ID: 914675426

View in Genome Browser
Species Human (GRCh38)
Location 1:149904231-149904253
Sequence CAGATTAGGGGAGGAACTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675418_914675426 -3 Left 914675418 1:149904211-149904233 CCCAGGCTCAACACAGAAACCAG 0: 1
1: 0
2: 5
3: 20
4: 293
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675417_914675426 1 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675415_914675426 13 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675413_914675426 22 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675412_914675426 23 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675416_914675426 4 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
914675419_914675426 -4 Left 914675419 1:149904212-149904234 CCAGGCTCAACACAGAAACCAGA 0: 1
1: 0
2: 1
3: 26
4: 361
Right 914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675426 Original CRISPR CAGATTAGGGGAGGAACTGT GGG Exonic
900865688 1:5267205-5267227 CAGATAAGCGGAGCAACTGAGGG - Intergenic
901187199 1:7382160-7382182 CAGAGGAGGGTAGGAAATGTAGG + Intronic
901776719 1:11565269-11565291 CAGCTCAGGGCAGGAAATGTGGG - Intergenic
901836134 1:11925493-11925515 CTGAGTAGAGGAGGAACTGATGG + Exonic
902841880 1:19079736-19079758 CAGACTAGGAAAGGCACTGTGGG - Intronic
904298422 1:29538821-29538843 CAGATAATGGGAGAAACTCTTGG + Intergenic
905313703 1:37067892-37067914 CAGAGTGGGGGAAGAAATGTCGG - Intergenic
908337016 1:63136911-63136933 TAGATGAGGGCAGGAAATGTTGG - Intergenic
908937076 1:69389009-69389031 CATATTAGGGGATGAAGTATGGG - Intergenic
914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG + Exonic
916362012 1:163980895-163980917 CAGATTATGAAAGGAACTATTGG + Intergenic
917521565 1:175752136-175752158 CAGGTGGGGAGAGGAACTGTGGG + Intergenic
917560469 1:176147853-176147875 CAGATTAAGGGAGGCTCTGTTGG - Intronic
920984875 1:210877559-210877581 CAGATTTTGAGAGGAACTTTTGG - Intronic
921685874 1:218088603-218088625 CAGATTTAGGGAGGAAGTATTGG - Intergenic
922809915 1:228409599-228409621 CAGCTTAGGTGAGGCACTGGGGG - Intronic
924132634 1:240927851-240927873 CAGGTTTGGGGAGAAAGTGTAGG + Intronic
924826814 1:247548338-247548360 CAGCCTAGGGGAGGAAGTGGGGG + Intronic
1063405789 10:5793534-5793556 CTGATTAGGGGAGAAAATATTGG - Intronic
1063551657 10:7039577-7039599 CAGACTAGGGGTCAAACTGTGGG - Intergenic
1063934000 10:11058426-11058448 CAAATTAGGTGAGGTACTGTTGG + Intronic
1067800055 10:49352656-49352678 CAGATTAGGGTAGAAAATGATGG - Intergenic
1070251256 10:74775496-74775518 CAGAATAGAGGAAAAACTGTAGG - Intergenic
1074417664 10:113281494-113281516 CTGATTTGGGGAGAAACTGAGGG - Intergenic
1075257138 10:120934278-120934300 CAGATAAGGGGAGGCATTGGGGG - Intergenic
1077371635 11:2184961-2184983 AAGATGAGGGGAGGAAGTGAAGG - Intergenic
1079195899 11:18326819-18326841 AAGATGAGGGGAGGATCTGACGG - Intronic
1080485886 11:32705772-32705794 AAGAATAGAGGAGGAGCTGTGGG - Intronic
