ID: 914675427

View in Genome Browser
Species Human (GRCh38)
Location 1:149904234-149904256
Sequence ATTAGGGGAGGAACTGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675415_914675427 16 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675417_914675427 4 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675413_914675427 25 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675416_914675427 7 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675418_914675427 0 Left 914675418 1:149904211-149904233 CCCAGGCTCAACACAGAAACCAG 0: 1
1: 0
2: 5
3: 20
4: 293
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675419_914675427 -1 Left 914675419 1:149904212-149904234 CCAGGCTCAACACAGAAACCAGA 0: 1
1: 0
2: 1
3: 26
4: 361
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247
914675412_914675427 26 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675427 Original CRISPR ATTAGGGGAGGAACTGTGGG AGG Exonic
900423013 1:2563781-2563803 ATTTGGGGAGATGCTGTGGGAGG + Exonic
900800909 1:4736460-4736482 ATTAGAGGAAGATGTGTGGGAGG - Intronic
900803478 1:4752129-4752151 ATTAAAGGAGGAACAGAGGGAGG + Intronic
901302800 1:8211781-8211803 CTTAGGGGAGGAAATGAGGGTGG - Intergenic
901768974 1:11521037-11521059 CTCTGGGGAGGTACTGTGGGCGG + Intronic
903146985 1:21380285-21380307 ATTAGGCCAGGCACTTTGGGAGG - Intergenic
904876245 1:33656650-33656672 AGCAGGGGAGGCAGTGTGGGAGG + Intronic
905079910 1:35309040-35309062 ATTTGGGGAGAAATGGTGGGTGG + Intronic
905539941 1:38752637-38752659 GATATGGGAGGAACTGTGGATGG - Intergenic
905655529 1:39684140-39684162 CGTAGGGGAAGAACTGAGGGGGG + Exonic
906268961 1:44459431-44459453 ATTAGGGGGGGTTCTGTGTGAGG - Intronic
909773267 1:79453021-79453043 AGTAGTGGAGGAAGGGTGGGTGG - Intergenic
913520789 1:119644150-119644172 ATTAGGGGAGAGGCTGAGGGTGG + Intronic
913944230 1:125142619-125142641 ATGAGGGAAGGAAGTGAGGGAGG + Intergenic
914675427 1:149904234-149904256 ATTAGGGGAGGAACTGTGGGAGG + Exonic
916297691 1:163237710-163237732 AGGAGGGCAGGAACAGTGGGGGG + Intronic
916560012 1:165926543-165926565 ATTAGAGGAGGGACTGAGGGAGG - Intergenic
918084549 1:181234764-181234786 ATGAGGGCAGGAGCAGTGGGAGG - Intergenic
920517712 1:206598917-206598939 ATTTGGGGAGGATGTCTGGGAGG - Intronic
921323555 1:213967793-213967815 AGTAGGGGAGGGATTGTGGGGGG + Intergenic
921526458 1:216224136-216224158 ATTAGGGAAGAAACTTTTGGGGG + Intronic
922142204 1:222899234-222899256 TTTGGGGGAGGAGTTGTGGGGGG + Intronic
1062798713 10:363468-363490 AGTACGGGAAGAACTGTGGGAGG + Intronic
1065024672 10:21528688-21528710 TTGATGGGGGGAACTGTGGGAGG - Intergenic
1065847424 10:29757620-29757642 ATTAGGACAGGAATTGGGGGTGG - Intergenic
1067775275 10:49160152-49160174 ATTAGGTGAGGAATTGTTGGGGG + Intronic
1069579788 10:69558404-69558426 ATTAGGTGATGACATGTGGGTGG + Intergenic
