ID: 914675428

View in Genome Browser
Species Human (GRCh38)
Location 1:149904238-149904260
Sequence GGGGAGGAACTGTGGGAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 848}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675412_914675428 30 Left 914675412 1:149904185-149904207 CCCAGGCTGGCCTAGGGCTCCTC 0: 1
1: 0
2: 4
3: 255
4: 4522
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848
914675418_914675428 4 Left 914675418 1:149904211-149904233 CCCAGGCTCAACACAGAAACCAG 0: 1
1: 0
2: 5
3: 20
4: 293
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848
914675416_914675428 11 Left 914675416 1:149904204-149904226 CCTCCATCCCAGGCTCAACACAG 0: 1
1: 0
2: 1
3: 48
4: 386
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848
914675415_914675428 20 Left 914675415 1:149904195-149904217 CCTAGGGCTCCTCCATCCCAGGC 0: 1
1: 0
2: 8
3: 54
4: 539
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848
914675413_914675428 29 Left 914675413 1:149904186-149904208 CCAGGCTGGCCTAGGGCTCCTCC 0: 1
1: 0
2: 3
3: 49
4: 1085
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848
914675419_914675428 3 Left 914675419 1:149904212-149904234 CCAGGCTCAACACAGAAACCAGA 0: 1
1: 0
2: 1
3: 26
4: 361
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848
914675417_914675428 8 Left 914675417 1:149904207-149904229 CCATCCCAGGCTCAACACAGAAA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG 0: 1
1: 0
2: 4
3: 75
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675428 Original CRISPR GGGGAGGAACTGTGGGAGGC AGG Exonic
900156272 1:1204503-1204525 GGGGAGGGAGGGAGGGAGGCTGG + Intronic
900182138 1:1315771-1315793 GGGGAGGGAGGGAGGGAGGCGGG + Intronic
900525756 1:3127811-3127833 GTGGGGGGACAGTGGGAGGCGGG + Intronic
900530097 1:3148906-3148928 GCGGAGGAAATGTTGGAGGAGGG + Intronic
900769324 1:4528318-4528340 GGGGGTGAACAGTGGGAAGCGGG + Intergenic
900913749 1:5620227-5620249 GGGGAGGGTCTGGGGGAGCCTGG - Intergenic
901070098 1:6512714-6512736 GGGGAGGGACTGAGGCAGGGCGG - Intronic
901240275 1:7688903-7688925 GGGGAAAAACAGTGAGAGGCAGG + Intronic
901443620 1:9293556-9293578 GGGGAGGCGCTGCGGGAGGGTGG - Intronic
901678535 1:10900443-10900465 GGGGCGGAATTGTGGGCGGGGGG - Intergenic
901768976 1:11521041-11521063 GGGGAGGTACTGTGGGCGGGAGG + Intronic
901933156 1:12609785-12609807 GAGGAAGAACTGAGGGAGACAGG - Intronic
902239840 1:15081133-15081155 AGGGAGGAACGGAGGGAGGGAGG - Intronic
902667815 1:17951876-17951898 GAGGAGGGACAGTGGGAAGCAGG + Intergenic
902833122 1:19030250-19030272 AGGGAGAAAAAGTGGGAGGCTGG + Intergenic
902906729 1:19563810-19563832 GGGGAGGAAAAGCGGGAGGCAGG + Intergenic
902992552 1:20199321-20199343 GTGGAGGAGGTGTGAGAGGCAGG + Intergenic
903015012 1:20355924-20355946 GGGGAGGAACCCAGGCAGGCAGG + Intergenic
903181562 1:21607697-21607719 GAGGAGTAACTGTTGGAGGTGGG - Intronic
903193388 1:21668881-21668903 GAGGAGGGACTGTGGGAAGTGGG - Intronic
903737805 1:25541402-25541424 GGGGAGGAAAGGAGGGAGGAAGG + Intergenic
903996479 1:27308057-27308079 AGGGAGGGAGGGTGGGAGGCAGG - Exonic
904003425 1:27351038-27351060 GGGGAGGTTCTGTCGAAGGCGGG - Intronic
904260025 1:29283077-29283099 GAGGAGGAGCTATGGGAGGTGGG - Intronic
904260050 1:29283149-29283171 GGGGAGGAACTGTGGGGCCAGGG - Intronic
904260091 1:29283268-29283290 GAGGTGGGGCTGTGGGAGGCGGG - Intronic
904295193 1:29515737-29515759 GGGGAGGAAGTGGAGGAGGATGG - Intergenic
904380144 1:30105084-30105106 GAGGAGGCCCTGTGGGATGCTGG - Intergenic
904429342 1:30451883-30451905 AGAGAGGAACGGAGGGAGGCTGG - Intergenic
904493251 1:30873045-30873067 GGGGAAGATCTGTGTGAGGCTGG + Intronic
904601088 1:31672952-31672974 AGGGAGGGAGTGTGGGAGGAGGG - Intronic
904648528 1:31986917-31986939 GTGCAGGAACTGTGTGAGCCAGG - Intergenic
904652389 1:32014806-32014828 GGGGAGGGACCGTGGGAGGAAGG + Intronic
904876246 1:33656654-33656676 GGGGAGGCAGTGTGGGAGGTAGG + Intronic
905145167 1:35882818-35882840 TGGGAGGAGAGGTGGGAGGCAGG + Intronic
905271575 1:36790940-36790962 GTGGGGGACCTGTGGGAGGTGGG + Intergenic
906192243 1:43905733-43905755 GGGGAGGAAGAGTGGCAGGAAGG - Intronic
906192363 1:43906168-43906190 GGGGAGGAAGAGTGGCAGGAAGG - Intronic
906192375 1:43906204-43906226 GGGGAGGAAGAGTGGCAGGAAGG - Intronic
906212495 1:44019897-44019919 AGGGAGGCTGTGTGGGAGGCCGG + Intronic
906805571 1:48776569-48776591 GGGGAGGGACGGTGGGACCCGGG - Intronic
906945946 1:50294379-50294401 TGGGAGGGAGTGTGGGAGGGAGG - Intergenic
907261056 1:53218983-53219005 GGGTAAGAACAGTGGGAGGTGGG + Intronic
907372164 1:54010624-54010646 GGGGAGGAACTGAGGAAGGGAGG - Intronic
907560797 1:55385700-55385722 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
912458763 1:109817541-109817563 GGGAAGGACCTGTGGGAGAGGGG + Intergenic
912711571 1:111953811-111953833 GGGTTGGAACTGAGGCAGGCAGG - Intronic
913490294 1:119373534-119373556 AGGCAGGATGTGTGGGAGGCAGG + Intronic
913944232 1:125142623-125142645 GGGAAGGAAGTGAGGGAGGGAGG + Intergenic
914394728 1:147254399-147254421 TGGGAGGAAGTGAGGGAGGAAGG + Intronic
914675428 1:149904238-149904260 GGGGAGGAACTGTGGGAGGCAGG + Exonic
915120449 1:153627173-153627195 GGGGAGGATCTGTGGGGTCCTGG - Intronic
915120738 1:153628391-153628413 GGGGAGGGACTGTTGAAGACAGG + Exonic
915460835 1:156069881-156069903 GGGGAGGGACTGAGGGGGACAGG - Intronic
915916495 1:159943842-159943864 GGTGAGGAAATGGGGGAGGCTGG + Intronic
916261074 1:162842810-162842832 TGGGAGGAAGGGTGGGAGGGGGG + Intronic
916357864 1:163933573-163933595 GTGGAGGATGTGTGGGAGGGTGG - Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
917041327 1:170809291-170809313 GGGCAGGGAGTCTGGGAGGCAGG + Intergenic
917521569 1:175752143-175752165 GGAGAGGAACTGTGGGAAGGGGG + Intergenic
917638260 1:176957833-176957855 GGGGAGAAAGAGTGGGAAGCAGG + Intronic
918332261 1:183471987-183472009 TGGGAGGAACTGTAGGAGGAAGG + Intergenic
918420491 1:184359858-184359880 GGGAAGGAGGAGTGGGAGGCGGG - Intergenic
919111478 1:193225028-193225050 AGGGGGAAACTGTGGGAGGGGGG - Intronic
920073545 1:203320957-203320979 GGGGAGGAGCTGGGGGAGGGGGG - Intergenic
920267408 1:204734392-204734414 CGGGAGGAAGTGTGGCAGGTTGG + Intergenic
921835322 1:219772422-219772444 TGGCAGGGACTGTGGGAGGCAGG - Intronic
922540438 1:226414861-226414883 CAGCAGGGACTGTGGGAGGCAGG - Intergenic
922719106 1:227891331-227891353 GGGAAGGCTCCGTGGGAGGCTGG + Intergenic
922995447 1:229954785-229954807 TGGGAGGAAGGGTGGGAGGAGGG - Intergenic
923223525 1:231917724-231917746 GGGGAAGAACAGTGAGGGGCAGG - Intronic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923447040 1:234081473-234081495 GGGGAGGGGCTACGGGAGGCAGG + Intronic
923608189 1:235464468-235464490 GGGGAGGAAGTGAGGGAGGAAGG - Intronic
924320913 1:242849311-242849333 TGGGAGGAAGGGTGGGAGGGAGG - Intergenic
924323752 1:242875014-242875036 GGGCAGAAACTGAGGTAGGCTGG - Intergenic
1062761326 10:23087-23109 TGGGAGGAAGAGTGGGAGGGAGG + Intergenic
1062814658 10:490512-490534 GGGGAGGCCCTCCGGGAGGCTGG + Intronic
1063338820 10:5243892-5243914 AGGGAGGAAAGGTGGGAGGAGGG + Intergenic
1063534184 10:6866931-6866953 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1063576314 10:7265180-7265202 AGGGAGGAAGAGAGGGAGGCAGG - Intronic
1063583883 10:7333764-7333786 GGGGAGGCCCTGTGGGGAGCTGG - Intronic
1063662198 10:8042721-8042743 GGGGAGGAAGTGGGGGAGGAAGG - Intergenic
1063693091 10:8305869-8305891 GGAGAGGAACTTGGAGAGGCTGG - Intergenic
1064004189 10:11687380-11687402 TGGGAGGACCTGTGGGAAGAAGG - Intergenic
1064018338 10:11790150-11790172 GGGGTGGCACTGGCGGAGGCGGG - Intergenic
1064299636 10:14112001-14112023 GGGAAGGAAGGGTGGGAGGGAGG + Intronic
1064474798 10:15676163-15676185 GCAGATGTACTGTGGGAGGCAGG - Intronic
1064767506 10:18689580-18689602 GGGGAGGAGTTGTGAGAGGCTGG - Intergenic
1065177783 10:23095705-23095727 GGGCCGGGACTGGGGGAGGCAGG + Exonic
1065768081 10:29050636-29050658 GTGAAGGAAGTGTGGGAGGATGG - Intergenic
