAAAGCAGATTAGTGG + Intergenic
1011191353 6:84732075-84732097 AAAGACAGAAAGCAGATCAGTGG + Intronic
1012071195 6:94618942-94618964 TATGACAGAAAACAGATTAGTGG + Intergenic
1012192492 6:96297814-96297836 AAAGACAGAAAACAGATCAGTGG - Intergenic
1012727060 6:102826867-102826889 CAAAACAAAAACCTGATTACAGG - Intergenic
1013057734 6:106600605-106600627 AGAGACAGAAAGCAGATTAGTGG - Intronic
1013299361 6:108789233-108789255 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1014351976 6:120357164-120357186 AAATACAGAAACCAGTTGAGAGG + Intergenic
1016841864 6:148533262-148533284 AAACACAGAAACCAGGTGTGTGG - Intronic
1018128305 6:160703458-160703480 AAATACAGAAAGTAGATTAGTGG - Intronic
1019762923 7:2827192-2827214 GGAGACAGAAAACAGATTAGTGG + Intronic
1020426080 7:8067932-8067954 CAACTTAGAAACCAGATTTCAGG - Intronic
1020851275 7:13356433-13356455 GGAAACAGAAAACAGATTAGTGG + Intergenic
1020984577 7:15117233-15117255 AGCCACAGAAATCAGATTAGCGG + Intergenic
1021010156 7:15453028-15453050 AAAGACAGAAAGTAGATTAGCGG + Intronic
1021304520 7:19015382-19015404 CAACCTAGAAACCATATTTGAGG - Intergenic
1021693193 7:23249484-23249506 AAAAATGGAAACCAGATTAGTGG - Intronic
1022661655 7:32373421-32373443 GAAGACAGAAAGTAGATTAGGGG + Intergenic
1023097591 7:36677908-36677930 AGACACAGAAAGTAGATTAGTGG + Intronic
1023211118 7:37805873-37805895 CAACATAGAAAACAAATTTGAGG + Intronic
1023591753 7:41787904-41787926 CAACTCAGAAACCAGTTTAGGGG - Intergenic
1024014901 7:45304867-45304889 AGAGACAGAAAGCAGATTAGAGG + Intergenic
1024118160 7:46212155-46212177 CCATATAGAAACCAAATTAGAGG + Intergenic
1024385508 7:48747696-48747718 GAACAGAGAAACCAAATTGGAGG - Intergenic
1024386097 7:48753790-48753812 CAACACAGAAACATGAAGAGAGG - Intergenic
1024440348 7:49409050-49409072 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1024926914 7:54626408-54626430 AAACACAGAAAACAGAATGGAGG + Intergenic
1025960247 7:66214215-66214237 AAAGACAGAAAATAGATTAGTGG - Intronic
1026145000 7:67739077-67739099 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1026475389 7:70730443-70730465 AGAGACAGAAAGCAGATTAGTGG - Intronic
1026944906 7:74309459-74309481 ATACACAGAATGCAGATTAGTGG - Intronic
1027502057 7:78964991-78965013 TAACTTAAAAACCAGATTAGTGG + Intronic
1028200878 7:87959565-87959587 AAACATAGCTACCAGATTAGAGG + Intronic
1029054148 7:97722685-97722707 AAACACAGAAAGTAGAATAGTGG + Intergenic
1029417374 7:100451416-100451438 CAAAACAAAAACCAGATTTTTGG - Intergenic
1029811518 7:103053897-103053919 CAACAGAGAAACAGAATTAGAGG - Intronic
1029889112 7:103907512-103907534 AGAGACAGAAAGCAGATTAGTGG + Intronic
1029990264 7:104956826-104956848 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1030344315 7:108415377-108415399 CGACACAAAAACCAGATTGAAGG - Intronic
1030355483 7:108537952-108537974 CAACAGAAAATCCAGATTAAGGG + Intronic
1030367824 7:108665885-108665907 AGAAACAGAAAGCAGATTAGTGG - Intergenic
1030537283 7:110784532-110784554 AAGCACAGAGATCAGATTAGAGG - Intronic
1030674691 7:112372257-112372279 AGAAACAGAAAGCAGATTAGTGG + Intergenic
1030952329 7:115806470-115806492 CATCACAGAAGCCAGAATAAGGG - Intergenic
1031211583 7:118835576-118835598 CAATACAGAAAGTAGATTAGTGG + Intergenic
1033066233 7:138157312-138157334 AAAGACAGAAAGTAGATTAGTGG + Intergenic
