ID: 914675425

View in Genome Browser
Species Human (GRCh38)
Location 1:149904230-149904252
Sequence CCAGATTAGGGGAGGAACTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 196}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675412_914675425 22 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675417_914675425 0 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675413_914675425 21 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675415_914675425 12 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675416_914675425 3 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675418_914675425 -4 Left 914675418 1:149904211-149904233 CCCAGGCTCAACACAGAAACCAG 0: 1
1: 0
2: 5
3: 20
4: 293
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196
914675419_914675425 -5 Left 914675419 1:149904212-149904234 CCAGGCTCAACACAGAAACCAGA 0: 1
1: 0
2: 1
3: 26
4: 361
Right 914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG 0: 1
1: 0
2: 3
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675425 Original CRISPR CCAGATTAGGGGAGGAACTG TGG Exonic
900241210 1:1618445-1618467 CCAGATTAGGGGTAGGAGTGGGG - Intronic
900865689 1:5267206-5267228 ACAGATAAGCGGAGCAACTGAGG - Intergenic
901425749 1:9181644-9181666 CAAGGTGAGGAGAGGAACTGGGG + Intergenic
901776720 1:11565270-11565292 CCAGCTCAGGGCAGGAAATGTGG - Intergenic
902438294 1:16412168-16412190 CCAGAGCAGGGGAAGGACTGAGG - Intronic
903738518 1:25544806-25544828 CCTGATGAGGGGAGAAGCTGTGG - Intronic
904143436 1:28370960-28370982 CCAGTTTAGGGGATGAGGTGTGG + Intronic
904645184 1:31960225-31960247 ACAGAGTAAGGAAGGAACTGAGG - Intergenic
905445728 1:38027440-38027462 CCAGGTGAGTGGAGGAATTGGGG + Intergenic
906869678 1:49464393-49464415 CAAGATGAGGGTAGGAACTTTGG + Intronic
907051421 1:51331811-51331833 CCAGACAAGGGGAGAGACTGGGG + Intronic
907372167 1:54010632-54010654 CCAGAGCTGGGGAGGAACTGAGG - Intronic
911206779 1:95099517-95099539 CCAGACTAGCAGAGGAAATGAGG - Intergenic
913324857 1:117618481-117618503 ACAGATAAGGGGATGAACAGAGG - Intronic
913341628 1:117763632-117763654 CCAAAAGAGGGGAGGAAGTGAGG - Intergenic
914334826 1:146704708-146704730 CCTGATTCAGGCAGGAACTGAGG + Intergenic
914675425 1:149904230-149904252 CCAGATTAGGGGAGGAACTGTGG + Exonic
914813070 1:151043673-151043695 CCAGCTTAGAGGTGGAACTTGGG - Exonic
920442640 1:205991180-205991202 CCAGATAAGAGGAGGAAGTGTGG + Intronic
922809916 1:228409600-228409622 TCAGCTTAGGTGAGGCACTGGGG - Intronic
923898804 1:238303375-238303397 CCAGAATAGGGAAAGAGCTGAGG + Intergenic
924023736 1:239811470-239811492 GCAGATCAGGGGAGAATCTGTGG - Intronic
924163759 1:241261177-241261199 ACAGATTAGGACAGGCACTGGGG + Intronic
924826813 1:247548337-247548359 GCAGCCTAGGGGAGGAAGTGGGG + Intronic