1066065179 10:31756575-31756597 GGGTAGGAAGTGTGGGCAGCTGG - Intergenic
1066086956 10:31980473-31980495 GGGGAGGGAGGGTGGGAGGAGGG - Intergenic
1066696930 10:38087426-38087448 GGGGTGGAAGGGTGGGAGGGTGG - Intergenic
1067658000 10:48211813-48211835 AGGGTGGAACTCTAGGAGGCAGG - Intronic
1067729692 10:48801317-48801339 GGAAAGGAAATGTGAGAGGCTGG + Intronic
1068745839 10:60529910-60529932 TGGGAGGAAGTGTGGGAAGGAGG + Intronic
1068962305 10:62878464-62878486 GGGGAGGGGCTGGGGGAGTCAGG - Intronic
1069604631 10:69731669-69731691 GGGGAGAAAGGGTGGGAAGCAGG - Intergenic
1069614555 10:69798691-69798713 GGGGAAGAAATGGGAGAGGCAGG + Intergenic
1069828795 10:71270361-71270383 AGGGAGGGAGGGTGGGAGGCAGG + Intronic
1069849668 10:71396834-71396856 GGGAGGGAGCTGCGGGAGGCGGG + Intergenic
1069958032 10:72063495-72063517 CCGGCGGAACTGTGGGAGGATGG - Intronic
1070656671 10:78276326-78276348 AGGGAGGAAGTGAGGGAGGGAGG - Intergenic
1070766242 10:79058088-79058110 GGGGAGGGAGAGTGGGAAGCTGG - Intergenic
1070781062 10:79137794-79137816 GGGGAGGACCTCTGAGAGGACGG + Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072746044 10:97939799-97939821 GGGCAGGCATTGTGGGAGGCTGG - Intronic
1072857875 10:98968839-98968861 TGGGAGGAAGGGTGGGAGGGGGG + Intronic
1073082002 10:100866242-100866264 GGGGGAGAACTGCGAGAGGCTGG - Intergenic
1073553582 10:104426409-104426431 GGGAAGGAGGTGTGGGAGGAGGG - Intronic
1074081063 10:110168600-110168622 TGGGAGGAGCTCTGGGAGCCAGG - Intergenic
1074235254 10:111578376-111578398 GGGGATGGACGGTGGGAGGAAGG - Intergenic
1074675117 10:115839657-115839679 GGGTAGTAACGGAGGGAGGCAGG - Intronic
1075402408 10:122170755-122170777 GGGGAGGAGCGGCGGGAGCCAGG - Intronic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1075814527 10:125254670-125254692 GAGGAGGAATTGGGGGAGGCGGG - Intergenic
1076391463 10:130105893-130105915 GGGGGGGAGCTGGGGGATGCGGG - Intergenic
1076693710 10:132237003-132237025 GGGGTGGAACTGGGGCAGACAGG - Intronic
1076776169 10:132699413-132699435 GGAGAGCAGCTGTGGGTGGCTGG + Intronic
1076808938 10:132876659-132876681 TGGGAGGGCCTGTGGGAGGCTGG + Intronic
1076857738 10:133125861-133125883 CAGGAGGAAAGGTGGGAGGCAGG - Intronic
1077007689 11:366171-366193 GGGGGAGAAATTTGGGAGGCAGG + Intergenic
1077253227 11:1569911-1569933 GGGTGGCAACTCTGGGAGGCAGG + Intronic
1077381805 11:2246828-2246850 GGGGAGGAGGGGTGGGAGGAAGG + Intergenic
1077705995 11:4486137-4486159 GCAGAGAAACTGTGGGAGGTGGG - Intergenic
1078163407 11:8862030-8862052 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
1078254590 11:9647073-9647095 AGGGAGGAAGGGAGGGAGGCAGG - Intergenic
1078451457 11:11443788-11443810 TGGGAAGAACTGGGGGAGGCAGG - Intronic
1079101925 11:17547314-17547336 GGGGAGGCACCTCGGGAGGCTGG + Intergenic
1079703840 11:23588306-23588328 GGGGTGGAAGTGTGGGAGTGGGG + Intergenic
1080431945 11:32207533-32207555 GAGGAGGAACTCTGTGAGGACGG + Intergenic
1080874738 11:36265398-36265420 GAGGAGGAAGGATGGGAGGCGGG + Intergenic
1081737026 11:45411368-45411390 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1081737031 11:45411380-45411402 TGGGAGGCAGGGTGGGAGGCAGG - Intergenic
1082799813 11:57406281-57406303 AGGAAAGAACAGTGGGAGGCAGG - Intronic
1082972931 11:59042815-59042837 GTGAAGGAACAGTGGGAGGTTGG + Intronic
1082977335 11:59086385-59086407 GTGAAGGAACAGTGGGAGGTTGG + Intergenic
1083196604 11:61092160-61092182 GGGGAGGAGCTGAGGGTGGGAGG - Intergenic
1083269809 11:61566308-61566330 GGCCAGGAATTGTGGGAGGTAGG - Intronic
1083292256 11:61696612-61696634 GGTGGGGAGCTGTGAGAGGCAGG + Intronic
1083309613 11:61777571-61777593 GGGAAGGAAGGGAGGGAGGCTGG + Intronic
1083616416 11:64028687-64028709 TGGGAGGAGCTGCGGGAGGAGGG - Intronic
1084192074 11:67503950-67503972 GGGGAAGGACTGTGGGAAGAGGG - Intronic
1084287457 11:68141367-68141389 GGGGAGGTGCAGTGGCAGGCAGG + Intergenic
1084417568 11:69042295-69042317 GGGAGGGAGCTATGGGAGGCAGG - Intergenic
1084683923 11:70682655-70682677 AGGGAGGAAATGGGGGAGGCAGG + Intronic
1084752760 11:71214920-71214942 GAGGAGGATGTGTGGAAGGCGGG - Intronic
1084982672 11:72839579-72839601 TGGGAATGACTGTGGGAGGCAGG + Intronic
1085309633 11:75508666-75508688 GGGGAGGCAGAGTGGCAGGCAGG - Intronic
1085311395 11:75519056-75519078 GGGGAGGAAGTGTGGGCTGCTGG - Intronic
1085404649 11:76254720-76254742 TGGGAGGGACGGTGGGAGGCTGG + Intergenic
1085806731 11:79643286-79643308 AGGGAGGAAAGGAGGGAGGCAGG + Intergenic
1086807712 11:91266497-91266519 GGGGAGGGAGGGAGGGAGGCAGG + Intergenic
1087848674 11:103002991-103003013 GGGGAGGGACTCTGAGTGGCTGG - Intergenic
1088375747 11:109140241-109140263 GGGAAGGAAGGGAGGGAGGCGGG - Intergenic
1088584996 11:111354075-111354097 AGGGAGGAAGTGAGGGAGGGAGG + Exonic
1088772474 11:113048986-113049008 GGGCAGGAACTGTAGGGGTCTGG - Intronic
1088791619 11:113231810-113231832 GGGAAGGACCTGGGGGAGGGAGG + Intronic
1088813263 11:113405531-113405553 GGAGGGAAACTGTGGGTGGCTGG + Intergenic
1089323830 11:117644034-117644056 GGATAGGAACTGGGGAAGGCAGG - Intronic
1089561821 11:119347017-119347039 GGGGAGGAAAGGTGGGCAGCTGG - Intergenic
1089848391 11:121476747-121476769 AGGGAGGAAGCGTGGGAGGGAGG - Intronic
1089904640 11:122025990-122026012 GGTAATGAACTGTGGGGGGCGGG - Intergenic
1090347366 11:126082419-126082441 GCTGCGGAGCTGTGGGAGGCGGG - Intergenic
1090651129 11:128807166-128807188 GGGGAGGACCTGTGGCAAGAGGG - Exonic
1090717378 11:129442367-129442389 GGAGACGAGCTGTGGGAGCCAGG + Intronic
1090902189 11:131042922-131042944 AGGAAGGAACAGGGGGAGGCTGG + Intergenic
1091386890 12:101491-101513 GGGGAGGGAGTGTGGGAGTTGGG + Intronic
1091550054 12:1530284-1530306 GGGGAGGAGGCGCGGGAGGCGGG + Intronic
1091594611 12:1868452-1868474 GGGAAGGCACGGTGGGAGGTGGG + Intronic
1091697401 12:2637298-2637320 TGGGAGGAACTGTGGCACCCAGG + Intronic
1091930497 12:4391911-4391933 GGGCAGGGACTGGGGGAGGGAGG + Intergenic
1092287895 12:7140251-7140273 GGGGAGAAACTGAGGGAGTTGGG + Intronic
1092291162 12:7160201-7160223 TGGGAGGACAGGTGGGAGGCAGG - Intergenic
1092291178 12:7160248-7160270 CGGGAGGACAGGTGGGAGGCAGG - Intergenic
1092291190 12:7160282-7160304 TGGGAGGAGAGGTGGGAGGCAGG - Intergenic
1092291198 12:7160305-7160327 TGGGAGGACAGGTGGGAGGCAGG - Intergenic
1093206651 12:16259405-16259427 AGGGAGGAACTGGGGGAGGGAGG - Intronic
1093703326 12:22247117-22247139 GGGAAGGAAATGAGGGAGGGAGG - Intronic
1093838035 12:23860145-23860167 GGGGGGAAACGGTGGGAGGAGGG + Intronic
1094088609 12:26622726-26622748 TGGGAGGAGCTGTGCTAGGCTGG + Intronic
1094474469 12:30830879-30830901 GGGAAGGGTCTGGGGGAGGCAGG - Intergenic
1095208687 12:39467975-39467997 GGTGAGGAAAAGTTGGAGGCTGG + Intergenic
1095234570 12:39781398-39781420 GAGGAGGTGCTGTGGAAGGCTGG - Intronic
1095379084 12:41567640-41567662 AGAGGTGAACTGTGGGAGGCTGG + Intronic
1096103836 12:48985469-48985491 GGGGAGGCTTTGGGGGAGGCTGG - Intergenic
1096513508 12:52144590-52144612 GGTGAGGATCTGTGGGGGTCAGG + Intergenic
1096529000 12:52231822-52231844 GGGGAGGCAGGGAGGGAGGCTGG + Intergenic
1096652988 12:53071228-53071250 GGGGAGGACCCCTGGGAGGGCGG + Intronic
1096751419 12:53761288-53761310 GGGGAGGAACAGTGTGAAGGAGG - Intergenic
1097193724 12:57232618-57232640 GGTGAGGAGGTGTGGGAGGAGGG + Intronic
1097585887 12:61515880-61515902 GAGGAGGAACTGGGGAAGGCGGG - Intergenic
1097991087 12:65834599-65834621 AGGGAGGAACGGAGGGAGGGAGG - Intronic
1098168662 12:67723293-67723315 GGACATGAATTGTGGGAGGCTGG + Intergenic
1099658133 12:85521631-85521653 GAGGAGTAAATATGGGAGGCTGG - Intergenic
1100738203 12:97561736-97561758 GAGGAGGAACTGTGGGCTACTGG - Intergenic
1101003047 12:100375311-100375333 GGGAAGGAGCTGGAGGAGGCTGG + Intronic
1101504264 12:105331279-105331301 GAGGAGCAAGTGTGGGAGGTGGG - Intronic
1102173779 12:110861379-110861401 GGGGAGGAGGTGAGAGAGGCAGG - Intronic
1102520827 12:113476681-113476703 TGGGTGGAACCCTGGGAGGCGGG + Intergenic