1069709921 10:70481627-70481649 AATAGGAGAGGAACTGTCTGGGG + Intronic
1070496595 10:77029865-77029887 ATTAGGTCAGGAAATGAGGGGGG + Intronic
1070726319 10:78793685-78793707 AGTAGGGGAGGAACAGAAGGGGG - Intergenic
1071398646 10:85247447-85247469 ATTCGGGGAGGCACAGAGGGAGG + Intergenic
1071496494 10:86170928-86170950 GTTGGGGGAGGAAGCGTGGGGGG - Intronic
1073035994 10:100564613-100564635 AATAGGAGTGGAACTGAGGGTGG + Intergenic
1074230715 10:111532262-111532284 ATTAGGGGAGGGAGTGAGGGTGG - Intergenic
1074417661 10:113281491-113281513 ATTTGGGGAGAAACTGAGGGGGG - Intergenic
1076141028 10:128078596-128078618 ATAAGGGGTGGGACAGTGGGTGG - Intronic
1076776168 10:132699409-132699431 ATGAGGAGAGCAGCTGTGGGTGG + Intronic
1077041534 11:526482-526504 GTTAGGGGAGACACTGGGGGCGG - Intergenic
1077081435 11:726215-726237 CCTGGGGGAGGAAGTGTGGGGGG + Intronic
1079978340 11:27121279-27121301 ATTAGGGGAGGAAGTCAGGTAGG + Intronic
1080431944 11:32207529-32207551 ACTAGAGGAGGAACTCTGTGAGG + Intergenic
1085640120 11:78188291-78188313 ATGAGGGTCGGGACTGTGGGAGG - Intronic
1086914495 11:92513146-92513168 ATTAGTAGAGAAATTGTGGGTGG - Intronic
1090118845 11:124003178-124003200 AATTGGGGAGGAAGTGTGGATGG - Intergenic
1090726754 11:129534042-129534064 ATTAGGTGAGGAGATGTGGATGG - Intergenic
1092057689 12:5521423-5521445 ATGAGGGAAGAAACTGAGGGTGG + Intronic
1092282229 12:7106919-7106941 ATGAGGAGGGGAAATGTGGGTGG + Intronic
1097216531 12:57418197-57418219 AAGAGGGGAGGAATTGTGGATGG - Intronic
1099092128 12:78325389-78325411 AGTAGGGGAGGAAGTTTGTGAGG + Intergenic
1100016930 12:90023118-90023140 ATTAAGGGAGGAGCTCTGGGAGG + Intergenic
1100666389 12:96758185-96758207 ATCAGAGGAGGAAAGGTGGGAGG + Intronic
1100820585 12:98425946-98425968 ATTACAGGAGCAACTGCGGGGGG - Intergenic
1101819692 12:108174224-108174246 ATGTGGGGAGGGAATGTGGGTGG - Intronic
1101926743 12:108978072-108978094 ATTAGGGGGGGAAATGTTGTGGG + Intronic
1103793659 12:123488842-123488864 ACAAGGGGAGGAAATGTTGGAGG + Intronic
1104033800 12:125084366-125084388 AGGAGGGGAGGAAGTGAGGGAGG - Intronic
1105602359 13:21898717-21898739 AACAGGTGAGGAAGTGTGGGAGG - Intergenic
1105924364 13:24993650-24993672 ATTTGAGAAGGAAGTGTGGGTGG - Intergenic
1105999479 13:25707050-25707072 ATTATGGTAAGATCTGTGGGTGG - Intronic
1108761269 13:53568479-53568501 ATTTGGGGAGGAAGTGGGAGCGG + Intergenic
1109148411 13:58812590-58812612 ACTTGGGGAGGGAGTGTGGGAGG - Intergenic
1110881427 13:80577477-80577499 AGTAGGGGATGTACTGGGGGAGG - Intergenic
1111096595 13:83523699-83523721 GAAAGGGAAGGAACTGTGGGAGG - Intergenic
1111628731 13:90822956-90822978 ATGTGGGCAGGTACTGTGGGTGG - Intergenic
1111924225 13:94445868-94445890 GGCAGGGGAGAAACTGTGGGGGG + Intronic
1113281394 13:108792372-108792394 ATTAGGGGAAGCTCTGTGGAGGG - Intronic
1113991175 14:16029424-16029446 AGGGGGGGAGGAACTGCGGGAGG - Intergenic