1033317615 7:140310863-140310885 TGAGACAGAAAGCAGATTAGTGG - Intronic
1033639465 7:143247298-143247320 CATGACAGACACCAGATCAGTGG + Intronic
1033670367 7:143487022-143487044 AGAGACAGAAACCAGGTTAGTGG + Intergenic
1034049890 7:147971488-147971510 CAGGACAGAAAGGAGATTAGTGG - Intronic
1034051481 7:147988753-147988775 CAGCAGAGAAACCAAATTACGGG - Intronic
1035014370 7:155752079-155752101 GGACACAGAAACCAGTTTAAAGG - Intronic
1035576273 8:708603-708625 CTATAAAGAAAACAGATTAGTGG + Intronic
1035634392 8:1133012-1133034 ACACACAGACCCCAGATTAGGGG - Intergenic
1035835656 8:2749142-2749164 AAGCACAGAAAGCAGATAAGTGG + Intergenic
1036920800 8:12852878-12852900 CAAGACAAAAAGCAGATTCGTGG + Intergenic
1036958694 8:13219980-13220002 AGACACAGAAAGCAGATTAGTGG + Intronic
1038001464 8:23395386-23395408 AGAGACAGAAACTAGATTAGTGG + Intronic
1038769289 8:30461810-30461832 CTTCACAGAAACAAAATTAGTGG - Intronic
1038852521 8:31293907-31293929 CAACAAAAAAACAAAATTAGTGG + Intergenic
1039472598 8:37822648-37822670 ATAGACAGAAAGCAGATTAGTGG - Intronic
1039549689 8:38433950-38433972 ATAGACAGAAAGCAGATTAGTGG - Intronic
1040812231 8:51467019-51467041 CAACACAGCAACCCCATTACTGG + Intronic
1041037334 8:53807603-53807625 CAAGACAGAAAGTAGGTTAGTGG + Intronic
1041654864 8:60338831-60338853 CATCACAGAAACCAGAAATGCGG - Intergenic
1041670594 8:60487885-60487907 CACCACAGAAACCAAGTTACAGG - Intergenic
1042152382 8:65802135-65802157 AAACACAGAAAGTAGAATAGAGG + Intronic
1042494803 8:69443957-69443979 GGAGACAGAAACGAGATTAGTGG - Intergenic
1042641576 8:70941146-70941168 AAAGACAGAAAGCAGATTGGTGG - Intergenic
1043470970 8:80562173-80562195 AAAGACAGAAAGTAGATTAGTGG - Intergenic
1043761470 8:84074422-84074444 CAACTCAGAAAATATATTAGAGG - Intergenic
1043845833 8:85162570-85162592 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1044172900 8:89078639-89078661 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1044603293 8:94026816-94026838 AGAGACAGAAAGCAGATTAGAGG - Intergenic
1044886708 8:96786207-96786229 AAAGACAGAAAGCAGATTAGTGG - Intronic
1045253896 8:100503254-100503276 CAACTCAGAATCCAGAAAAGTGG - Intergenic
1046113023 8:109749790-109749812 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1046379900 8:113437013-113437035 AAAGACAGAATCCAGAGTAGCGG - Exonic
1046645268 8:116779026-116779048 TAAGACAGAAAGTAGATTAGTGG + Intronic
1046668599 8:117033429-117033451 AAAAACAGAAAGCAGATTGGTGG + Intronic
1047829037 8:128611856-128611878 GATCACAGAAGCCAAATTAGTGG - Intergenic
1047999972 8:130370851-130370873 AGAGACAGAAAGCAGATTAGTGG + Intronic
1048228450 8:132613488-132613510 AGAGACAGAAAACAGATTAGTGG + Intronic
1049170168 8:141155085-141155107 GGAGACAGAAAGCAGATTAGTGG + Intronic
1049226418 8:141452991-141453013 TAAGACAGAAAGTAGATTAGAGG + Intergenic
1049865979 8:144936108-144936130 AGACACAGAATACAGATTAGTGG - Intronic
1050041928 9:1504574-1504596 AAAGACAGAAAGCAGGTTAGTGG + Intergenic
1050403869 9:5286416-5286438 AAACACAGAAAGTAGAATAGTGG + Intergenic
1050426933 9:5521171-5521193 AGAGACAGAAACTAGATTAGTGG + Intronic
1050566065 9:6885203-6885225 AGGGACAGAAACCAGATTAGTGG - Intronic
1050608046 9:7321812-7321834 AGACACAGAAAACAGATCAGTGG - Intergenic