1083706840 11:64522565-64522587 AAGATTAGGGGTGGAATAGTAGG - Intergenic
1085125954 11:74002540-74002562 CAGATTAGGTGAGTTAATGTTGG + Intronic
1086753850 11:90533424-90533446 CAGATCAGAGGAGAAACTGTAGG + Intergenic
1086825787 11:91494080-91494102 GTGATTAGGGGAAGAGCTGTGGG + Intergenic
1088217593 11:107529931-107529953 CAGAAAGGGGTAGGAACTGTAGG + Intronic
1088590299 11:111397172-111397194 TGGATTGGGGGAGGAATTGTGGG - Intronic
1096223032 12:49844111-49844133 CTGATAAGGAGAGGAACTGAAGG + Intergenic
1097202342 12:57289868-57289890 CTGATTAGGGGTGGAGTTGTGGG - Intronic
1098068071 12:66641380-66641402 CAGATTGGGGGAGGAAGGGGTGG + Intronic
1100406044 12:94273639-94273661 CAGACTAGTAGAAGAACTGTGGG - Intronic
1101145196 12:101834028-101834050 CAGATTTTGAGAGGGACTGTGGG - Intergenic
1104131647 12:125899462-125899484 CAGATTTGGCCTGGAACTGTTGG + Intergenic
1105390330 13:19971131-19971153 CAGGTAAGGGGAAGAATTGTAGG + Intronic
1105405090 13:20127070-20127092 CAGCTTAGTGGAGGAGCTGTGGG + Intergenic
1105503547 13:20991751-20991773 CATTTAAGGGGAAGAACTGTGGG + Intronic
1107743887 13:43485003-43485025 CAGGACAGTGGAGGAACTGTGGG - Intronic
1107824127 13:44312292-44312314 CAGAAAAGGGGAGCAGCTGTGGG - Intergenic
1108112730 13:47093729-47093751 AAGATTGGAGGAGGAACAGTTGG - Intergenic
1112703923 13:102044318-102044340 CAGTTTAGGGGAGAAACAATAGG - Intronic
1114583381 14:23785932-23785954 CATATTATGGGAGGACCTGGTGG - Intergenic
1117022440 14:51585240-51585262 CAGATGTGGTGAGGAACTGGGGG - Intronic
1119326625 14:73763544-73763566 CTCATTGGGGGAGGAACAGTGGG - Intronic
1121536939 14:94697427-94697449 CCCAGTAGGGGAGGTACTGTTGG + Intergenic
1123695099 15:22873437-22873459 CAGAGGAGGGGAGGAGCTGTGGG - Intronic
1125383154 15:39109045-39109067 GAGATCAGGGGAAGAGCTGTGGG - Intergenic
1128700946 15:69803856-69803878 CAGCTTTGGGGAGGAAGTGCAGG + Intergenic
1128983720 15:72204228-72204250 CAGTTAATGGAAGGAACTGTTGG + Intronic
1129580418 15:76802966-76802988 CAGATTAAGGTAGTAACAGTAGG - Intronic
1134531768 16:14989416-14989438 CTGAGTAGAGGAGGAACTGATGG + Intronic
1136295823 16:29301565-29301587 CTGGTTAGGGAAGGAAGTGTGGG + Intergenic
1138064120 16:53922828-53922850 CAGAGTTGGGGAGGAAGTGAGGG + Intronic
1138696308 16:58816671-58816693 CAGAGGAGGGGATGAGCTGTAGG + Intergenic
1141254352 16:82386656-82386678 TAGATTAGGGGAGGAAGAGTGGG + Intergenic
1142101742 16:88275752-88275774 CTGGTTAGGGAAGGAAGTGTGGG + Intergenic
1144185879 17:12794561-12794583 GGGAGTAGGTGAGGAACTGTGGG + Intronic
1147487211 17:40828058-40828080 CAGATTAGGGCAGTTACAGTGGG - Intronic
1147679722 17:42233915-42233937 CAGATTAGGGCAGAAACATTTGG + Intronic
1149028437 17:52056993-52057015 CAGATTGGTGGAGCTACTGTAGG - Intronic
1151666455 17:75547873-75547895 AAGGTGAGGGGAGGAAGTGTAGG + Intronic
1152053719 17:78003866-78003888 CAGACTAGGGGCTGGACTGTAGG + Intergenic
1156778933 18:40826618-40826640 CACATGTGGTGAGGAACTGTGGG + Intergenic