1102535137 12:113575675-113575697 GGAGGGGAACAGTGGGAGCCTGG + Intergenic
1102685425 12:114721024-114721046 GGGCTGGAACTGTGGGGGACGGG + Intergenic
1102886400 12:116525383-116525405 GGGGAGGGACTGAGGGAGGGAGG - Intergenic
1103223182 12:119263699-119263721 GGGGAGAAAAGGTGGGAGGGAGG - Intergenic
1103350896 12:120282890-120282912 GGGGAGGAAGGGAGGGAGGGAGG + Intergenic
1104033798 12:125084362-125084384 GGGGAGGAAGTGAGGGAGGGAGG - Intronic
1104191088 12:126482471-126482493 AGGGAGGAAGTGGGGGAGGAGGG - Intergenic
1104270421 12:127278208-127278230 GGGGAGGAGCGGTGGCCGGCAGG + Intergenic
1104466409 12:128994244-128994266 GGGGAGGAAGAGTGGGAGCTAGG + Intergenic
1104534594 12:129607245-129607267 GGGTAGGATCTCTGGGAGCCTGG + Intronic
1104728627 12:131093153-131093175 GGGTTAGAACTGTGGGAGGGAGG + Intronic
1104737051 12:131141678-131141700 GGGGAGGAAGCGTGGGAAGGAGG + Intergenic
1104968578 12:132520938-132520960 TGGTAGGGACTGTGGGAGGTGGG + Intronic
1105292228 13:19060470-19060492 GGGCAGGGACTGGGTGAGGCAGG + Intergenic
1105480685 13:20773112-20773134 AGGAAGGAACTGTTTGAGGCAGG - Intronic
1105481946 13:20785859-20785881 GGGGAGGAAAGGAGGGAGGGAGG + Intronic
1105503548 13:20991758-20991780 GGGGAAGAACTGTGGGAGTCAGG + Intronic
1106394545 13:29367432-29367454 GAGGAGGCACTGGTGGAGGCAGG + Intronic
1106512217 13:30421842-30421864 GGGGAGGAGGTGGGGGAGGGCGG + Intergenic
1106853291 13:33818402-33818424 GGGGAAGAGGTGTGGGAGGCTGG + Intronic
1107543239 13:41412824-41412846 AGGGAGGCAGTGTGGGAGGAAGG + Intergenic
1108743349 13:53362261-53362283 AGGGAGGAACGGAGGGAGGGTGG - Intergenic
1108769743 13:53684978-53685000 GGGCAGGAACTAAGGAAGGCTGG + Intergenic
1109148410 13:58812586-58812608 GGGGAGGGAGTGTGGGAGGAAGG - Intergenic
1109249317 13:59999795-59999817 GAGGAGGAGCTGGGGGAGGCTGG - Intronic
1109555521 13:63969928-63969950 GAGGGGGAAGGGTGGGAGGCAGG + Intergenic
1110622811 13:77618133-77618155 AGGGAGGAAGGGAGGGAGGCAGG - Intronic
1111048420 13:82846759-82846781 GAGGAGGAAGGGAGGGAGGCAGG + Intergenic
1111084851 13:83362514-83362536 GGGGGGGAGCTGGGGGAGGGGGG - Intergenic
1111628730 13:90822952-90822974 GGGCAGGTACTGTGGGTGGAAGG - Intergenic
1111924227 13:94445872-94445894 GGGGAGAAACTGTGGGGGGGCGG + Intronic
1112035403 13:95492500-95492522 GGGGAGGCACGGTGGGAGTGAGG - Intronic
1112280266 13:98056701-98056723 GGTAAGGAACTGTGGGGCGCAGG + Intergenic
1112325744 13:98441782-98441804 GGGGAGGAAAGGGGCGAGGCAGG + Intronic
1113571683 13:111362427-111362449 GGAGAGGAGCTGTGAGTGGCTGG + Intergenic
1113663060 13:112120173-112120195 TGGGAGGCAGGGTGGGAGGCAGG + Intergenic
1113735430 13:112675150-112675172 GGGGAGTGTCTGTGGGAGACTGG - Intronic
1114053971 14:18950114-18950136 TGGGGGAAACGGTGGGAGGCGGG - Intergenic
1114482572 14:23044723-23044745 GGGGAGGAGATGTGGGACTCTGG + Intergenic
1114667911 14:24391535-24391557 GGGGAGTATCTGCAGGAGGCTGG - Intergenic
1115870911 14:37801641-37801663 GGTGAGGAACTGTGGGCAGCTGG + Intronic
1115957156 14:38794158-38794180 GTGGGGGAACTGGAGGAGGCTGG - Intergenic
1116264398 14:42668134-42668156 GGGGAGTATCTGTGTGATGCAGG + Intergenic
1116674253 14:47885191-47885213 CAGGAGGAAGGGTGGGAGGCAGG - Intergenic
1116808835 14:49519968-49519990 AGGGAGGAAAGGAGGGAGGCAGG + Intergenic
1117677025 14:58165743-58165765 GAGGAGGCACTGTGGGCAGCTGG - Intronic
1117772048 14:59143315-59143337 GGGGAGGAGGTGAGGGTGGCGGG - Intergenic
1117977071 14:61309386-61309408 GGAGGGGATCTGTGGCAGGCAGG + Intronic
1117992601 14:61449323-61449345 GGGGAGGAAAGGAGGGAGGGAGG - Intronic
1118110724 14:62715837-62715859 AGGGAGGGACTGAGGGAGGGAGG + Intronic
1118491352 14:66263759-66263781 GGAAAGGATCAGTGGGAGGCTGG - Intergenic
1118758170 14:68860634-68860656 GGGGAGGAACTGGGAGTGACAGG + Intergenic
1119207420 14:72805111-72805133 AGGCAGGTCCTGTGGGAGGCTGG - Intronic
1119298123 14:73549735-73549757 GGGGTGCTACTGTGGGAGGGGGG - Intronic
1119302412 14:73581919-73581941 GGGGTGCTACTGTGGGAGGGGGG - Intergenic
1119421947 14:74512423-74512445 ATGGAGGAAGTGTGGGAGGCAGG + Intronic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119921501 14:78450611-78450633 GGGAAGGAGCTCTGGGAGGCTGG + Intronic
1120891954 14:89499205-89499227 AGGAGGGAACTGTGGGAGCCAGG - Intronic
1120972225 14:90217056-90217078 AGGGAGGATCTGGTGGAGGCAGG + Intergenic
1121274712 14:92659593-92659615 GGGGAGGAACTGAGTGTGGGTGG + Intronic
1121470083 14:94146058-94146080 AGGGAGCAACTGTGTGAGGTAGG + Intergenic
1122145068 14:99684154-99684176 GGGGCGGAGCTCTGGGGGGCGGG + Intergenic
1122825760 14:104369679-104369701 GGGAAGGAGCTGAGGGAGACTGG - Intergenic
1122837217 14:104436190-104436212 TGGGCGGAGCTGAGGGAGGCAGG + Intergenic
1122900922 14:104782069-104782091 GGGGAGGGGACGTGGGAGGCGGG - Intronic
1122979691 14:105185896-105185918 GGGGAGGACGTGGGGGAGTCAGG + Intergenic
1123586490 15:21765056-21765078 GGGAAGGAACTGTGGGGGTGGGG - Intergenic
1123623129 15:22207621-22207643 GGGAAGGAACTGTGGGGGTGGGG - Intergenic
1123695094 15:22873430-22873452 GGGGAGGAGCTGTGGGGGAGGGG - Intronic
1124387948 15:29225460-29225482 GGTGGGGAACTGTGGGAATCGGG + Intronic
1124819785 15:33033398-33033420 GGACAGGGACTGTGGTAGGCGGG - Intronic
1125051870 15:35308481-35308503 GGGGAAGACCTGAGGAAGGCAGG + Intronic
1125185710 15:36927338-36927360 AGAGAGGATCTGAGGGAGGCAGG + Intronic
1125500609 15:40238535-40238557 GGGAGGGCACTGTGGAAGGCTGG + Intergenic
1126066596 15:44830569-44830591 GGGGAGGCTGTCTGGGAGGCAGG + Intergenic
1126093286 15:45070300-45070322 GGGGAGGCTGTCTGGGAGGCAGG - Intronic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1127224857 15:56918526-56918548 GGGGAGGAGCTGTCGGGGACTGG - Intronic
1127934749 15:63626107-63626129 GGGGGGGCACTGTGTCAGGCAGG + Exonic
1128056462 15:64703203-64703225 GGGGAGGGTCAGTTGGAGGCAGG - Exonic
1128904038 15:71451717-71451739 AGGGAGGAACTCTGGGAGAGAGG - Intronic
1129171829 15:73812615-73812637 GGGCTGGCACTGTGGGAGGAAGG - Intergenic
1129250052 15:74303731-74303753 GGGGAGGAGCTGAGGAGGGCTGG - Intronic
1129313331 15:74726658-74726680 GGAGAGGAACTGTCGAAGGGTGG + Intergenic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129732501 15:77940182-77940204 GCAGAGGAACAGAGGGAGGCGGG - Intergenic
1129799078 15:78399948-78399970 GGGGAGTGGCAGTGGGAGGCAGG - Intergenic
1129845984 15:78767951-78767973 GGGGAGGAGCAGAGGGAGCCGGG - Intronic
1130274275 15:82468471-82468493 GGGGCCATACTGTGGGAGGCAGG - Intergenic
1130466621 15:84195845-84195867 GGGGCCATACTGTGGGAGGCAGG - Intergenic
1130497643 15:84477691-84477713 GGGGCCATACTGTGGGAGGCAGG + Intergenic
1130588917 15:85200438-85200460 GGGGCCATACTGTGGGAGGCAGG - Intergenic
1130599069 15:85264074-85264096 GGGGAGGAGCAGAGGGAGCCGGG - Intergenic
1130972026 15:88741196-88741218 GTGGAGAAACTGTGGAAGGATGG + Intergenic
1131346723 15:91656390-91656412 GGGAAGGAAGGGAGGGAGGCAGG - Intergenic
1131449209 15:92525332-92525354 GGGGAGGAAGAAAGGGAGGCAGG - Intergenic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1132055280 15:98647599-98647621 GGGGAGGAAATGTGGGGGCCCGG - Intergenic
1132501415 16:286191-286213 GGGGAGGTCCTGTGCGGGGCCGG - Intronic
1132550853 16:553301-553323 GGTGAGGACCTGTGGAGGGCAGG - Intronic
1132657855 16:1048766-1048788 GGGGCGGAACTGCGGGACACAGG + Intergenic
1132858138 16:2056595-2056617 GGGGAGGAGCTGGGGTAGGACGG + Intronic
1133020027 16:2963289-2963311 GGGAAGGAACTGGTGGGGGCCGG - Intergenic
1133038020 16:3045752-3045774 GGGAAGGAACTGGAGGAAGCGGG - Intergenic
1133218292 16:4306799-4306821 GGGGAGAAAGGGTGGGAGCCGGG - Intergenic
1133307363 16:4818879-4818901 GGGAAGGACCTGTGGAAGGAAGG - Intronic
1133410280 16:5562504-5562526 GGGGAGGACCTGGGGGAGACAGG + Intergenic
1133431654 16:5742291-5742313 AGGGAGGAAGGGAGGGAGGCAGG - Intergenic
1133567466 16:7008897-7008919 AGGGAGGAAGTGAGGGAGGGAGG - Intronic
1133567569 16:7009137-7009159 AGGGAGGAAGTGAGGGAGGGAGG - Intronic