1114170003 14:20262739-20262761 ATTAGAGGAGGAAGTCAGGGTGG + Intronic
1117654088 14:57936756-57936778 ACTAGGGGAGGAGTTGTAGGAGG + Intronic
1117673130 14:58127841-58127863 ATTAAGGGAAGAAGTGCGGGGGG + Intronic
1118934016 14:70269599-70269621 ATTAGGTGGGGAAGTGTTGGTGG + Intergenic
1119145868 14:72313524-72313546 ATAAGGGGAGAAACTGTGGCAGG - Intronic
1120706355 14:87750170-87750192 ATTATGGCATGAACGGTGGGCGG + Intergenic
1122938434 14:104970538-104970560 ATGGGGGGAGGAGCTGTGGAGGG - Intronic
1124557097 15:30736257-30736279 GTTACGGGAGGCACAGTGGGAGG + Intronic
1126511230 15:49477115-49477137 TATAATGGAGGAACTGTGGGGGG - Intronic
1126783893 15:52161186-52161208 ATAATGGGAGAATCTGTGGGCGG + Intronic
1128383763 15:67132540-67132562 AGAATGGGAGGAATTGTGGGAGG + Intronic
1129261097 15:74367746-74367768 AGTAGGGGAGGAGCTGTCTGCGG - Intergenic
1130314965 15:82787357-82787379 ATCGGGGGAGGAACTGGGGCTGG - Exonic
1131012056 15:89026368-89026390 ATGTGGCAAGGAACTGTGGGTGG - Intergenic
1131067111 15:89441575-89441597 CTGAGGGGAGCACCTGTGGGTGG + Intergenic
1132480783 16:165210-165232 GTCAGGGCAGGAACTGTGGGAGG - Intronic
1132501046 16:284822-284844 ATGAGGGCAGTGACTGTGGGTGG + Intronic
1133354715 16:5127421-5127443 TTGAGGGGAGGAACTCTGGCGGG + Intergenic
1134596348 16:15499092-15499114 ATTTGGGGAGGAATCCTGGGAGG - Intronic
1134875925 16:17698647-17698669 ATTGGGGTAGGAAGTGTGAGAGG - Intergenic
1135190368 16:20349262-20349284 ATGAGGGAAGGATCTCTGGGTGG - Intronic
1135480651 16:22818146-22818168 CCTCGGGGAGGAAATGTGGGTGG - Intronic
1136910361 16:34140556-34140578 AGGAAGGGAGGAACTGAGGGAGG - Intergenic
1137744369 16:50810001-50810023 AGTAGAAGAGCAACTGTGGGAGG + Intergenic
1137833863 16:51571829-51571851 ATTTGAGGAGCAACTGTGCGTGG - Intergenic
1143606355 17:7988632-7988654 ATGAGGGGAGGGCCTTTGGGAGG + Intergenic
1143606823 17:7991778-7991800 ATGAGGGGAGGGCCTTTGGGAGG - Intergenic
1144203116 17:12958931-12958953 ATTAGGGGAGGTGGTGGGGGTGG + Intronic
1146661801 17:34669825-34669847 AGAAGGGGAGGCACAGTGGGAGG - Intergenic
1148525586 17:48329832-48329854 ATTAGTGGAGGAACTTGGGCAGG + Intronic
1149666085 17:58365469-58365491 ATTGGGGTAGGAACAGTGGAAGG + Intronic
1151676611 17:75602034-75602056 AGGAGGAGAGGAACTGGGGGTGG + Intergenic
1152699224 17:81810940-81810962 TAGAGGGGAGGAACTGTGGGGGG + Intronic
1153280527 18:3410453-3410475 ATTATGGGTGGAAATGGGGGAGG + Intergenic
1153471731 18:5453901-5453923 ATTAGGGCAGGAAGCATGGGGGG - Intronic
1154277920 18:12978182-12978204 ATTAAAGGAGGAAACGTGGGAGG + Intronic
1154488221 18:14896077-14896099 TATAATGGAGGAACTGTGGGGGG + Intergenic
1156736984 18:40272272-40272294 ATTATGGGAAGGACTGTGTGTGG - Intergenic
1156839129 18:41590621-41590643 AGGAGGGGAGGAACCTTGGGTGG - Intergenic
1158358899 18:56650066-56650088 ATGTGGTAAGGAACTGTGGGTGG + Intronic