1158930003 18:62314673-62314695 TAGATTATGGAAGGAACTATAGG + Intergenic
1159893820 18:73978156-73978178 CAGATTCGAGGGGGAAGTGTAGG - Intergenic
1161984738 19:7647124-7647146 CAGGTTAGGGGAGGAACCCCAGG - Intronic
1163730625 19:18947230-18947252 CACATCAGGGGAGGCACTGCGGG + Intergenic
1168370438 19:55829097-55829119 CAGATGAGGGTATGAAATGTTGG + Intronic
1168723980 19:58570705-58570727 CAGAGCAGGGGAGGGACTGCAGG - Intronic
925540495 2:4961303-4961325 CAGATTAGAGGCGTAACTGTGGG - Intergenic
925872047 2:8279717-8279739 CAGAGTAGGAGAGGAAGAGTAGG - Intergenic
926604767 2:14886419-14886441 CAGATGAGGGAAGGAACTGCAGG - Intergenic
927759936 2:25743812-25743834 GAGATTAGAGCAGGACCTGTTGG + Exonic
929373593 2:41256842-41256864 GAGATTAGGGCAGGAAATCTTGG - Intergenic
930043375 2:47146811-47146833 GAGGATAGGGGAGGAAGTGTAGG + Intronic
930664861 2:54091972-54091994 CAGACAAGGGCAGCAACTGTGGG + Intronic
930795806 2:55389590-55389612 CTGTTTAGGGAAGGAACTGAAGG - Intronic
933158698 2:79001377-79001399 GAGAAGAGGGGAGGAAATGTGGG - Intergenic
935152630 2:100451214-100451236 CTGATTAGGGAAGGAGCTGGAGG - Intergenic
936563496 2:113562984-113563006 TAGATTAGGGGAGGCAGGGTAGG - Intergenic
937086567 2:119175777-119175799 TGGGTTAGGGGAGGAACTGAAGG - Intergenic
937248549 2:120509645-120509667 CAGCTCAGGGGAGGAACAGAAGG + Intergenic
939810806 2:146829916-146829938 GAGATTAGGGGAAGAAATCTTGG - Intergenic
940982491 2:160019308-160019330 AAGATGAGGGGAAGAACTGAGGG - Intronic
944317659 2:198300711-198300733 CAGATTTGAGGAAAAACTGTGGG + Intronic
946306323 2:218858941-218858963 CAGGTTGGGGGAGGAACTCGAGG + Intergenic
947063090 2:226188911-226188933 CAGAGCAGGGGAGGAAGTTTGGG + Intergenic
1169283918 20:4291163-4291185 CAGGGTAGGGGAGGAACTAGAGG - Intergenic
1172956951 20:38767545-38767567 CAGAATGGAGAAGGAACTGTTGG + Exonic
1173549161 20:43920572-43920594 CAGGTTGGGGGAGGAGCTATAGG - Intronic
1173859357 20:46272262-46272284 CAAATTTGGGGAGGAAGAGTTGG + Intronic
1175336636 20:58200390-58200412 CAGAGTTGGGGAAGAACTGATGG + Intergenic
1179301891 21:40119276-40119298 ATGATTAGGAGAGGAACTATAGG + Intronic
1179770646 21:43612900-43612922 GAGATTAGGGCAGGAAATCTTGG - Intronic
1181727147 22:24819573-24819595 CAGATCAAGGGAGGCACTCTGGG - Intronic
1181728321 22:24826984-24827006 CAGATCAAGGGAGGCACTCTAGG - Intronic
1182090892 22:27594129-27594151 CAGATGAAGGGAGGGACTGGAGG + Intergenic
1182535018 22:30994586-30994608 CAGATTGGGGGCTGCACTGTCGG - Intergenic
1183262863 22:36807166-36807188 CAGCTTAGGGGAGGGAGTGGTGG + Intronic
1183477037 22:38041355-38041377 CAGGCTTGGGGAGGGACTGTTGG + Intronic
949361056 3:3232560-3232582 CAAATTAGGGCAGGCACAGTGGG + Intergenic
950028832 3:9838559-9838581 CAGATGAGGGGAGACAGTGTAGG - Intronic
950441105 3:13010983-13011005 CAGAGTGGTGGAGGAAGTGTGGG - Intronic
951913764 3:27777935-27777957 CAGAAGGAGGGAGGAACTGTAGG + Intergenic
953328136 3:42029893-42029915 CAGAATAGGGGAGGCACGATTGG + Intronic