1133593983 16:7272923-7272945 GGGAAGGAAGTGAGGGAGGAAGG - Intronic
1133853051 16:9524231-9524253 GGGGAGGAACGGAGAGAGGGAGG - Intergenic
1134054771 16:11162990-11163012 GGAGAGGATCTCAGGGAGGCCGG + Intronic
1134451624 16:14367495-14367517 GGCCAGGAGCTGTGGTAGGCTGG - Intergenic
1135040466 16:19113993-19114015 GGGGAGGAAATGCCGGAGTCTGG - Exonic
1135055154 16:19225955-19225977 GGGTAGGAAGAGTGGGAGGTGGG + Intronic
1135166089 16:20140475-20140497 GGGGAGGAACAGTTAGAGGGTGG - Intergenic
1135520460 16:23172928-23172950 GGGGAGGGGCTGGGGGAAGCAGG - Intergenic
1136117125 16:28101521-28101543 GGTCAGGAACTCTGGGAGGAAGG + Exonic
1136285527 16:29238323-29238345 GGGGAGGAAAGGAGGGAGGGAGG + Intergenic
1136286764 16:29248741-29248763 GGAGAGGAAGTGTGGCAGCCAGG - Intergenic
1137632552 16:49957138-49957160 GGGGAGGACCAGTGGAAGGAAGG + Intergenic
1138115335 16:54356540-54356562 GGGGAAGAAATGTGGGTGGATGG + Intergenic
1138595515 16:58027159-58027181 GAGGAAGCGCTGTGGGAGGCAGG - Intronic
1138713500 16:58995757-58995779 GGGGAGAAAGGGTGGGAGGTGGG + Intergenic
1139759315 16:69171661-69171683 GGGAAGGGACTGTGGGAGAGGGG + Intronic
1140270149 16:73458313-73458335 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1141074000 16:80985933-80985955 GGGAAGGAGCTGTGGGAGAGTGG + Intronic
1141141637 16:81500318-81500340 AGGGAGGGACAGAGGGAGGCAGG - Intronic
1141184956 16:81780134-81780156 GGTGAGAAACTATGGGGGGCGGG + Intronic
1141699225 16:85634863-85634885 GGGGAGGGGCAGTGGGCGGCTGG + Intronic
1141953301 16:87353217-87353239 TGGGAGTAACAGTGAGAGGCAGG - Intronic
1142182761 16:88679223-88679245 GGGGAGGCCCTGCGGGAGGCTGG - Intronic
1142262564 16:89049752-89049774 CGGGAGGCACAGTGGGCGGCCGG + Intergenic
1142411478 16:89919197-89919219 GGGGAAGAACTGTGGGGACCTGG + Exonic
1142597279 17:1035766-1035788 GGGGAGGGGCTGAGGGAGGATGG - Intronic
1142747487 17:1967131-1967153 GGGGAGGAGCGGCGGGAGCCTGG - Intronic
1143034611 17:3987222-3987244 GGGAAGAAACTGGGGAAGGCGGG - Intergenic
1143244031 17:5468237-5468259 GGGGAGGTCGTGTGGGAGGGAGG - Intronic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1143536482 17:7543375-7543397 TGGAAGGAACAGAGGGAGGCAGG + Intergenic
1144185880 17:12794568-12794590 GGTGAGGAACTGTGGGTGTGCGG + Intronic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144278782 17:13703303-13703325 GGGGGGGAAGTGAGGGAGGGGGG + Intergenic
1144447125 17:15341544-15341566 GGGAAGGGGCTGTGGGAGGAAGG + Exonic
1144572438 17:16407992-16408014 GAGGAGGTGCGGTGGGAGGCAGG + Intergenic
1144622667 17:16828316-16828338 GGTGGGGGACTGTGGGAGGGAGG + Intergenic
1144757131 17:17686480-17686502 GGGGAGGCAGGGTGGGAGGCAGG + Intronic
1144829360 17:18122831-18122853 GGGGAGGGTCAGTAGGAGGCAGG - Intronic
1145209576 17:21003319-21003341 GGGGAGAGGCTGTGGGAGGTTGG - Intronic
1145230493 17:21170161-21170183 AGGGATAAACAGTGGGAGGCAGG - Intronic
1145389473 17:22444444-22444466 GGGCAGGAAAGCTGGGAGGCAGG - Intergenic
1145827864 17:27890922-27890944 GGAGAGGGACTGGGGGAGGCAGG - Intronic
1145972972 17:28967767-28967789 GGGCTGGAACTGTAGGAGGCTGG + Intronic
1145990885 17:29078806-29078828 GGAGAAGAGCTGGGGGAGGCAGG + Exonic
1146652061 17:34613071-34613093 GGGGAGGCTCTGGGGGAAGCTGG - Intronic
1147056111 17:37836419-37836441 GTGGAGGCACGGTGGGAGGCAGG - Intergenic
1147161719 17:38572640-38572662 GGGGAGCGACTGTGGGGGCCGGG - Intronic
1147190468 17:38735359-38735381 GGGGAGGTAGGGTGGGTGGCTGG + Exonic
1147239912 17:39083896-39083918 AGGGAGGAAGCGAGGGAGGCAGG - Intronic
1147251989 17:39158154-39158176 AGGGAGGAAGTGAGGGAGGGAGG + Intronic
1147325625 17:39668149-39668171 GGTGAGGAACTGAGGGTGGGGGG + Exonic
1147392821 17:40121238-40121260 GGGAAGGAACTGTTGGTAGCTGG + Intergenic
1147420743 17:40321096-40321118 GGGGATGCACGGTGGGGGGCAGG + Intronic
1147670265 17:42172993-42173015 GAGCAGGGACTGAGGGAGGCTGG + Intronic
1147753135 17:42749597-42749619 GGGTTGGAACTGGGGGAGGGAGG - Intergenic
1147986462 17:44309912-44309934 GGGAAGGAGCTATGGGAGCCAGG - Intronic
1148118182 17:45190356-45190378 GGGGAGTGAGTTTGGGAGGCAGG + Intergenic
1148669963 17:49402976-49402998 GGGGAGGAAATGTGGAATCCAGG + Intronic
1148697652 17:49570724-49570746 GGTGAGGTCCTGTGAGAGGCAGG + Intergenic
1148739769 17:49886187-49886209 GGGGAGGAATGGGGAGAGGCAGG + Intergenic
1148870727 17:50657564-50657586 GGCCAGGAACTGAGGGAGGTGGG - Intronic
1149431696 17:56599324-56599346 GGGGAGGAAGTGGGGGGTGCTGG - Intergenic
1149891440 17:60392891-60392913 GGGGAGAAACTCTGGGAGAGAGG - Intronic
1151144377 17:72027249-72027271 GGGGAGGGAATGCGGGAGGATGG - Intergenic
1151668021 17:75556679-75556701 GGTGGGGAGCTGAGGGAGGCAGG - Intronic
1152237120 17:79144401-79144423 GGGGAGGGACCTTGGGAAGCTGG - Intronic
1152237958 17:79148260-79148282 GGGAAGGGACCTTGGGAGGCTGG - Intronic
1152265680 17:79293329-79293351 GGGAAGGAAGGGAGGGAGGCAGG - Intronic
1152269660 17:79316595-79316617 GGGGAGGGGCTCTGGGAGGAAGG - Intronic
1152282125 17:79390989-79391011 GGGAAGGATCTGTGGGAATCAGG - Intronic
1152381635 17:79945272-79945294 TGGGAGGAACTGGCAGAGGCAGG - Intronic
1152433592 17:80262186-80262208 GAGGAGGTACGGTGGGAGCCAGG + Intronic
1152460550 17:80439899-80439921 GGGCAGGCAAGGTGGGAGGCAGG + Intergenic
1152637998 17:81438028-81438050 GGGGAGGTTTTGTGGGAGGAGGG - Intronic
1152702098 17:81824255-81824277 GGGCAGGAGCTGTGTGTGGCAGG + Intronic
1152703040 17:81828927-81828949 GGGCAGGAAGTGTGGCTGGCAGG + Intronic
1152713966 17:81889423-81889445 GGGGTGGTTCTCTGGGAGGCAGG + Intronic
1152762473 17:82116276-82116298 GGGGAGTGAGGGTGGGAGGCAGG + Intronic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1152954233 18:23417-23439 TGGGAGGAAGAGTGGGAGGGAGG + Intergenic
1153318916 18:3752518-3752540 AGGGAGGAACGGAGGGAGGGAGG - Intronic
1154018731 18:10644136-10644158 AGGGAGGAACGGTGGAGGGCAGG - Intergenic
1154185497 18:12179286-12179308 AGGGAGGAACGGTGGAGGGCAGG + Intergenic
1154503592 18:15009947-15009969 GGGGAGGAAGAGAAGGAGGCAGG + Intergenic
1155096285 18:22559500-22559522 GGGGAGGACCTCTTGGAGCCAGG - Intergenic
1156011348 18:32501206-32501228 GGAGAGGAACTGGGGGTGGGCGG + Intergenic
1156278344 18:35606965-35606987 GAGCAGGAACTGTGGGGGTCAGG - Intronic
1156453174 18:37278201-37278223 GGGGAGGAAGAGGGGGAGCCTGG - Intronic
1156510024 18:37628481-37628503 GGGCATGAACACTGGGAGGCAGG - Intergenic
1156681408 18:39593289-39593311 GGTGAGAAACTATAGGAGGCAGG + Intergenic
1156839128 18:41590617-41590639 GGGGAGGAACCTTGGGTGGTTGG - Intergenic
1157286171 18:46378895-46378917 GGGGAGGAAGAGTGGAAGGTGGG - Intronic
1157618727 18:49003211-49003233 GGGGAGGAAGAGGGGGAGGAGGG - Intergenic
1160356088 18:78229531-78229553 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
1160429265 18:78800357-78800379 AGGGAGGGAGTGAGGGAGGCTGG - Intergenic
1160429274 18:78800396-78800418 AGGGAGGGAGTGAGGGAGGCTGG - Intergenic
1160429283 18:78800435-78800457 AGGGAGGGAGTGAGGGAGGCTGG - Intergenic
1160429292 18:78800474-78800496 AGGGAGGGAGTGAGGGAGGCTGG - Intergenic
1160429301 18:78800513-78800535 AGGGAGGGAGTGAGGGAGGCTGG - Intergenic
1160429310 18:78800552-78800574 AGGGAGGGAGTGAGGGAGGCTGG - Intergenic
1160429319 18:78800591-78800613 AGGGAGGGAGTGAGGGAGGCTGG - Intergenic
1160716251 19:578144-578166 GGAGGGAAACTGAGGGAGGCGGG - Intronic
1160817984 19:1044988-1045010 GGACAGGCACTGTGGGATGCGGG - Exonic
1161058388 19:2201768-2201790 GGAGAGGAACTGTGAGAGCCTGG - Intronic
1161059560 19:2208169-2208191 GGGGAAGCACCGTGGGAGGCAGG - Intronic
1161104685 19:2437340-2437362 AAGGAGGCCCTGTGGGAGGCTGG + Intronic
1161233835 19:3188422-3188444 TGGGAGGGACTCTAGGAGGCTGG - Intronic
1161294257 19:3511743-3511765 GGCGAGTTACTGTTGGAGGCCGG - Intronic
1161345456 19:3766901-3766923 GGGCAGGACCTGTGGGCTGCAGG + Intronic
1161456674 19:4373113-4373135 GGAGAGGAGCAGTGGGAGGGGGG + Intronic