1159545773 18:69838833-69838855 ATTAGGGGAGGAACTAGGGGAGG - Intronic
1164782434 19:30903867-30903889 ATAAGTAGAGGAACTGTGGAGGG - Intergenic
1164887764 19:31797505-31797527 AAAAGGTGAGGAAATGTGGGTGG + Intergenic
1165782449 19:38442266-38442288 ACTAGGGGAGGGAGTGTGGCAGG + Intronic
1166566756 19:43770240-43770262 GTTAGGGGAGGATGAGTGGGAGG - Intronic
1166638941 19:44477458-44477480 AGTAAGGGAGGAACTATGAGAGG + Exonic
927409529 2:22808286-22808308 ATGTGGTAAGGAACTGTGGGTGG + Intergenic
928930450 2:36618616-36618638 AATAGGTGAGCAATTGTGGGAGG - Intronic
929227758 2:39527839-39527861 ATTAGGGCAGGAACTGTGCCTGG + Intergenic
929373590 2:41256839-41256861 ATTAGGGCAGGAAATCTTGGGGG - Intergenic
930043376 2:47146814-47146836 GATAGGGGAGGAAGTGTAGGAGG + Intronic
930779315 2:55207701-55207723 ACCAGGGGAGCAACTGTGAGGGG + Intronic
931917031 2:66967605-66967627 ATTAGGGGATCAATTTTGGGAGG - Intergenic
931919428 2:66997010-66997032 AATAGGGGAGGGAGTGAGGGAGG - Intergenic
932095964 2:68848676-68848698 TTTCGGGGAGGAATGGTGGGGGG + Intergenic
932682634 2:73839207-73839229 ATTAGGGAAGCTACTGAGGGGGG - Intronic
933714579 2:85350698-85350720 ATTAGTGGAGGCACTGGGGGTGG - Intronic
936563493 2:113562981-113563003 ATTAGGGGAGGCAGGGTAGGGGG - Intergenic
938169016 2:129058429-129058451 AGCAGGGGAGCAACTGAGGGTGG - Intergenic
939836660 2:147137414-147137436 ATGAGGGGAGGACCTGTGCCAGG + Intergenic
941020180 2:160399445-160399467 ATTAGGGGAGAAACTGGGCAGGG - Intronic
941843265 2:170109947-170109969 ATGAGTGGAGGCACTGTGTGAGG + Intergenic
944021609 2:195112632-195112654 ACTTGGGGAGGAAGAGTGGGTGG - Intergenic
947063091 2:226188914-226188936 AGCAGGGGAGGAAGTTTGGGAGG + Intergenic
948001619 2:234572505-234572527 ATGAGGGGATGCACTGAGGGTGG + Intergenic
948768031 2:240233454-240233476 AGTGGGGGAGGTGCTGTGGGCGG - Intergenic
948866967 2:240780471-240780493 ATTGCGTGGGGAACTGTGGGAGG - Intronic
1169388261 20:5169146-5169168 AATGGCTGAGGAACTGTGGGAGG + Intronic
1169868959 20:10231130-10231152 ATGGGGGCAGGAAGTGTGGGGGG - Intronic
1171213859 20:23337566-23337588 ATTTGGGGAGGAGCTGAGTGAGG - Intergenic
1171770695 20:29320226-29320248 AGGAAGGGAGGAACTGAGGGAGG + Intergenic
1171905825 20:30899279-30899301 AGGAAGGGAGGAACTGAGGGAGG - Intergenic
1171951075 20:31423084-31423106 ATTAGGGGAGGAAATGAGCAGGG - Intergenic
1173190380 20:40871377-40871399 AGGAGAGGAGGAGCTGTGGGTGG - Intergenic
1174117418 20:48236620-48236642 ATTAGGGCTGGGGCTGTGGGAGG - Intergenic
1174299459 20:49570857-49570879 ATTAGTGGGGGAGCTGAGGGGGG + Intergenic
1174895360 20:54443635-54443657 AATAGGGCAGGAAATGAGGGAGG - Intergenic
1175027312 20:55915849-55915871 ATTTGGGGAGGAAGGTTGGGAGG + Intergenic
1176727209 21:10448046-10448068 ATTAGGGTAGGAAATTTGGTGGG + Intergenic
1177660484 21:24076309-24076331 ATTAGATGAGGAACTGGGGGAGG + Intergenic