1050648769 9:7752658-7752680 GCAAACAGAAAGCAGATTAGAGG + Intergenic
1051331098 9:16025750-16025772 AAAGACAGAAAGCAGATCAGTGG + Intronic
1051813027 9:21072255-21072277 AATGACAGAAAGCAGATTAGTGG - Intergenic
1052402675 9:28020222-28020244 TAACACTGAAACCAGATAAAAGG - Intronic
1054735722 9:68748071-68748093 AGAAACAGAAAGCAGATTAGGGG - Intronic
1055582652 9:77723743-77723765 AAAGACAGAAAGTAGATTAGAGG + Intronic
1055604104 9:77949878-77949900 CAAGACAAAAACCAGATTGCAGG - Intronic
1055686053 9:78775970-78775992 CAAAAAAGAAAACAGATTGGTGG - Intergenic
1055825058 9:80313716-80313738 GAACACAGAATCCAGATTGAAGG - Intergenic
1055922809 9:81479365-81479387 AGACACAGAAACCAGGTTGGTGG + Intergenic
1056101852 9:83307609-83307631 AAAAACAGAAAGTAGATTAGTGG + Intronic
1056158594 9:83865144-83865166 CAACAGAGAAAACAGAAAAGAGG - Intronic
1056173610 9:84012762-84012784 TGAGACAGAAAGCAGATTAGTGG + Intergenic
1056351970 9:85758793-85758815 CAACAGAGAAAACAGAAAAGAGG + Intergenic
1057187832 9:93067108-93067130 AGAGACAGAAAGCAGATTAGTGG - Intronic
1057821017 9:98330931-98330953 AGAGACAGAAACTAGATTAGTGG - Intronic
1058716328 9:107725503-107725525 CTTGAGAGAAACCAGATTAGAGG + Intergenic
1059116540 9:111604777-111604799 GAACACAGAAACCACCTTAAAGG + Intergenic
1059321330 9:113472578-113472600 AGAGACAGAAAGCAGATTAGTGG + Intronic
1059480356 9:114584596-114584618 AGACACAGAAAATAGATTAGTGG - Intergenic
1059502731 9:114768908-114768930 CCACAAAGAAACCAAATTTGAGG - Intergenic
1059996642 9:119916733-119916755 AGACACAGAAAGTAGATTAGTGG - Intergenic
1061086641 9:128403311-128403333 TGAGACAGAAAGCAGATTAGTGG + Intergenic
1061284054 9:129612350-129612372 CAACACTGCAGCCAGATAAGAGG - Exonic
1061380932 9:130256864-130256886 AAAGACAGAAAACAGTTTAGTGG - Intergenic
1061771028 9:132921655-132921677 TAAGACAGAAAACAGATTAGTGG + Intronic
1185520063 X:731946-731968 AAACACAGAAAGTAGATTCGAGG - Intergenic
1185671579 X:1814171-1814193 CCAGACACAAAGCAGATTAGTGG + Intergenic
1185696865 X:2201471-2201493 AGAGACAGAAACTAGATTAGTGG - Intergenic
1185912220 X:3992549-3992571 AAACAGAAAAACCACATTAGCGG - Intergenic
1186245626 X:7613481-7613503 AGACACAGAAAGTAGATTAGTGG - Intergenic
1186369189 X:8929443-8929465 CAACAGAGAAGGGAGATTAGGGG + Intergenic
1186461136 X:9749466-9749488 AGAGACAGAAACTAGATTAGTGG - Intronic
1186591479 X:10934468-10934490 AGAAACAGAAAGCAGATTAGTGG - Intergenic
1186882009 X:13875830-13875852 AGAGACAGAAAGCAGATTAGTGG + Intronic
1187089867 X:16084918-16084940 CATCACAGAAACCCTATTACTGG + Intergenic
1187351313 X:18520269-18520291 AAATACAGAAAGCAGATTGGTGG - Intronic
1187403440 X:18982850-18982872 CAACAAAGAAAACAGATTAAGGG + Intronic
1187586405 X:20667082-20667104 CATGACAGAAAACAGATTAGTGG - Intergenic
1187909506 X:24097930-24097952 ATAAACAGAAAGCAGATTAGTGG - Intergenic
1188031536 X:25269240-25269262 AAAGACAGAAAACAGATCAGTGG - Intergenic
1188187838 X:27137533-27137555 CATCACAGAAACCAAATAACGGG - Intergenic
1188402845 X:29769066-29769088 ATAGACAGAAAACAGATTAGTGG - Intronic
1188453040 X:30329022-30329044 AGACATAGAAAGCAGATTAGTGG - Intergenic
1189420079 X:40849073-40849095 CAAAACATAGAACAGATTAGTGG - Intergenic
1190284344 X:48952264-48952286 CAAGCCAGAAAGTAGATTAGTGG + Intronic