1161658164 19:5528852-5528874 TGGCTGGAACTGTGGGAGGGAGG + Intergenic
1162341510 19:10094012-10094034 GGTGAGGAAATGGGAGAGGCAGG - Intronic
1162341517 19:10094046-10094068 GGTGAGGAAATGGGAGAGGCAGG - Intronic
1162392896 19:10400162-10400184 GGGGAGGGGCTGTAGCAGGCTGG + Intronic
1162578409 19:11512994-11513016 GGGGAGGAATGGCGGGAGCCTGG + Intronic
1162773529 19:12965119-12965141 GGGAATAAACTGTGGGGGGCCGG + Intergenic
1162783581 19:13020395-13020417 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
1163427220 19:17246118-17246140 GGGGAGGGGCAGAGGGAGGCGGG - Intronic
1163609237 19:18292481-18292503 GGGGCGGTAGTGTGGGACGCGGG - Intergenic
1164853511 19:31503271-31503293 GTGGAGGCACGGTGGGATGCCGG - Intergenic
1165256675 19:34580459-34580481 GTGGAGGAGCTGGGGCAGGCAGG + Intergenic
1165265909 19:34663930-34663952 GTGGAGGAGCTGGGGCAGGCAGG - Intronic
1165273544 19:34730947-34730969 GTGGAGGAGCTGGGGCAGGCAGG - Intergenic
1165284148 19:34825349-34825371 AGGGAGAAACTGGGGAAGGCTGG - Intergenic
1165419486 19:35715915-35715937 TGGAAGGAACAGTGGGAGGTAGG - Intronic
1165590352 19:36963989-36964011 GGGGAGGGACGGAGGGAGGGAGG + Intronic
1165902154 19:39174053-39174075 GGGGAGGGAGGGTGGGAGGGAGG - Intronic
1166073113 19:40397997-40398019 GCGGTGGGACAGTGGGAGGCTGG + Intronic
1166137761 19:40787570-40787592 GGGGAGGCACTGGGGGAGAGGGG + Intronic
1166140888 19:40804555-40804577 GGGGATGAATTGTGGGAAGAGGG + Intronic
1166294784 19:41883500-41883522 GGGGACGAACGGTGCGAGGCCGG + Intronic
1166318010 19:41999343-41999365 GGAGAGGGGCTGGGGGAGGCGGG - Intronic
1166566755 19:43770236-43770258 GGGGAGGATGAGTGGGAGGCTGG - Intronic
1166648087 19:44547591-44547613 GGGGAGGAAGGGAGGGAGGGAGG + Intergenic
1166798925 19:45444185-45444207 AGGAGGGAACTGCGGGAGGCTGG - Intronic
1166824061 19:45598503-45598525 GGGGAGGAGGGGTGGGAGGGAGG - Intronic
1166913695 19:46179347-46179369 GGGGGGGGTCTGTGAGAGGCAGG + Intergenic
1166960299 19:46492940-46492962 GGAGAGGAACGGTGGGAGAAGGG - Exonic
1167148511 19:47696090-47696112 GGAGAGAGACTGTGCGAGGCAGG + Intronic
1167195174 19:48023394-48023416 AGGGAGGAAGTGAGGGAGGAGGG + Intronic
1167236915 19:48320871-48320893 CGGGAGAAACTATGGGAGGAGGG + Intronic
1167517653 19:49932659-49932681 GGGGAGGGACAGGGGGAGGGAGG - Exonic
1167523891 19:49972158-49972180 GGGGGGGCTCTGTGGGAGGGAGG - Intergenic
1167550301 19:50155693-50155715 TGTGAGGAACTGTGGGAGGAGGG - Intronic
1167616253 19:50535850-50535872 GGTGGGGAAGGGTGGGAGGCGGG - Intronic
1167642136 19:50687775-50687797 GGGGAGAAACTGAGGCAGGGAGG - Intronic
1167714098 19:51129932-51129954 GGGCAGAAGCTGGGGGAGGCTGG - Intronic
1167858004 19:52258214-52258236 CTGGAGGAACTGTGCAAGGCTGG + Intergenic
925174799 2:1775233-1775255 GGGGAGGAACTCTCAGAGCCGGG - Intergenic
925194363 2:1911543-1911565 GGGGGTGGTCTGTGGGAGGCTGG - Intronic
925411561 2:3642783-3642805 TGGGAGGAAGTGAGGAAGGCAGG - Intronic
925567278 2:5269846-5269868 TGGGGGGAAGTGTGGGAGGGAGG - Intergenic
926225569 2:10964760-10964782 GGGGAGGAACCTAGGGAGGCGGG - Intergenic
926322102 2:11755645-11755667 GGGGAGGAAATGGAGGAGGCAGG + Intronic
926704309 2:15826003-15826025 TAGGAGGAACTGTGTGGGGCAGG + Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926782838 2:16491056-16491078 GAGAAGGATGTGTGGGAGGCAGG - Intergenic
926799008 2:16642496-16642518 GGGGTGGAACTGGGGGACCCTGG - Intronic
926878901 2:17518591-17518613 GAGGAGGGACTGAGGGAGGCGGG - Intergenic
926907482 2:17819526-17819548 GGGAAGGGAGTGTGGGTGGCGGG - Intergenic
927275892 2:21262106-21262128 GGGGAGGAACTTTTGAATGCAGG + Intergenic
927783203 2:25955383-25955405 GGTGAGCAACAGGGGGAGGCAGG - Intronic
927927538 2:27024315-27024337 GGGGAGGGAGCGTGGGGGGCCGG + Intronic
928102123 2:28444942-28444964 GGGGAGGAACTGGGAGAGCCTGG + Intergenic
928171567 2:29007762-29007784 GGGGAGGAACTGTGGGGTCGTGG - Intronic
928362818 2:30679433-30679455 CGGAAGGAACTGTGCTAGGCAGG + Intergenic
928435563 2:31252407-31252429 GGATAGGAACTGAGGAAGGCAGG - Intronic
928938243 2:36702667-36702689 AGGGAGGAAAGGTGAGAGGCAGG + Intronic
929437434 2:41939247-41939269 AGGGAGGGGCTGTGGGAGGAGGG + Intronic
929879634 2:45824589-45824611 AGGGAGGAAATGAGGGAGGGAGG - Intronic
931087528 2:58849710-58849732 GCAGAGGAAGTGTGTGAGGCTGG + Intergenic
931090454 2:58880530-58880552 AGTGAGGAAGGGTGGGAGGCAGG + Intergenic
931213261 2:60217499-60217521 ATGAAGCAACTGTGGGAGGCTGG - Intergenic
931655263 2:64505046-64505068 TGGGAGGCACTGTGAGAGGATGG - Intergenic
932312652 2:70756158-70756180 GGGGAGGAAAGGGGGTAGGCAGG - Intronic
932337220 2:70938214-70938236 GAGGAGGAAGTGAGTGAGGCGGG - Intronic
932417907 2:71584739-71584761 GGGGAGAAGCTGGGAGAGGCTGG + Intronic
932604553 2:73156515-73156537 GGGGAGCAACTGTGAGGGCCTGG - Intronic
932809944 2:74816790-74816812 GGAGTGGAAGTGTGGGAGGAGGG - Intergenic
933498789 2:83086155-83086177 GGGGAGGGACAGAGGGAGGGAGG - Intergenic
933664071 2:84950500-84950522 AGGGAGGAAGGGAGGGAGGCAGG + Intergenic
933723715 2:85414106-85414128 GGGGAGCCCCTATGGGAGGCTGG + Intronic
934122104 2:88850095-88850117 GGGCAGGAATTGTTGGAGGAGGG - Intergenic
934135461 2:88992352-88992374 GGGAAGCAAATGTGTGAGGCTGG - Intergenic
934527230 2:95059438-95059460 GGGGAGGGAGCCTGGGAGGCGGG - Intergenic
934572125 2:95379430-95379452 AGGATGGAGCTGTGGGAGGCTGG - Intronic
934653349 2:96104573-96104595 GAGGAGGGTCTGTGGGAGGGTGG - Intergenic
935255495 2:101306672-101306694 GGGCAGAAACTGTGGGAGTATGG - Intronic
935467701 2:103418432-103418454 TGGGGGGAAGTGTGGGAGGGGGG + Intergenic
936163822 2:110103508-110103530 GGGGCAGATCTGTGGGAGTCAGG - Intronic
936279228 2:111122951-111122973 GGGGAGGGTCTGTGGGATGAAGG + Intronic
937039023 2:118806908-118806930 GGAGACGCACGGTGGGAGGCAGG + Intergenic
937097258 2:119243422-119243444 GGGGAGGAAGAGCAGGAGGCAGG - Intronic
937854070 2:126660208-126660230 GCTGAGGAGCTGGGGGAGGCAGG - Intronic
937993558 2:127677139-127677161 TTGGCTGAACTGTGGGAGGCTGG - Intronic
938259129 2:129882772-129882794 GGGCAGGAACAGAGGGAGGGAGG - Intergenic
938502766 2:131840078-131840100 GGGGAGGAAGAGAAGGAGGCAGG + Intergenic
938823718 2:134983619-134983641 AGGGAGGGACTGTGGGGGGGTGG + Intronic
939462901 2:142519619-142519641 GAGGAGGAATTGGGGGAGGAGGG + Intergenic
941111779 2:161424271-161424293 GGGGAAGAGCTGTGAGGGGCTGG - Exonic
941715585 2:168760075-168760097 TGGGGGGATCTGAGGGAGGCTGG - Intronic
942320291 2:174730363-174730385 GGGGAGGGGCTGTGGAGGGCGGG + Intergenic
942425289 2:175853712-175853734 GGGGAGCATCTGTGGGGGTCTGG + Intergenic
942541010 2:177015745-177015767 GGGGAGGGACTGGAGGTGGCAGG - Intergenic
943266400 2:185738429-185738451 GGGAAGAAGCTGTGGGAGCCTGG + Intergenic
943446497 2:187994011-187994033 TGGGAGGTACCGTGTGAGGCAGG - Intergenic
944474888 2:200093340-200093362 GGTGAGGAACTGGGGAGGGCTGG - Intergenic
944494382 2:200291602-200291624 GGGGAGGAGGAATGGGAGGCAGG - Intergenic
945028955 2:205645805-205645827 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
945826310 2:214724221-214724243 TGGGAGGAAGAGTGGGAGGGGGG + Intergenic
946199762 2:218064827-218064849 GGGGAGGAACTGGAGGGGGAGGG - Intronic
946391051 2:219417398-219417420 GGAGAGGAGCTGTGGGGGGCAGG - Intergenic
946553110 2:220823920-220823942 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
947077710 2:226363900-226363922 AGGGAGGAACGGAGGGAGGAAGG + Intergenic
947628708 2:231637655-231637677 GGGAAGGAAGTGGGGGAGGAGGG + Intergenic
948103146 2:235391339-235391361 GGGGAGGTAGAGAGGGAGGCTGG - Intergenic
948169545 2:235890008-235890030 GGGGAAGAGCTGAAGGAGGCTGG - Intronic
948254517 2:236556284-236556306 GGTCAGTTACTGTGGGAGGCTGG + Intergenic
948460637 2:238128495-238128517 GGGGAGGGACTGGAGGGGGCGGG - Intronic
948623151 2:239249315-239249337 GGGGAGGGGCTGCGGAAGGCGGG + Intronic
948830380 2:240595710-240595732 GGGAAGAGACTGAGGGAGGCAGG - Intronic
1169308082 20:4510933-4510955 AGAGTGGAACTGTGGGATGCAGG - Intergenic