1179629836 21:42669528-42669550 ATTAGGAGATGAACCTTGGGAGG + Intronic
1180287186 22:10759005-10759027 ATTAGGGTAGGAAATTTGGTGGG - Intergenic
1180316093 22:11278100-11278122 AGGGGGGGAGGAACTGCGGGAGG + Intergenic
1180339245 22:11605388-11605410 AGGAAGGGAGGAACTGAGGGAGG - Intergenic
1180512617 22:16107708-16107730 ATTGGTGAAGGAACTGTGTGTGG - Intergenic
1180715602 22:17870061-17870083 ATGAGGGGAAGGACTGTGGAGGG + Intronic
1182306799 22:29375390-29375412 ATTAGGGGAGGAAGTCTGTGGGG - Intronic
1182831284 22:33306537-33306559 CTTAGGAGAGGGACTGTGGCAGG - Intronic
1182900669 22:33895641-33895663 ATGTGGCAAGGAACTGTGGGTGG - Intronic
1183171217 22:36189685-36189707 ATTGGGGGAGGAAGAGAGGGAGG - Exonic
1183437287 22:37803462-37803484 ATTAGGGGAGGAAGGGGGAGGGG - Intergenic
950560344 3:13717796-13717818 ATGAGGGCAGGGGCTGTGGGTGG + Intergenic
954115939 3:48466815-48466837 GGTGGTGGAGGAACTGTGGGAGG - Exonic
957803051 3:85110273-85110295 AATAAGAGAGAAACTGTGGGGGG + Intronic
959913984 3:111795618-111795640 ATTAAAGGAGGCAGTGTGGGTGG - Intronic
961572911 3:127813280-127813302 AGGAGGGGAGAAACTGTGGGAGG - Intronic
964921141 3:161897137-161897159 AGTAGGGGAGGCATTGTGTGGGG - Intergenic
966317091 3:178659878-178659900 ATTAGGTGGGAAACTGTGTGGGG - Intronic
967491215 3:190093015-190093037 ATAAAGGGAGGAATTTTGGGTGG - Intronic
970260695 4:14221336-14221358 GTCATGGGAGGGACTGTGGGAGG - Intergenic
970617200 4:17779706-17779728 AGTATGGGAGGAACAGTGAGGGG - Intronic
971148879 4:24009879-24009901 ATTAGAAGAGGAGGTGTGGGTGG - Intergenic
971364619 4:25967814-25967836 ATTAGGGGAGGGAATGTTAGGGG + Intergenic
973266756 4:48218935-48218957 AATAAGAGAGGCACTGTGGGTGG + Intronic
973864287 4:55096211-55096233 AGGAGGTGAGTAACTGTGGGTGG - Exonic
976408966 4:84691107-84691129 ATTTGGGAAGGGACTGTTGGAGG + Intronic
977252322 4:94703125-94703147 ATTAGGGGAGGCAGAGTGAGGGG - Intergenic
978611400 4:110545139-110545161 AATAGGTGAGCAACTGTGGCAGG + Intronic
985095592 4:186409503-186409525 GATAGGGGAGGAAATGAGGGAGG + Intergenic
990306056 5:54494897-54494919 ATGTGGCAAGGAACTGTGGGTGG - Intergenic
991208125 5:64073476-64073498 ATGAAGGGAGGAAGGGTGGGAGG - Intergenic
991607378 5:68416575-68416597 ATTGTGGGAGGAATTGTGGGAGG + Intergenic
992716419 5:79514659-79514681 ATTAGGGAAGGAGCAGGGGGAGG + Intergenic
993730216 5:91413242-91413264 TTTAGTAGAGGAACTGGGGGAGG + Intergenic
994031061 5:95143552-95143574 ATTAGAGGAGGAAGGGAGGGAGG - Intronic
996064767 5:119068580-119068602 ATTAGGAGATGATCTGTGAGGGG + Intronic
996685602 5:126277058-126277080 ATTAGGGCAGCCACTGTGGATGG - Intergenic
998261542 5:140635498-140635520 CTTAGGGGAGGCACTCTGGGTGG + Intergenic
1000042009 5:157491771-157491793 ATGAGGGCAGGCCCTGTGGGTGG - Intronic
1003515368 6:6813531-6813553 TTTGGGGAAGGAACAGTGGGAGG + Intergenic
1003539478 6:7005588-7005610 ATAAAGGGAATAACTGTGGGAGG - Intergenic