1065517134 10:26534921-26534943 CCAAATTTGGGGAGAAATTGGGG + Intronic
1065674091 10:28155683-28155705 ACAGATTTGGGGAGGAAGGGAGG + Intronic
1065883504 10:30058320-30058342 CTAGATTTGGGGAGGGAATGAGG + Intronic
1067522918 10:47021669-47021691 GCTTATTAGGGGAGGAACAGAGG - Intergenic
1068791844 10:61037868-61037890 ACAGACTAAGGGAGGCACTGAGG - Intergenic
1069097648 10:64279030-64279052 GCCCATAAGGGGAGGAACTGGGG - Intergenic
1074417665 10:113281495-113281517 ACTGATTTGGGGAGAAACTGAGG - Intergenic
1075257139 10:120934279-120934301 CCAGATAAGGGGAGGCATTGGGG - Intergenic
1076277644 10:129217646-129217668 CCAGTGTGGGTGAGGAACTGGGG + Intergenic
1076777951 10:132708609-132708631 CCAGCTGCGGGGAGGGACTGGGG - Intronic
1077485981 11:2838636-2838658 CCAGGGTAGGGGAGGATGTGGGG + Intronic
1077501315 11:2910909-2910931 CCAGATAAGGGGGAGAAATGGGG + Intronic
1079651552 11:22935806-22935828 CCAGAGTCGGGGAGGAATGGAGG - Intergenic
1081602549 11:44505321-44505343 CAAGATTATAGAAGGAACTGGGG + Intergenic
1081683609 11:45026199-45026221 CCAGATCAGGGCAGGACCAGAGG - Intergenic
1082212802 11:49525936-49525958 CCAAATAAGGGAATGAACTGAGG + Intergenic
1082892319 11:58153196-58153218 CCAAATTAGAGGAGGCACTGGGG + Intronic
1085019185 11:73194426-73194448 CCAGATTAAAGAAGAAACTGAGG + Intergenic
1089214945 11:116829684-116829706 CCAGATGAGCTCAGGAACTGGGG - Intronic
1090185548 11:124737155-124737177 CCAGGTTAGGGAGGCAACTGGGG - Intergenic
1090491398 11:127164164-127164186 ACAGATTAGGGGAAGAGCAGAGG - Intergenic
1090879873 11:130824159-130824181 CCAGGTAAGGGGAGGAGCTGCGG - Intergenic
1092088455 12:5785057-5785079 CCAGGGTAGGGGTGGAGCTGGGG - Intronic
1092211050 12:6646764-6646786 CCAGACTAGGGGGGAAACCGAGG - Intronic
1094340279 12:29403565-29403587 CAAGAATCAGGGAGGAACTGAGG - Intergenic
1096983218 12:55740942-55740964 CCAGTTAAGGGTAGGAATTGTGG + Intergenic
1100140895 12:91617531-91617553 CCAGTTTTGTGGAAGAACTGAGG - Intergenic
1102040577 12:109798257-109798279 CCAGAAAAGGGAAGGAACTGGGG + Intronic
1102480586 12:113220845-113220867 CCAGACTAAGGCAGGAGCTGAGG + Intronic
1103359976 12:120347746-120347768 CCAGACCAGGGGAGAAATTGAGG - Intronic
1103564086 12:121806753-121806775 CCAGAGCAGGGGAGGTGCTGCGG - Intronic
1105405089 13:20127069-20127091 ACAGCTTAGTGGAGGAGCTGTGG + Intergenic
1105424051 13:20278982-20279004 TCAGTTTAGAGGAGGATCTGAGG + Intergenic
1105835574 13:24208216-24208238 CCAGAATAGTGACGGAACTGGGG + Intronic
1106516223 13:30456433-30456455 GCAGTTTAGGCCAGGAACTGTGG + Intergenic
1106518939 13:30479931-30479953 CCAGATTAGGGAGGGCCCTGAGG - Intronic
1106864707 13:33950858-33950880 CCAAATTAGAGGAGGAAATTGGG - Intronic
1107824128 13:44312293-44312315 CCAGAAAAGGGGAGCAGCTGTGG - Intergenic
1112152606 13:96780467-96780489 CTAGATTAAGGGAGGAAATAGGG - Intronic