1170555893 20:17514279-17514301 TGTGAGGAACTGTTGGAGGCTGG + Intronic
1171359049 20:24573827-24573849 GTGGAGGAACTGGGGGTTGCTGG - Intronic
1171360242 20:24582197-24582219 GGGGAGGAAGTGCAGGGGGCAGG - Intronic
1171399202 20:24860820-24860842 GGGAGGGAACTGTGGGTGGGTGG + Intergenic
1172485008 20:35292578-35292600 TGGGAGGAAGAGAGGGAGGCAGG - Intergenic
1172591593 20:36121845-36121867 GGGCAGGAAGTGGGGAAGGCTGG + Intronic
1172750171 20:37245304-37245326 GGGGAGGAAATGAGGGAGCTGGG - Intergenic
1172798492 20:37559824-37559846 GGGGAGGAACTGTGAGTTCCAGG + Intergenic
1172805452 20:37608637-37608659 GGTGAGAAAGTGCGGGAGGCAGG - Intergenic
1172893918 20:38286311-38286333 GGGGAGGCTCTGTTGCAGGCTGG + Intronic
1173201371 20:40957652-40957674 GGGGAAGAACTGGGACAGGCTGG - Intergenic
1173675467 20:44831277-44831299 GGGAAGGAAATGAGGGAGGGAGG - Intergenic
1173737413 20:45372161-45372183 GTTGTGGAATTGTGGGAGGCAGG + Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1174064108 20:47852284-47852306 GGGGAGAAGCGGTGGGAGTCAGG + Intergenic
1174361435 20:50031272-50031294 GGGAAGGAGCTGAGGGAGGGAGG + Intergenic
1174799666 20:53552835-53552857 GGGGTAGTATTGTGGGAGGCAGG - Intergenic
1175931230 20:62494748-62494770 GGGCGGGGACTGTGTGAGGCAGG - Intergenic
1176235018 20:64049923-64049945 GGGCAGTAACTGGGGGAGGGCGG + Intronic
1176270481 20:64233372-64233394 GGGGAGGGAGTGGGGGAGGTGGG - Intronic
1177012491 21:15745129-15745151 GGGAGGGAGGTGTGGGAGGCAGG + Intronic
1177722290 21:24923863-24923885 GGGGTGGAGGTGTGGGAGGAGGG - Intergenic
1178059406 21:28835109-28835131 GGGGAGGAACTGGTGGTGGGTGG - Intergenic
1178887695 21:36496712-36496734 GGGGAGGAAGGGAGGGAGGAAGG + Intronic
1178887992 21:36497408-36497430 AGGGAGGAAGGGAGGGAGGCAGG + Intronic
1179091342 21:38268856-38268878 GGTGGGGAACAGTGGGAGGGTGG - Intronic
1179265450 21:39798739-39798761 GGGCAGGAGTTATGGGAGGCTGG - Intronic
1179714294 21:43279863-43279885 GGGGAGGAAGTGTCGAGGGCAGG + Intergenic
1179893441 21:44349325-44349347 AGGGAGGAAATGAGGGTGGCGGG + Intergenic
1179909468 21:44440410-44440432 GGGGAGGAGCTGGGGGTGACTGG - Intronic
1180013642 21:45068869-45068891 GAGAAGGGAGTGTGGGAGGCGGG - Intergenic
1180081590 21:45489992-45490014 GGGGAGGAGGTGTGGGGGACGGG - Intronic
1180081609 21:45490033-45490055 GGGGAGGAGGTGTGGGGGACGGG - Intronic
1180127571 21:45802690-45802712 GGAGAGGCCCTGAGGGAGGCAGG + Intronic
1180156104 21:45977992-45978014 GGGGAGCAAGTGTGAGAGGAGGG + Intergenic
1180159107 21:45991162-45991184 GGGGAGGAGCTGGTGGAGGCTGG + Intronic
1180242938 21:46523953-46523975 GGTGAGGAGCTCAGGGAGGCCGG + Intronic
1180472442 22:15672495-15672517 TGGGGGAAACGGTGGGAGGCAGG - Intergenic
1180525451 22:16254881-16254903 GGAAAGGAACTGAGGGAGGAAGG + Intergenic
1180911722 22:19455494-19455516 GGGGTGGCACTGTGGAAGGAGGG + Intronic
1181062152 22:20286655-20286677 GGGGAGGGGATGTGGGAGGTAGG + Intergenic
1181469020 22:23126729-23126751 GGGGAGGACCTGGGGATGGCTGG + Intronic
1181630260 22:24147372-24147394 AGGGAGGAACGGAGGGAGGGAGG - Intronic
1181966364 22:26658782-26658804 GGGGAGGAAGTATGAGAGGGAGG + Intergenic
1182063008 22:27411148-27411170 TAGGAGGCACTGGGGGAGGCTGG - Intergenic
1182254832 22:29030813-29030835 GGGGAGGAGCCGCGGGAGGGGGG + Intronic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182841197 22:33391373-33391395 GGGGAAGAACTATGGGAGCTGGG + Intronic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183096619 22:35555840-35555862 GGGCAAGGACTGTGGGATGCAGG - Intergenic
1183303782 22:37071198-37071220 GTGGAGGGGCTGTGGGGGGCGGG - Intronic
1183374959 22:37457711-37457733 GGGGTGTGACTGTGGGTGGCAGG + Intergenic
1183629900 22:39026586-39026608 AGGGAGGGGCTGTGGGAGTCAGG - Intronic
1184101659 22:42344166-42344188 AGGGAGGAACGGTGGGCGGGAGG - Intergenic
1184322270 22:43751583-43751605 GTGGAGGAAGTGTGAAAGGCAGG + Intronic
1184385274 22:44170679-44170701 GGGAAGGAGCTGGGGGAGGGGGG - Intronic
1184530360 22:45051584-45051606 GGTGGGGAACAGTGGGAGCCGGG - Intergenic
1184582168 22:45425279-45425301 GGTGAGCACATGTGGGAGGCCGG + Intronic
1185141835 22:49106895-49106917 AGGGAGAAAGGGTGGGAGGCAGG - Intergenic
1185372514 22:50467603-50467625 GGGCAGGTGCTGTGGGAGACAGG + Exonic
949182874 3:1155813-1155835 AGAGAGAAACTGTAGGAGGCTGG - Intronic
950029433 3:9842530-9842552 GGTGAGGAACTGCAGGAGGAAGG - Intronic
950234891 3:11310382-11310404 TAGGAGGAACGGTGGGAGGTCGG - Intronic
950287920 3:11759605-11759627 GTGGAGGAACTGGGGTAGGGTGG - Intergenic
950426563 3:12927651-12927673 GGGAAGGTGCTGTGGGAAGCGGG + Intronic
950686917 3:14625129-14625151 GGGGAGGAAGAGAGGGAGGGAGG + Intergenic
950798971 3:15534008-15534030 GGAGAGAGACTGGGGGAGGCAGG - Intergenic
952512605 3:34072224-34072246 GAGGAAGAAATGTGGGATGCAGG + Intergenic
953847390 3:46438575-46438597 GAGCAGGAACTGTGTGAGGGAGG - Intronic
954144725 3:48628890-48628912 GGAGAGGCACTGTGGGGGGATGG - Intronic
954430728 3:50469701-50469723 GGGCAGGCACTGTGGGACCCGGG - Intronic
954446440 3:50549406-50549428 GGGGAGGAGCTGGGGGAGAGAGG + Intergenic
954538616 3:51379534-51379556 GGGGAGGCACTGGGGGGGCCAGG - Intronic
954609334 3:51936073-51936095 GGGGAGGAGCTGGGGGAGACCGG - Intronic
955968901 3:64417192-64417214 GGGGAGGAAGGGAGGAAGGCAGG + Intronic
956105615 3:65815043-65815065 GGTGGGGAACTGTACGAGGCAGG - Intronic
957128171 3:76189078-76189100 AGTGAAGAAATGTGGGAGGCAGG + Intronic
958022167 3:88011117-88011139 AAGCAGAAACTGTGGGAGGCAGG + Intergenic
958089715 3:88861300-88861322 TGGGAGGAAGAGTGGGAGGAGGG + Intergenic
959141754 3:102494300-102494322 GGGGAGCAACTGACAGAGGCAGG - Intergenic
959564988 3:107825088-107825110 GGGGATGAACTGTGGCAGGATGG + Intergenic
959706146 3:109340596-109340618 AGGGAGGAAATGAGGGAGGGAGG - Intergenic
959724634 3:109529375-109529397 GTGGAGAAACTGTGGGGGTCAGG - Intergenic
960312401 3:116132420-116132442 GGGGTGGAGCAGTGGGAGGAAGG - Intronic
960459967 3:117921614-117921636 GAGGAGGCAGTGTGGGAGGTAGG - Intergenic
960584923 3:119311755-119311777 GGGGAGGGAATGTGGGAGACAGG + Intronic
961573471 3:127816804-127816826 GGGAAGGAACTGCAGGAGGGAGG + Intronic
961653980 3:128431565-128431587 GGCTAGAAAGTGTGGGAGGCCGG - Intergenic
962754279 3:138456368-138456390 GTGGAGGGGCTGTGGGAGTCAGG + Intronic
963240994 3:143002097-143002119 GGAGGGAAACTGAGGGAGGCCGG - Intronic
963900302 3:150727043-150727065 GGGCAGGAACTGTGGGGGTCTGG + Intergenic
964344461 3:155742503-155742525 TGGGAGTACCTGGGGGAGGCTGG - Intronic
965321867 3:167261356-167261378 GGGGAGGAACTGGCGGTGGTCGG + Intronic
965370752 3:167859427-167859449 GGGCAGGTAATGTGGGAGACAGG + Intergenic
965942457 3:174201303-174201325 AGGGAGGAAGGGAGGGAGGCGGG + Intronic
967107057 3:186262498-186262520 GGGAAGGAACTGTGTGGGGATGG - Intronic
967258547 3:187619006-187619028 GGGGAGGAAGGGAGGGAGGCAGG - Intergenic
967388112 3:188929861-188929883 GGGGAGGCACTGTGGATGGCGGG - Intergenic
967877060 3:194274708-194274730 GGGAAGCAATTATGGGAGGCGGG - Intergenic
967919334 3:194602737-194602759 GGGGAGGGGGTGTGTGAGGCCGG + Intronic
967977282 3:195042546-195042568 GGGGAGCCACGGTGGGGGGCGGG - Intergenic
968089586 3:195891989-195892011 GGGAAGGAACTCCGGGATGCTGG + Intronic
968424911 4:516919-516941 GGGGAGCCACTGGGGCAGGCTGG + Intronic
968479042 4:825874-825896 GGGGAGGAGCTGGGCGAAGCCGG + Intronic
968844282 4:3031304-3031326 GGGGAGCAAAGGTGGGAGGCAGG + Intronic
968948111 4:3676089-3676111 GGGGAGGAAGCATGGGAGGGTGG + Intergenic
968978442 4:3834059-3834081 GTGGAGAAGGTGTGGGAGGCAGG - Intergenic
968991662 4:3917385-3917407 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
969239391 4:5888834-5888856 GGGGAGGGAGTGTGGGACGGGGG + Intronic
969251523 4:5971404-5971426 GGGGAGGAGTCGGGGGAGGCTGG - Intronic
969410571 4:7025377-7025399 GGGCTGGAACTGAGGGGGGCCGG + Intronic
969481570 4:7449282-7449304 GGGGAGGAAGGGAGGGAGGAAGG - Intronic