1003977630 6:11358765-11358787 ATTATGGGATGAATGGTGGGTGG + Intronic
1004203590 6:13572257-13572279 ATGAGGGGAGTTACTGTGGAGGG + Intergenic
1010007698 6:71013211-71013233 ATTTGGGGAGGAAGCGGGGGTGG + Intergenic
1010083189 6:71887057-71887079 ATGGGGGGAGGCACCGTGGGTGG - Exonic
1011750810 6:90452973-90452995 ACTGGTGGAGGAACTTTGGGAGG + Intergenic
1016349613 6:143153181-143153203 AGTAGGGAAGGAAATGTGCGAGG + Intronic
1017229122 6:152053202-152053224 ACTAAGGGAGGGACTGAGGGAGG - Intronic
1018300671 6:162399187-162399209 AATTGGGTAGGAACTGTGGAAGG + Intronic
1018300920 6:162402420-162402442 AGTAGGGGGGCAACTGTGAGTGG - Intronic
1019684568 7:2373888-2373910 AGGAGGGGAGGAGATGTGGGAGG - Intronic
1020008848 7:4797451-4797473 TTTGTGGGAGGAACTGTTGGTGG + Intronic
1020876541 7:13702200-13702222 AGGAGGGGAGGAACGGAGGGAGG - Intergenic
1021273497 7:18621974-18621996 ATTTGGGCAGGAACTGTGCCAGG + Intronic
1021473565 7:21034537-21034559 ATTAGGGGAGGGTGTGAGGGAGG - Intergenic
1022972152 7:35528210-35528232 GTTAGGGCAGGAACTGAGGCTGG + Intergenic
1024289514 7:47791989-47792011 CCTAGGGGAGGAACTATTGGTGG - Intronic
1024931693 7:54671122-54671144 ATAAGGGGTGGAAATGTGGGTGG + Intergenic
1027263465 7:76480958-76480980 AGTGGGAGAGGCACTGTGGGAGG + Intronic
1027314838 7:76979057-76979079 AGTGGGAGAGGCACTGTGGGAGG + Intergenic
1029276763 7:99409749-99409771 ATGAGAGGAGGCTCTGTGGGCGG + Intronic
1032772910 7:135077387-135077409 TTTAGGAGATGAACTGTAGGTGG - Intronic
1032913908 7:136465313-136465335 ACTTGGCCAGGAACTGTGGGTGG + Intergenic
1033046534 7:137967504-137967526 GTTGGGGGAGTGACTGTGGGAGG - Intronic
1033384286 7:140856254-140856276 GTTGGGGGAGGAACAGAGGGAGG + Intronic
1033961055 7:146913697-146913719 ATTAGGAGAGGGGCTTTGGGAGG - Intronic
1034010293 7:147522185-147522207 AAGAGGTGGGGAACTGTGGGAGG - Intronic
1034602892 7:152279909-152279931 ATTAGGGTAGGAAATTTGGTGGG - Intronic
1034946730 7:155267135-155267157 GTTAGGGGAGGAGCTCAGGGTGG - Intergenic
1035981827 8:4381234-4381256 ATTAGGGGAGCATCTGAGTGAGG + Intronic
1036088081 8:5635545-5635567 GTTGTGGGAGGGACTGTGGGAGG - Intergenic
1036291113 8:7491554-7491576 ACTAGGTGAGCACCTGTGGGAGG - Intergenic
1036330377 8:7819982-7820004 ACTAGGTGAGCACCTGTGGGAGG + Intergenic
1037957043 8:23068346-23068368 ATTAAGGCAGGAACTGAGCGAGG + Intronic
1038890424 8:31715667-31715689 TTTAGGGAAGGAACTGTGTTGGG + Intronic
1040903127 8:52437997-52438019 ATTATCTGAGGAACAGTGGGTGG - Intronic
1041712759 8:60909044-60909066 GTTAGGGGAAGAAGTGAGGGAGG - Intergenic
1042467098 8:69140680-69140702 ATAAGGGGAGGAACTGCAGTGGG + Intergenic
1042877797 8:73455668-73455690 TTTAGGGGAGGAAATGACGGTGG - Intronic
1043867834 8:85395729-85395751 ATTAGGGGATGAATTGGGGAGGG + Intronic
1044979949 8:97706833-97706855 ACTTTGGGAGGTACTGTGGGAGG + Intronic