1117022441 14:51585241-51585263 TCAGATGTGGTGAGGAACTGGGG - Intronic
1119326626 14:73763545-73763567 CCTCATTGGGGGAGGAACAGTGG - Intronic
1119865796 14:77972840-77972862 CCAAAGTAGGTGATGAACTGAGG + Intergenic
1121338212 14:93089943-93089965 CCAGAAGAGCGGAAGAACTGAGG + Intronic
1121602408 14:95215545-95215567 CCAGATTAAGGGAGGCAGTGAGG - Intronic
1123105105 14:105837596-105837618 CCAGGTCTGGGGAGGAACGGGGG + Intergenic
1123695100 15:22873438-22873460 CCAGAGGAGGGGAGGAGCTGTGG - Intronic
1124407475 15:29404960-29404982 CCAGGTGGAGGGAGGAACTGGGG - Intronic
1126609189 15:50511707-50511729 CCAGAATAGGCCAGGCACTGTGG + Exonic
1127005603 15:54566059-54566081 CAAGAGTAGGGGGGGAACTCTGG - Intronic
1127542016 15:59949814-59949836 CCTGATTAGAGTAGGGACTGAGG - Intergenic
1129753027 15:78079153-78079175 CCAGATGATGGGAGGGACAGGGG + Intronic
1131696958 15:94888117-94888139 CCACATTAGGTTAAGAACTGAGG - Intergenic
1132849736 16:2019686-2019708 CCAGATGGGGGGAGGGACGGAGG - Exonic
1133877560 16:9749291-9749313 AGAGATTAGGGGAAAAACTGAGG + Intergenic
1134552042 16:15142965-15142987 CCAGCTTATAGCAGGAACTGGGG - Intergenic
1135270974 16:21069455-21069477 CCAGAAGAGGGGAGGAAATTTGG - Exonic
1136295822 16:29301564-29301586 CCTGGTTAGGGAAGGAAGTGTGG + Intergenic
1138064119 16:53922827-53922849 ACAGAGTTGGGGAGGAAGTGAGG + Intronic
1139514980 16:67447483-67447505 CCAAATGAGGGGAGGAATGGTGG - Intronic
1139998797 16:71006528-71006550 CCTGATTCAGGCAGGAACTGAGG - Intronic
1140476823 16:75243149-75243171 CCAGAGCAGGGCAGGAGCTGGGG - Intronic
1140579938 16:76218174-76218196 CCAGTTTAGAGGTGGAAATGGGG - Intergenic
1141254351 16:82386655-82386677 CTAGATTAGGGGAGGAAGAGTGG + Intergenic
1141574048 16:84952841-84952863 CCAGATGAGGCCAGGAGCTGTGG - Intergenic
1142101741 16:88275751-88275773 CCTGGTTAGGGAAGGAAGTGTGG + Intergenic
1142197800 16:88746753-88746775 CCAGGCCAGGGGAGGAGCTGGGG - Intronic
1144795288 17:17887224-17887246 CCAGATAAGGGTTGGAATTGTGG - Intronic
1145040301 17:19573074-19573096 AGAAATTAGGGGAGGAACTGGGG - Intronic
1148525585 17:48329828-48329850 CCTTATTAGTGGAGGAACTTGGG + Intronic
1148712406 17:49691411-49691433 CCAGTTATGGGGAGGAACTGAGG - Intergenic
1150708552 17:67510188-67510210 CCAGATTAGTCTAGGACCTGGGG - Intronic
1151061454 17:71099415-71099437 CCAGACTAGAAGAGGAAGTGGGG - Intergenic
1151105561 17:71612542-71612564 CCAGACAGGGGGAGGAACTACGG + Intergenic
1152009336 17:77701361-77701383 CAACATTAGTGGAGAAACTGGGG + Intergenic
1152709017 17:81860979-81861001 CCAGTTTAGGGGCGGAGCTGCGG + Intergenic
1156744838 18:40377333-40377355 CCAGTTTGAGGGAGGCACTGTGG - Intergenic
1157295334 18:46438015-46438037 CCAGATTCTGGGAAGAACTTAGG + Intronic
1157652005 18:49342595-49342617 CCAGATTAGGAGGGGAGGTGAGG + Intronic
1158163902 18:54517563-54517585 AGGGATTAAGGGAGGAACTGAGG - Intergenic