954291071 3:49650320-49650342 CAGAAAAGGGGGAGAACTGTGGG - Intronic
957569894 3:81933096-81933118 CAGGTGTGGGGAAGAACTGTAGG + Intergenic
961082988 3:124042425-124042447 TGGAGTAGGGGAGGGACTGTTGG + Intergenic
961657530 3:128451619-128451641 CAGATGAGACGAGGAACGGTGGG + Intergenic
964078369 3:152720801-152720823 TAGCTTAGGGGAGGAAGTATAGG + Intergenic
965611112 3:170544883-170544905 CAGATTAGGGACTGGACTGTAGG + Intronic
968270815 3:197402295-197402317 CAGATTTGGAAAGGACCTGTAGG + Intergenic
971349440 4:25843210-25843232 TGGATTATGGGAGGAACTGGGGG + Intronic
972718630 4:41674189-41674211 CAGATAGGAGGAGGAAGTGTGGG - Intronic
974070981 4:57123396-57123418 GAGATTAGGGCAGGAAATCTTGG + Intergenic
974958720 4:68673898-68673920 TAGATTGGGTGAGGAACTGAAGG - Intergenic
975494086 4:75018924-75018946 CAGAGTTGGGGAAGAACTGATGG + Intronic
976008636 4:80460475-80460497 CAGATGAGGGGAGAAAGTGCAGG - Intronic
982099398 4:151953513-151953535 CAGCTGAGGGGAGGTGCTGTTGG - Intergenic
982955937 4:161766352-161766374 CAGATGAGGGGAGGCACAGCAGG - Intronic
986981869 5:13457415-13457437 AAGATGAGGGGAGGTACTGGTGG + Intergenic
987244701 5:16037122-16037144 CATATTAGGAGAGTGACTGTTGG + Intergenic
987415149 5:17654669-17654691 CACATTATGGGAGGCAGTGTGGG - Intergenic
988850406 5:35174798-35174820 CAGCTTCTGGGAGGAAATGTTGG + Intronic
992028762 5:72699086-72699108 CAGATTAGAGGAGGATGTGCTGG + Intergenic
993333261 5:86625798-86625820 CAGGTTAAGGAAGGAAATGTGGG - Intergenic
993497997 5:88629755-88629777 CAAATTAGAGGTGGAATTGTTGG - Intergenic
993713875 5:91255089-91255111 CAGAGTAGAGGAGGAGCTCTGGG + Intergenic
997188889 5:131911164-131911186 CACATTAAGTTAGGAACTGTAGG - Intronic
997786280 5:136716971-136716993 CAGATTAATGGAGAAACTGATGG + Intergenic
998261541 5:140635495-140635517 CATCTTAGGGGAGGCACTCTGGG + Intergenic
1000936974 5:167313658-167313680 CATTTTAGGGGAGGAAATGGAGG - Intronic
1002337400 5:178489354-178489376 CAGACTAGGGGCTGCACTGTCGG + Intronic
1003223912 6:4187915-4187937 AAGATTAAGGTAGGAACTGACGG + Intergenic
1004222540 6:13759116-13759138 CAGACTGGGGGAGCCACTGTGGG - Intergenic
1007335077 6:41150062-41150084 CAGATTTGGGGAGAAACTTGGGG - Intronic
1007765093 6:44155281-44155303 CAGATCCCAGGAGGAACTGTGGG - Exonic
1008039059 6:46776695-46776717 CAGATGAGGGTAAGCACTGTGGG + Intergenic
1012161224 6:95888162-95888184 CAGATGAGAGGTTGAACTGTGGG - Intergenic
1012531629 6:100244960-100244982 CAGAGTAGGGGAGGATCCGATGG - Intergenic
1013087771 6:106871131-106871153 GAGATGAGGGAAGAAACTGTTGG + Intergenic
1013420921 6:109966021-109966043 TAGATTACGGGAGACACTGTAGG - Intergenic
1014706335 6:124751880-124751902 GAGATGATGGGAGGAACTCTTGG + Intronic
1015040323 6:128708515-128708537 CAGATTTGGGGAGCAACAATTGG + Intergenic
1015078128 6:129188233-129188255 CACATTAGGGTAGGAATTCTAGG - Intronic
1018023217 6:159782538-159782560 CAGATTAGGAGAAAAAGTGTTGG + Intronic
1024289516 7:47791992-47792014 CTGCCTAGGGGAGGAACTATTGG - Intronic