969849002 4:9942179-9942201 GGGAAGGAACTGAGCCAGGCTGG + Intronic
969967438 4:11011753-11011775 GGGGAGGAGCTGGGGGAGGCAGG - Intergenic
970236762 4:13966717-13966739 AGGGAAGAACTGTGGAATGCGGG + Intergenic
970582095 4:17482820-17482842 GGTGAGGAACACAGGGAGGCTGG - Intronic
972273254 4:37532958-37532980 TGGGGGGAACAGTGGGAGGGGGG + Intronic
972389537 4:38601841-38601863 GGGTGAGAACTGTGGGAGGGAGG - Intergenic
973560239 4:52128166-52128188 GGGGAGGAACTCAGGCAGGAGGG + Intergenic
973745462 4:53959506-53959528 GGGAAGGCCCTGAGGGAGGCCGG - Intronic
973765398 4:54157236-54157258 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
973953773 4:56042582-56042604 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
973968920 4:56191396-56191418 AGGGAGGAACAGAGGGAGGGAGG - Intronic
974008749 4:56587463-56587485 GGGGGGGAAGAGTGGGAGGGGGG - Intronic
974011458 4:56611421-56611443 GGGGGGAAAGTGTGGGAAGCGGG + Intergenic
974085483 4:57255996-57256018 GGGAAGGAAGTGTTGGAGCCAGG - Intergenic
975724579 4:77279470-77279492 TGGAAGGAACTGTGGCTGGCAGG + Intronic
976101185 4:81565637-81565659 GCCAAGGAGCTGTGGGAGGCGGG - Intronic
976433823 4:84994033-84994055 GGGGAGGAAGGGAGGGAGGGTGG + Intergenic
976486153 4:85607369-85607391 AGGGAGGAACGGAGGGAGGAAGG + Intronic
976655082 4:87479949-87479971 GAGGAGTATCTGTGGGAAGCTGG + Intronic
977072922 4:92415463-92415485 TGGGAGGAACTGTGGGAGGAGGG - Intronic
977825790 4:101530118-101530140 AGGGAGGAAGAGTGGGAGGGGGG - Intronic
978416724 4:108484621-108484643 CGGAAGGGGCTGTGGGAGGCAGG + Intergenic
978589569 4:110310229-110310251 GGGGAGGAATTGTGGAGCGCTGG + Intergenic
978779197 4:112532240-112532262 GAGGAGGAAACCTGGGAGGCTGG + Intergenic
979866404 4:125760387-125760409 GGGGAGGAAGTGAGGGAAGAGGG + Intergenic
980086616 4:128397240-128397262 CGGGAGGAAGTGTGGCAGGGTGG - Intergenic
980196520 4:129596102-129596124 GGGGAGGGACTGAGGGAGGGGGG + Intergenic
981375363 4:144009090-144009112 AGGGAGGAAGTGAGGGAGACTGG - Intronic
981413343 4:144458767-144458789 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
981644368 4:146981904-146981926 GCTAAGGCACTGTGGGAGGCTGG - Intergenic
982558648 4:156900942-156900964 AGGGAGGAAGTGAGGGAGGGAGG + Intronic
983632359 4:169862145-169862167 GATGAGGTATTGTGGGAGGCTGG + Intergenic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985580901 5:694560-694582 GGAGAGGAAGTGTGGGGCGCGGG - Intergenic
985595526 5:785892-785914 GGAGAGGAAGTGTGGGGCGCGGG - Intergenic
985632518 5:1021415-1021437 GGGGAGGGGCTGGGGGGGGCTGG - Intronic
985635111 5:1032071-1032093 GGGCAGGAGCTCTGGGCGGCTGG - Intronic
985660870 5:1155942-1155964 CGGGAGGAAGGGAGGGAGGCCGG + Intergenic
985672333 5:1213239-1213261 GGGCAGGGGCTGTGGGGGGCGGG - Intronic
985756356 5:1720973-1720995 GCTCAGGACCTGTGGGAGGCGGG + Intergenic
986139537 5:5017168-5017190 GGGAAGGAAAACTGGGAGGCTGG + Intergenic
986865117 5:11976931-11976953 GAGGAGGAACTCTGGGAGCCGGG - Intergenic
988122324 5:26982114-26982136 AGGGAGGAAGGGTGGGAGGGAGG - Intronic
988272118 5:29031048-29031070 AAGCAGGAACTGTGGGAGGCAGG + Intergenic
988548198 5:32176710-32176732 GGGGAAGAAGTGAGGGAGGAAGG + Intergenic
988795431 5:34649034-34649056 GGGATGGAACTGTGGGAGTCAGG - Intergenic
988895257 5:35665428-35665450 GGAGAGGAACAGAGGGAGGGAGG + Intronic
990485638 5:56257284-56257306 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
990673159 5:58155184-58155206 TGGGGGGAAGTGTGGGAGGAGGG + Intergenic
991172306 5:63642628-63642650 AGGGAGGAACAGAGGGAGGGAGG - Intergenic
992253310 5:74897175-74897197 GGAAAGGCACTGTGGGAGGGAGG - Intergenic
995472980 5:112523149-112523171 GGGGAGGAACTGGTGGTGGGTGG + Intergenic
996762919 5:127003973-127003995 GGGGAGTGGCTGAGGGAGGCTGG + Intronic
997854993 5:137365119-137365141 GGGGAGCAGCTGTGGAAAGCTGG - Intronic
998003131 5:138640123-138640145 GAAGAGGCACTGTGGGTGGCGGG + Intronic
998184292 5:139966976-139966998 GTGGAGCCACTGGGGGAGGCTGG - Intronic
998381429 5:141728857-141728879 GGGGAGGAAGGGAGGGAGGGAGG - Intergenic
998664988 5:144287067-144287089 GGGGAGGAGCTGGGAGTGGCTGG + Intronic
999136429 5:149322934-149322956 GGGGAGGTACTGTAGGAAACCGG + Intronic
999249305 5:150172640-150172662 GGGGATGTACTGTAAGAGGCTGG + Intronic
999268808 5:150284491-150284513 GGGGAGGAAGGGAGGGAGGGAGG + Intronic
999399391 5:151252927-151252949 GGGGCGGAACTGAGCGCGGCGGG - Exonic
999739814 5:154541771-154541793 GGGGAGGAACAGAGAGGGGCAGG + Intergenic
1000251199 5:159497367-159497389 AGGGAGGAACTTATGGAGGCGGG + Intergenic
1000854523 5:166381651-166381673 GGGGAGGAGATCTGGGAGACAGG - Intergenic
1001027515 5:168236583-168236605 GGGAAGGAACTGTGGCAGTGAGG - Intronic
1001250433 5:170142931-170142953 GGGAGGGGACTGAGGGAGGCAGG - Intergenic
1001301487 5:170536853-170536875 GGGCAGGAAAGGAGGGAGGCAGG + Intronic
1001579476 5:172789154-172789176 GGGGAGGCCCTGTGGGATGGTGG + Intergenic
1001946651 5:175784399-175784421 TGGGAGGCAGAGTGGGAGGCAGG - Intergenic
1002066928 5:176656572-176656594 GTGGAGGGACTGTGGGGAGCAGG + Intronic
1002104932 5:176875358-176875380 GGGGAGGCTCTGGGGGAGGGTGG - Intronic
1002169579 5:177367571-177367593 GGCGAGGGACTGGGCGAGGCAGG + Intronic
1002387754 5:178881247-178881269 AGGGAGGAATTGTGAGGGGCAGG + Intronic
1002690357 5:181045942-181045964 GTGGAGGAGGTGTTGGAGGCTGG - Intronic
1002690366 5:181045972-181045994 GTGGAGGAGGTGTTGGAGGCTGG - Intronic
1002690426 5:181046151-181046173 GTGGAGGAGGTGTTGGAGGCTGG - Intronic
1002917717 6:1542190-1542212 GGGGAGGGAAGGAGGGAGGCAGG + Intergenic
1002975701 6:2073659-2073681 GGGAAGGATGTGTGGGTGGCAGG - Intronic
1003276871 6:4660957-4660979 GAGACGGAACTGTGGGAGGAAGG - Intergenic
1003515370 6:6813535-6813557 GGGAAGGAACAGTGGGAGGTGGG + Intergenic
1003548231 6:7079119-7079141 GGGAAGGAAGTGAGGGAGGGAGG + Intergenic
1003596272 6:7476854-7476876 GTGGAGGAGCCGTGGGAGGTGGG + Intergenic
1004303256 6:14477244-14477266 GAGGAGGAAATGTGGGAGCGGGG + Intergenic
1004372322 6:15063224-15063246 GGGGTGGAGGTGTGTGAGGCAGG - Intergenic
1004550931 6:16646526-16646548 GAGGTGGAACAGTGGGAGACTGG - Intronic
1004729960 6:18347996-18348018 GGGAGGGAAGTGTGGAAGGCTGG - Intergenic
1005421321 6:25654311-25654333 GGGGAGGGTATGTGGGGGGCAGG + Intronic
1005849836 6:29813183-29813205 GGGGAGGAACAGTGAGCTGCTGG - Intergenic
1006360216 6:33583488-33583510 GGGAAGGAGGTGTGGGGGGCAGG - Intergenic
1006731649 6:36240438-36240460 GGGGAGGAGAACTGGGAGGCTGG - Intergenic
1006787487 6:36678480-36678502 GGCGAGGGACTGGGGGAGGAGGG + Intronic
1006919122 6:37615859-37615881 GGGTAGGAACTTGGGAAGGCAGG + Intergenic
1007072873 6:39049331-39049353 GGGGAGGCACTGCGGGAGAGGGG - Intronic
1007223281 6:40295409-40295431 GGGCAGGAAGTGAGAGAGGCAGG + Intergenic
1007320737 6:41027409-41027431 CGGGAACAACTGTGGGAGACAGG + Exonic
1007377647 6:41467655-41467677 GGGGTGGAGCTGGGGGGGGCGGG + Intergenic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1008289834 6:49701271-49701293 TGGGAGAAAATGTGGGAGGGTGG - Intronic
1011016410 6:82760605-82760627 GTGGGGGAAGTGTGGGAGGGAGG + Intergenic
1011657736 6:89566705-89566727 GGAGGGTAGCTGTGGGAGGCAGG - Intronic
1013117716 6:107115211-107115233 GGGGAGGCGCTGGGGGCGGCGGG + Intronic
1013289603 6:108708847-108708869 GGGGAGGATGTGTGGAACGCAGG - Intergenic
1013916923 6:115351520-115351542 AGGGAGGAAGAGAGGGAGGCAGG + Intergenic
1014416430 6:121190335-121190357 AGGGAAGAACGGTGGGGGGCAGG - Intronic
1015042550 6:128739752-128739774 GGGGAGGAAGCGAGGGAGGGAGG - Intergenic
1015099706 6:129462111-129462133 AGGGAGGAAGAGTGGGAAGCCGG + Intronic
1015335888 6:132037643-132037665 GGGGAGGGAGTGAGGGAGGGAGG + Intergenic
1015924558 6:138296066-138296088 GGTGAGAAACTATGGGGGGCGGG - Intronic
1016199745 6:141394066-141394088 GGGGAGGGGCTGTGAGGGGCGGG + Intergenic
1016561762 6:145403367-145403389 GGGGAGGGGGTGTGGGAGGATGG - Intergenic
1016882760 6:148927209-148927231 GAGGAGGACCAGTGGGAGGGAGG + Intronic