1163679008 19:18669875-18669897 GCAGATGAAGGCAGGAACTGAGG - Exonic
1163730624 19:18947229-18947251 CCACATCAGGGGAGGCACTGCGG + Intergenic
1165521300 19:36316332-36316354 CCAGGTTAGGGGAGGAACTAAGG + Intergenic
1165622763 19:37262258-37262280 CCAGGTTAGGGGAGGAACTAAGG - Intergenic
1165634460 19:37328888-37328910 TCAGATTAGGGGAGGAACTAAGG - Intronic
1165653987 19:37517016-37517038 CCAGTTTTAGGGAGGAATTGGGG + Intronic
1165782448 19:38442262-38442284 CCAGACTAGGGGAGGGAGTGTGG + Intronic
1166857657 19:45791307-45791329 CCAACTTTGGGGAGGCACTGTGG - Intronic
1167512234 19:49901492-49901514 CCAGATTGGGGAAGGGACTCAGG + Intronic
1167883469 19:52481662-52481684 CCAGAGTCGGGTAGGAAATGGGG + Intronic
925540496 2:4961304-4961326 GCAGATTAGAGGCGTAACTGTGG - Intergenic
927688679 2:25191695-25191717 TCAGATCAGGGGAGGCCCTGTGG + Intergenic
930327143 2:49934267-49934289 CCAGAGCAGGGAAGGAAGTGGGG - Intronic
930664860 2:54091971-54091993 CCAGACAAGGGCAGCAACTGTGG + Intronic
931879041 2:66547094-66547116 AAAGCTTAGGGGAGGAGCTGAGG - Intronic
932432263 2:71683106-71683128 CCAGAGGAAGGGAGGAGCTGGGG + Intronic
933884199 2:86702632-86702654 CTAGATTAGCAGAGGAGCTGAGG + Intronic
935549551 2:104438073-104438095 CCAGATTAGGGCAGGTATTGGGG + Intergenic
937779849 2:125824610-125824632 GCAAATTAGAGGAAGAACTGAGG - Intergenic
940982492 2:160019309-160019331 GAAGATGAGGGGAAGAACTGAGG - Intronic
942004891 2:171687971-171687993 CCAGCTTTGGGGAGGAAAGGCGG + Intronic
942801395 2:179880264-179880286 ACAGAGTAGGGAAGAAACTGCGG - Intergenic
944317658 2:198300710-198300732 CCAGATTTGAGGAAAAACTGTGG + Intronic
944546500 2:200804131-200804153 CCAGATTAGGCCAGGTACAGTGG - Intergenic
946192904 2:218016726-218016748 CCAAAATAGGAGAGGCACTGGGG + Intergenic
1171227988 20:23457183-23457205 CCAGAGCAGAGAAGGAACTGAGG - Intergenic
1172763661 20:37339268-37339290 CCAGACTAGGCCAGGCACTGTGG - Intergenic
1173599001 20:44279653-44279675 CCAGATTCTGGGAGGTGCTGGGG + Exonic
1180067455 21:45419665-45419687 CATGCTTAGGGGAGGACCTGGGG + Intronic
1180715600 22:17870057-17870079 ACAGATGAGGGGAAGGACTGTGG + Intronic
1181035218 22:20166695-20166717 CCAGGTTGGGGCAGGACCTGGGG + Intergenic
1181727148 22:24819574-24819596 CCAGATCAAGGGAGGCACTCTGG - Intronic
1183420670 22:37709662-37709684 CCAGAGGTGGGGAGGAATTGGGG + Intronic
1203285721 22_KI270734v1_random:153528-153550 CCTGATGAGGGGTGGGACTGGGG - Intergenic
950097107 3:10336887-10336909 CCAGATTACGGGAGGAAGCAAGG - Intronic
952872075 3:37909776-37909798 CCACATTTGGGGAGGGAATGAGG + Intronic
953487637 3:43317318-43317340 CCAGATGAGAGGAGGATCTGGGG + Intronic
954291072 3:49650321-49650343 CCAGAAAAGGGGGAGAACTGTGG - Intronic
954699180 3:52442642-52442664 TGAGATCAGGGGAGGACCTGAGG - Intronic
954796212 3:53162251-53162273 CCAGATGAGGGGAGGAGGTCGGG + Intronic