1027188589 7:75985572-75985594 CAGAGTTGGGGTGGACCTGTGGG - Exonic
1027438639 7:78194644-78194666 GAGATTAGGGGAAGAAAAGTAGG + Intronic
1027444349 7:78255328-78255350 CAGATCATGGGAGGCACTATGGG + Intronic
1028360956 7:89965593-89965615 CAGATTAGACAAGGAACTATGGG + Intergenic
1029238533 7:99143194-99143216 CAGGTTTGGGGAGGAAAGGTGGG + Intronic
1030129048 7:106181058-106181080 CAGATTCGGTCAGGAACTCTGGG + Intergenic
1030386222 7:108871035-108871057 CAGATAAGAGGAGGAACAGCTGG - Intergenic
1030399108 7:109026406-109026428 CAGATTATGGTAGAAACTGTGGG + Intergenic
1031393744 7:121247606-121247628 TAGATGAGTGAAGGAACTGTGGG + Intronic
1032734137 7:134674397-134674419 TGGAATAGGGGAGGAACTGGGGG - Intronic
1035084889 7:156249645-156249667 GAGAACAGGGGAGGAAGTGTGGG + Intergenic
1037472291 8:19222687-19222709 CAGCTTAGGGGAAAAAATGTAGG + Intergenic
1037583701 8:20261975-20261997 CAGCTTAGGGGAGGAGGTGTGGG - Intronic
1037800695 8:22033765-22033787 CAGAGTAGGGGAGGAAGAGGAGG - Intronic
1038348999 8:26759609-26759631 CTGACTCGGGGAGGCACTGTGGG + Intronic
1038689051 8:29744525-29744547 CAGGTTAGGGAAGGAGCTGCTGG - Intergenic
1038885620 8:31659542-31659564 CAGATTGGGGTAGGAGCTTTTGG + Intronic
1040733007 8:50472602-50472624 CAGATTAGGCAAGGAATTTTTGG + Intronic
1040851405 8:51904489-51904511 CAGATTAGGAGAAGAAAGGTGGG - Intergenic
1041151480 8:54939798-54939820 GAGATCATGGGAGGAACTCTTGG - Intergenic
1042877798 8:73455671-73455693 CACTTTAGGGGAGGAAATGACGG - Intronic
1045670694 8:104550028-104550050 CAGATTAGGGGTTGAAATTTGGG - Intronic
1045766202 8:105673615-105673637 AATATTAGTGGAGGAACTCTTGG - Intronic
1046506332 8:115142483-115142505 CAGATTAGGAGAGGAGCAGGTGG + Intergenic
1047044121 8:121032685-121032707 CATGTTAGGGCAGGAACTGAAGG + Intergenic
1049889235 9:52741-52763 TAGATTAGGGGAGGCAGGGTAGG + Intergenic
1050178260 9:2892260-2892282 TAGATAAGGGGAGGGACTGCAGG + Intergenic
1053555367 9:39131870-39131892 CAGATTAGGGAAGGCAATGCAGG + Intronic
1053730719 9:41054026-41054048 TAGATTAGGGGAGGCAGGGTAGG + Intergenic
1054697780 9:68378054-68378076 TAGATTAGGGGAGGCAGGGTAGG - Intronic
1056897286 9:90562921-90562943 CACATGAGGGGAGGAGCTGGAGG - Intergenic
1056970288 9:91195698-91195720 CAGATCAGGGGAGGAGCTCAAGG - Intergenic
1059379569 9:113912679-113912701 AAGACGAGGGGAGGAACTCTAGG - Intronic
1061283859 9:129611443-129611465 CAGACTAGGAGAGAAACCGTGGG + Intronic
1191716760 X:64199072-64199094 CAAATTAGGGGAGGAGCTGAAGG - Intronic
1191871219 X:65747189-65747211 CAGATTAGGTGATGAATTGGAGG - Intergenic
1192575760 X:72241937-72241959 CAGAATAGGGGAGAAGATGTAGG + Intronic
1193977759 X:88144125-88144147 CCGATTAGGTGGGGAGCTGTGGG - Intergenic
1195049044 X:101080170-101080192 GAGCTTAGGGGAGGAACAGAAGG + Intronic
1199539650 X:148944984-148945006 CAAATTAAGGGAGAAACTGCAGG + Intronic
1202304081 Y:23449550-23449572 GAGATTAGGCGAGGACCTTTTGG - Intergenic
1202566729 Y:26221041-26221063 GAGATTAGGCGAGGACCTTTTGG + Intergenic