1045666113 8:104486744-104486766 AATAAGGGAGAAACTTTGGGAGG + Intergenic
1047624929 8:126646896-126646918 ACTGGGGGTGGAACAGTGGGAGG + Intergenic
1049889238 9:52744-52766 ATTAGGGGAGGCAGGGTAGGGGG + Intergenic
1051375509 9:16398501-16398523 ATTAGAGGAAAATCTGTGGGTGG - Intergenic
1052003558 9:23318362-23318384 ATTAGCTGATGAACTATGGGTGG - Intergenic
1052876957 9:33574605-33574627 AATTGGGGAGCACCTGTGGGAGG + Intergenic
1053288808 9:36866661-36866683 CTTCGGTGAGGAACTGAGGGGGG + Intronic
1053499053 9:38569781-38569803 AATTGGGGAGCACCTGTGGGAGG - Intronic
1053621576 9:39824916-39824938 TATAATGGAGGAACTGTGGGGGG + Intergenic
1053730722 9:41054029-41054051 ATTAGGGGAGGCAGGGTAGGGGG + Intergenic
1053883522 9:42619389-42619411 TATAATGGAGGAACTGTGGGGGG - Intergenic
1053889147 9:42674909-42674931 TATAATGGAGGAACTGTGGGGGG + Intergenic
1054222541 9:62426853-62426875 TATAATGGAGGAACTGTGGGGGG - Intergenic
1054228169 9:62482322-62482344 TATAATGGAGGAACTGTGGGGGG + Intergenic
1054697777 9:68378051-68378073 ATTAGGGGAGGCAGGGTAGGGGG - Intronic
1054813072 9:69450187-69450209 AATTGGGGAAGCACTGTGGGAGG - Intronic
1056774901 9:89504669-89504691 ATTAGAGAAGGCACAGTGGGAGG + Intergenic
1058245339 9:102616223-102616245 TTTATGGGAGAAACTGTGGAAGG + Intergenic
1059408397 9:114116599-114116621 AGTGGGAGAGGAACCGTGGGAGG - Intergenic
1059487032 9:114634713-114634735 ATTCGTGGAGGAACTGAGGCAGG - Intronic
1060211717 9:121714677-121714699 ACTAGGGGAGGAGCTGGGGCTGG - Intronic
1061405675 9:130391925-130391947 ATGGTGGGAGGAACTGAGGGTGG - Intronic
1186335213 X:8579668-8579690 CTTAGGTGAGGAGGTGTGGGAGG - Intronic
1186590798 X:10927973-10927995 ATTTGGGGAGCAACTGAAGGGGG + Intergenic
1188005597 X:25013868-25013890 ACTGGGGGAGCAACTGCGGGCGG - Intronic
1189231667 X:39456797-39456819 AATAGGGGAGGATCAGAGGGAGG + Intergenic
1192948071 X:75987025-75987047 CTTAATGGAGGAGCTGTGGGAGG + Intergenic
1193406832 X:81110776-81110798 TTTAGGAGAGAAACTGTGTGAGG + Intergenic
1195470453 X:105223675-105223697 ATTAGGGCTTGAACTGTGGCAGG + Intronic
1197012249 X:121580071-121580093 ATTAGGGGAGGAAAAGGGGATGG + Intergenic
1197494601 X:127161950-127161972 ATTGGGGGAGGAAATGGGGTGGG + Intergenic
1198311794 X:135432425-135432447 AATAGGGGAGGAAAGGAGGGGGG - Intergenic
1198766753 X:140088023-140088045 CTCAGGGGCGGAGCTGTGGGAGG + Intergenic
1199600578 X:149539348-149539370 ACTGGGGGTGGAGCTGTGGGTGG - Intergenic
1199649970 X:149940459-149940481 CTGGGGGGCGGAACTGTGGGAGG + Intergenic
1199650004 X:149940593-149940615 GCTAGGGGTGGAGCTGTGGGTGG + Intergenic
1199802995 X:151270039-151270061 ATGAGGGGAGGCACTGAGGAGGG - Intergenic
1199863648 X:151823748-151823770 CTTTGGGGAGAAACTGAGGGAGG + Intergenic
1200123576 X:153802716-153802738 AGTTGGGGAGGAAGAGTGGGAGG - Exonic
1201074253 Y:10175211-10175233 AGGAAGGGAGGAACTGAGGGAGG - Intergenic