956340775 3:68221345-68221367 CCAGATAAGAGGAGGAATAGGGG - Intronic
956734581 3:72228416-72228438 AGAGACTAGGGGAGGAAGTGGGG - Intergenic
959102775 3:102032336-102032358 CCAGGTTATGGGTGGAAATGCGG + Intergenic
962816384 3:139005097-139005119 CAAGAGTAGGGGTGAAACTGAGG + Intergenic
963344227 3:144074703-144074725 CCTGATTAGTGAAGGAACTGTGG + Intergenic
969263699 4:6050332-6050354 CCAGAGCAGTGGTGGAACTGGGG + Intronic
970172428 4:13303237-13303259 CAAGAAGAGGGCAGGAACTGAGG + Intergenic
970954083 4:21790432-21790454 CCAGAATAGGAGAGGAATTTCGG + Intronic
971349439 4:25843209-25843231 GTGGATTATGGGAGGAACTGGGG + Intronic
972942750 4:44217327-44217349 CAAAATTAAGGGTGGAACTGGGG + Intronic
974011943 4:56615110-56615132 CCAGATTGGGAGAGGAATTTAGG - Intergenic
976211419 4:82675385-82675407 ACAGACTAGGGGATGAATTGAGG + Intronic
985702618 5:1382608-1382630 CCCGTTTAGGGAAGGCACTGCGG + Intergenic
988904509 5:35772429-35772451 CTGGATTAGGGCAGGAATTGTGG - Intronic
989749507 5:44876287-44876309 CCAGTTTAGGGGTGGAATAGCGG - Intergenic
992326847 5:75668424-75668446 CAAGATTAGGAAAGGAACAGAGG + Intronic
993333262 5:86625799-86625821 CCAGGTTAAGGAAGGAAATGTGG - Intergenic
994708060 5:103230398-103230420 CCAGAAGAGGGGAGGCAGTGAGG + Intergenic
995862454 5:116655773-116655795 ACAGATTAGGGAAGGTACTTCGG - Intergenic
998556175 5:143125899-143125921 GCTGATTAGGAGAGGAACAGGGG + Intronic
999018817 5:148140256-148140278 CCACAATAGGGCAGGAACTTAGG + Intergenic
999920341 5:156311608-156311630 ACAGAGGAGGGGAGGAGCTGGGG + Intronic
1000332410 5:160216090-160216112 GCTGAGTAGGGGATGAACTGGGG + Intronic
1001803069 5:174560049-174560071 CCTGATCCGGGGAGGAACTCTGG - Intergenic
1004222541 6:13759117-13759139 CCAGACTGGGGGAGCCACTGTGG - Intergenic
1005392025 6:25343729-25343751 CCAGACAAGGTGAGGAAGTGGGG - Intronic
1005903982 6:30244400-30244422 ACAGAATATGGGAGAAACTGTGG - Intergenic
1006169647 6:32085695-32085717 TGAGATTGGGGGAGGAGCTGGGG - Intronic
1007335078 6:41150063-41150085 CCAGATTTGGGGAGAAACTTGGG - Intronic
1007765094 6:44155282-44155304 CCAGATCCCAGGAGGAACTGTGG - Exonic
1008039058 6:46776694-46776716 CCAGATGAGGGTAAGCACTGTGG + Intergenic
1008106001 6:47441867-47441889 ACAGATTCAGGGAGGAATTGGGG - Intergenic
1009886015 6:69625047-69625069 GGAGTTGAGGGGAGGAACTGAGG + Intergenic
1014448430 6:121555936-121555958 GCAGAGGAGGGGAGGAAATGGGG + Intergenic
1018303640 6:162430319-162430341 TCATTTTAGGAGAGGAACTGAGG + Intronic
1019311278 7:362025-362047 AGAGATCAGGGCAGGAACTGGGG - Intergenic
1019777944 7:2923540-2923562 GCAGATGAGGAGAGGAGCTGAGG + Intronic
1022245760 7:28557694-28557716 AGAGATGAGGGAAGGAACTGGGG + Intronic
1023849333 7:44141384-44141406 CCAAATAAGGAGAGGAACAGAGG + Intergenic
1027444348 7:78255327-78255349 CCAGATCATGGGAGGCACTATGG + Intronic