1191712657 X:64167088-64167110 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1191803677 X:65109381-65109403 TAAAACAGAAAGTAGATTAGTGG - Intergenic
1191820924 X:65306979-65307001 CATGACAGAAAGCAGATAAGTGG + Intergenic
1191874017 X:65775855-65775877 AGAAACAGAAAGCAGATTAGTGG - Intergenic
1192525167 X:71836715-71836737 AAAGACAGAAACTAAATTAGTGG + Intergenic
1192558946 X:72112538-72112560 CAAAACAGAAAGTTGATTAGTGG - Intergenic
1192966943 X:76187146-76187168 CAACACAGCAATCCCATTAGTGG - Intergenic
1193083897 X:77431049-77431071 AAAGACAGAGAACAGATTAGTGG - Intergenic
1194005320 X:88484429-88484451 AGAGACAGAAAGCAGATTAGTGG - Intergenic
1194618941 X:96144166-96144188 AAAGACAGAAAATAGATTAGAGG + Intergenic
1194750167 X:97675145-97675167 AGATACAGAAAGCAGATTAGTGG - Intergenic
1195006887 X:100693993-100694015 CAAGACAGAAAGCATATTAGGGG + Intronic
1195164139 X:102201176-102201198 AGAGACAGAAACTAGATTAGTGG - Intergenic
1195194721 X:102485919-102485941 AGAGACAGAAACTAGATTAGTGG + Intergenic
1195548881 X:106144206-106144228 CAACACAGTAATGAGATTACTGG - Intergenic
1195636865 X:107127259-107127281 AAAGACAGAAAGTAGATTAGTGG + Intronic
1195775004 X:108393440-108393462 AGAGACAGAAAGCAGATTAGTGG + Intronic
1195798286 X:108678122-108678144 CAACATAGAAAGCACATGAGTGG - Intronic
1195874101 X:109520260-109520282 AAAGACAGAAAACAGATTGGTGG + Intergenic
1196236745 X:113290452-113290474 AAAGACAGAAAGTAGATTAGAGG - Intergenic
1196383226 X:115117754-115117776 AATGACAGAAAGCAGATTAGTGG + Intronic
1196971338 X:121112047-121112069 CTACAGAGAAAGTAGATTAGTGG - Intergenic
1197390849 X:125862033-125862055 CAACTCAGAAACTATATTTGAGG + Intergenic
1197446639 X:126557923-126557945 GAAAACAGAAAACAAATTAGTGG + Intergenic
1197483854 X:127022553-127022575 AGAGACAGAAAACAGATTAGTGG + Intergenic
1197543763 X:127798446-127798468 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1197795644 X:130295352-130295374 AGACACAGAAAGTAGATTAGTGG + Intergenic
1197991510 X:132323286-132323308 CAACACAGAAATCAGAATGTTGG - Intergenic
1198000692 X:132432522-132432544 AGAGACAGAAAGCAGATTAGTGG - Intronic
1198034945 X:132792685-132792707 AGAGACAGAAAGCAGATTAGTGG - Intronic
1198274973 X:135091425-135091447 ACAGACAGAAAGCAGATTAGTGG - Intergenic
1198516565 X:137414404-137414426 AAATACAGAAAGCAGATTAGAGG - Intergenic
1198588824 X:138153419-138153441 TAACACAGAAAACAAATTTGAGG + Intergenic
1198820988 X:140648749-140648771 AAAGACACAAAGCAGATTAGTGG - Intergenic
1199200546 X:145083211-145083233 AAATACAGAAAGTAGATTAGAGG - Intergenic
1199532800 X:148869173-148869195 AGAGACAGAAAGCAGATTAGAGG + Intronic
1200139116 X:153889113-153889135 AAAGACAGAAATCAGATCAGTGG - Intronic
1200178160 X:154132969-154132991 AGACACAGACAGCAGATTAGCGG + Intergenic
1200182757 X:154160946-154160968 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1200188411 X:154198060-154198082 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1200194061 X:154235200-154235222 AGAGACAGAAAGCAGATTAGTGG + Intergenic
1200194724 X:154239972-154239994 CAAGTCAGAAAGCAGATTGGTGG - Intergenic
1200199816 X:154273004-154273026 AGAGACAGAAAGCAGATTAGTGG + Intronic
1200288788 X:154851086-154851108 AGAGACAGAAAACAGATTAGTGG - Intronic
1201464134 Y:14261254-14261276 AGACACAGAAAGTAGATTAGTGG - Intergenic