1028360955 7:89965592-89965614 CCAGATTAGACAAGGAACTATGG + Intergenic
1029323889 7:99789079-99789101 CCAGAGTAGGGGCAGAACTCTGG - Intergenic
1030399107 7:109026405-109026427 ACAGATTATGGTAGAAACTGTGG + Intergenic
1032257930 7:130311794-130311816 CCAGTTTGGGGGAGGAGATGAGG - Intronic
1032734138 7:134674398-134674420 GTGGAATAGGGGAGGAACTGGGG - Intronic
1032884527 7:136123607-136123629 CGAGATGAGGGGAGGGACAGAGG + Intergenic
1034411060 7:150942411-150942433 CCAGATGAGGGGAGGAGCCAAGG + Intergenic
1036674594 8:10819408-10819430 CCAGATTAGCTGAGTAACAGTGG + Intronic
1037161738 8:15781192-15781214 CCAGCTTGGGAGAGGAACTGTGG - Intergenic
1037583702 8:20261976-20261998 GCAGCTTAGGGGAGGAGGTGTGG - Intronic
1039841949 8:41300161-41300183 ACAGATTAGTGGAGGTACGGAGG + Intronic
1040661652 8:49582508-49582530 CCTGATGAGGGGCGGACCTGGGG - Intergenic
1041735886 8:61110024-61110046 CCAGAGGAGGGGATGAAGTGAGG - Intronic
1042019806 8:64359694-64359716 TCAGATAAGGGGAGGAACCATGG + Intergenic
1044435935 8:92164378-92164400 CCAGAGTAAGGGAGAAAATGGGG + Intergenic
1044733696 8:95255340-95255362 CCTGAGAAGGGGAGGAGCTGGGG - Intronic
1046733295 8:117748908-117748930 CCAGATGTGGGGAGGAACAGAGG + Intergenic
1053392858 9:37748346-37748368 CAAGTTTAGGGGAGGAGCTCGGG + Intronic
1053564171 9:39230627-39230649 CCAGATTAGGGCACAAAGTGGGG + Intronic
1053829958 9:42068498-42068520 CCAGATTAGGGCACAAAGTGGGG + Intronic
1054132977 9:61388407-61388429 CCAGATTAGGGCACAAAGTGGGG - Intergenic
1054600598 9:67118955-67118977 CCAGATTAGGGCACAAAGTGGGG - Intergenic
1056200488 9:84271199-84271221 CTAGATTAGGAGAGGCACTCAGG - Intergenic
1057522663 9:95772419-95772441 CCAGATCAGGGCAGGACATGGGG - Intergenic
1058410464 9:104725399-104725421 CCAGCTTAGGGCTGGTACTGGGG - Intergenic
1060396776 9:123321800-123321822 CCAGTGGAGGGGAGGAACTTGGG - Intergenic
1061004063 9:127918443-127918465 CCTGGATAGGGGAGGCACTGAGG - Intergenic
1061283858 9:129611442-129611464 CCAGACTAGGAGAGAAACCGTGG + Intronic
1061536373 9:131252657-131252679 CCAGAGTAGCTGAGGAACTGGGG - Intergenic
1187087854 X:16060408-16060430 CCAGCCAAAGGGAGGAACTGTGG - Intergenic
1188113389 X:26217208-26217230 CAAGAATAGGAGAGGAAGTGGGG - Exonic
1188914592 X:35894559-35894581 CCTCATGAGGAGAGGAACTGTGG - Intergenic
1193977761 X:88144126-88144148 CCCGATTAGGTGGGGAGCTGTGG - Intergenic
1196052980 X:111324994-111325016 TCAGATTGGAGGAGGAACTGGGG + Intronic
1199600505 X:149538907-149538929 CTAGATAAGGGGAGGGACAGAGG + Intergenic
1199650083 X:149941034-149941056 CTAGATAAGGGGAGGGACAGAGG - Intergenic
1200926790 Y:8661888-8661910 CCAGATGAATGGAAGAACTGAGG + Intergenic
1200961890 Y:9003497-9003519 CCAGATGAAGGGAGGAAGAGAGG + Intergenic
1201586798 Y:15569986-15570008 CCAGAGGTGAGGAGGAACTGAGG - Intergenic