1017041029 6:150308869-150308891 AGGGAGGAAGTGAGGGAGGGAGG + Intergenic
1017229120 6:152053198-152053220 AGGGAGGGACTGAGGGAGGGAGG - Intronic
1017898468 6:158701415-158701437 GGGGAGGAGCCGTGGGAAGAGGG + Intronic
1018183146 6:161242225-161242247 GGTGAGTAACTGTGGGGGCCCGG + Intronic
1018631569 6:165826781-165826803 GGGGACGCACAGGGGGAGGCTGG + Intronic
1018858284 6:167691103-167691125 AGGGAGGAACTCTCAGAGGCTGG - Intergenic
1019159243 6:170058159-170058181 GAGGAGGAACGGTGTGAGACAGG - Intergenic
1019295561 7:272242-272264 GGAGAGGAAATCTGGGATGCAGG - Intergenic
1019299494 7:296208-296230 GGGCAGGACCTGGGGGAGGGAGG - Intergenic
1019407668 7:892192-892214 GGGAAGGACATGTCGGAGGCCGG + Intronic
1019551713 7:1606615-1606637 GGGGAGGAGGAGTGGGAGGAGGG - Intergenic
1019551817 7:1606884-1606906 GGGGAAGAACAGGGGGAGGAGGG - Intergenic
1019736620 7:2653024-2653046 GGGTAGGCACTGGGGCAGGCAGG + Intronic
1019740453 7:2670409-2670431 GTGGAGGCAGAGTGGGAGGCGGG + Intergenic
1019925648 7:4190576-4190598 GTGGAGAGACTGTGGGATGCAGG + Intronic
1020005812 7:4783392-4783414 GGGGAGGAGGTGTCTGAGGCTGG - Exonic
1020014003 7:4820636-4820658 GGGAAGGAACCGTGGCCGGCAGG + Intronic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1020431542 7:8120985-8121007 GAGGGGGAACTGTGGGTGTCAGG - Intronic
1020598904 7:10248000-10248022 TGGGACGCACTGAGGGAGGCTGG - Intergenic
1020860812 7:13489695-13489717 GGAGAGGGACTGTGGTGGGCAGG - Intergenic
1020979104 7:15045926-15045948 AGGCAGGGTCTGTGGGAGGCAGG - Intergenic
1021116016 7:16747481-16747503 GGGAGGGAACTCTTGGAGGCTGG - Intergenic
1022139460 7:27480707-27480729 GGATACGAACTGTGAGAGGCTGG + Intergenic
1022171673 7:27837614-27837636 GGGGAGTAAGTCTGGGAGGTTGG + Intronic
1022473377 7:30695012-30695034 GGGGAGGAGGTGGGGGAGGAAGG + Intronic
1022675431 7:32495324-32495346 GGGGAGGAGCGGGGGGAGGGCGG - Intergenic
1023218060 7:37886615-37886637 GGGGAGGAATTGTGGGATAGAGG - Intronic
1023396917 7:39759981-39760003 GGGGAAGAACTCTGGGGAGCAGG - Intergenic
1023859940 7:44212582-44212604 GGGAAGGCTCTGTGGGAGGGAGG + Exonic
1024307580 7:47941153-47941175 GGGAAGGAAGTGGGGGTGGCGGG + Intronic
1026133175 7:67636922-67636944 AGGGAGGAACGGAGGGAGGGAGG - Intergenic
1026459788 7:70603824-70603846 TCAGAGGAACTGGGGGAGGCTGG - Intronic
1026461027 7:70615217-70615239 GGGGTGGAAGAGTGGGTGGCAGG + Intronic
1026965261 7:74435323-74435345 AGGCAGGAGCTGTGAGAGGCGGG - Intergenic
1026988693 7:74570921-74570943 AGGGAGGAGCTGTGGGGAGCTGG - Intronic
1027822675 7:83067627-83067649 AGAGAAGAACTGTGGGAGCCAGG - Intronic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1029364327 7:100107389-100107411 GGGGAGGAACTGGAGAAGGATGG + Exonic
1029370640 7:100148664-100148686 GGGGAGGATCTGGGAGGGGCGGG - Intergenic
1029654583 7:101915746-101915768 GTGGAGCAACTTGGGGAGGCGGG + Intronic
1030160391 7:106502344-106502366 AGCCAGGAGCTGTGGGAGGCAGG - Intergenic
1030389957 7:108915498-108915520 TGGGAGGAAGGGTGGGAGGGGGG - Intergenic
1030647088 7:112073752-112073774 GGGGAGGAGATGGGGGAGGAGGG + Intronic
1030942505 7:115671344-115671366 AGGGAGGAAGTGAGGGAGGGAGG - Intergenic
1031302469 7:120079912-120079934 GGTTAGAAGCTGTGGGAGGCAGG + Intergenic
1031540616 7:122990854-122990876 AGGGAGGAAGGGAGGGAGGCAGG - Intergenic
1031819614 7:126483760-126483782 GGGGAGGAAGGGAGGGAGGGAGG - Intronic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1032469946 7:132170991-132171013 TGGGGAGAACTGGGGGAGGCAGG - Intronic
1032839893 7:135705431-135705453 GGAGAGGAAATGGGGGAGGTTGG + Intronic
1033046532 7:137967500-137967522 GGGGAGTGACTGTGGGAGGAGGG - Intronic
1033165606 7:139036132-139036154 GGGGTGGGCCTGCGGGAGGCCGG + Intergenic
1034013889 7:147560737-147560759 AGGGAGGAAATGAGGGAGGGAGG + Intronic
1034106884 7:148497799-148497821 GGAGAGGAATGGTGGGAGGCGGG - Intergenic
1035100925 7:156395973-156395995 TGGGAGGGACTGGGGGAGGCTGG - Intergenic
1035470660 7:159106797-159106819 GGGGAGGTACAGAGAGAGGCCGG + Intronic
1035520855 8:274049-274071 GGGTAGGAAGTGTGGGATGTGGG + Intergenic
1035687327 8:1535099-1535121 CGGGAGGAATCGAGGGAGGCAGG + Intronic
1035707031 8:1683628-1683650 GGGGAGGAAGAGAGGGAAGCAGG + Intronic
1036017727 8:4804546-4804568 AGGGAGGAACACTGGGAGGGAGG + Intronic
1037908597 8:22729779-22729801 GGGGAGGACCTGGTGGAGGAGGG + Intronic
1038034583 8:23676284-23676306 TGGGAGGAAGTGAGGAAGGCAGG - Intergenic
1038054170 8:23842672-23842694 GGGTGGGAAGTGTGGGAGGGAGG + Exonic
1038726052 8:30083226-30083248 GGGGAGGCACGGCTGGAGGCGGG + Intergenic
1039344991 8:36693626-36693648 GAGGGGGAGGTGTGGGAGGCAGG + Intergenic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1039476471 8:37841678-37841700 GGGGAGGACTTGAGGGAGGGGGG - Exonic
1039617382 8:38966937-38966959 AGGGAGGGAGGGTGGGAGGCGGG - Intronic
1041007569 8:53510133-53510155 GGGCAGGAACTGTAGGGTGCTGG - Intergenic
1041227794 8:55717308-55717330 GGGGAGGAACTGGTGGTGGGTGG - Intronic
1041727185 8:61029369-61029391 GGAGAAGAACAGAGGGAGGCGGG + Intergenic
1042200795 8:66278110-66278132 GGGGAGGAGCTCAGGGAGGGAGG - Intergenic
1042313260 8:67399422-67399444 TAGGAGGAATTGTGGTAGGCTGG - Intergenic
1042467100 8:69140684-69140706 GGGGAGGAACTGCAGTGGGCGGG + Intergenic
1043762439 8:84084585-84084607 GGAGAGGAACAGTGAGAGGTTGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1045188393 8:99860263-99860285 GGTGAGGGACTGTGGGTGGGAGG + Intronic
1045665111 8:104476571-104476593 GGGGGGGAAATGTGGGATGGAGG - Intergenic
1046195988 8:110863069-110863091 GGGGAGGGGCTGTGGAAGGTGGG - Intergenic
1046490423 8:114945316-114945338 TGGGGGAAAGTGTGGGAGGCGGG - Intergenic
1046658165 8:116919604-116919626 AGGGTGGGACTGGGGGAGGCAGG + Intergenic
1046870956 8:119205527-119205549 GGGGTGGCAGTGGGGGAGGCGGG + Intronic
1047094198 8:121606596-121606618 TGAAAGGAACTGTGTGAGGCCGG - Intergenic
1047616365 8:126565572-126565594 GGGGAGGAACTTGGTGAGGAGGG - Intergenic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1048690342 8:136955820-136955842 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1049055382 8:140232370-140232392 GAGGAGGAACTGGGGGAACCTGG + Intronic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049548691 8:143246567-143246589 GGGGAGGAACTTTCGGGGGCGGG + Intergenic
1049548714 8:143246638-143246660 GGGAAGGAGCTTTCGGAGGCGGG + Intergenic
1049739222 8:144227977-144227999 GGGGAAGCACTTTAGGAGGCTGG + Intronic
1049792337 8:144477914-144477936 GAGGAGGAAATGTCGGGGGCGGG - Intergenic
1050434132 9:5591377-5591399 GGCCAGGCACTTTGGGAGGCTGG - Intergenic
1051039443 9:12789068-12789090 GGGGGGGTGCTGGGGGAGGCAGG - Intronic
1051166797 9:14271148-14271170 GGGGAGGTTCTATGGGACGCTGG - Intronic
1051834255 9:21317152-21317174 GGCAGGGAACTGTGTGAGGCAGG + Intergenic
1051859409 9:21607224-21607246 AGGGAGGAAGTGAGGGAGGGAGG + Intergenic
1052081376 9:24210011-24210033 CAGGGGGAAGTGTGGGAGGCAGG + Intergenic
1052777356 9:32745711-32745733 GGAGAGGAAAAGTGGGTGGCTGG - Intergenic
1052864256 9:33455462-33455484 TGGGAGGCACTTTGGGAGGTGGG + Intergenic
1053139820 9:35675663-35675685 GGGGTGGGACGGTGGGCGGCGGG - Intronic
1053182866 9:35989063-35989085 TGGGCGGATGTGTGGGAGGCGGG - Intergenic
1053288810 9:36866665-36866687 GGTGAGGAACTGAGGGGGGTGGG + Intronic
1053450844 9:38192813-38192835 GGGGGGCATCTGTGGGAGGTGGG + Intergenic
1054906792 9:70419739-70419761 GGGGAGGGAGTGGGGGAGGCGGG + Intergenic
1055552048 9:77440369-77440391 GGGGAGGATCTGGTGGAGACGGG - Intronic
1056742189 9:89267079-89267101 GGGGAGGGAGTTTGGGAGGGTGG - Intergenic
1057120064 9:92563749-92563771 GGGGAGGAAGAGGGGGAGGGAGG - Intronic
1057196052 9:93116014-93116036 GGGAAGGAATTGAGGGAGGAGGG + Intergenic
1057294435 9:93827148-93827170 GGTGAGGTGCTGAGGGAGGCGGG + Intergenic
1057303195 9:93898207-93898229 GGGGAGGGAGTGAGGGAGGGTGG + Intergenic
1057488724 9:95506406-95506428 GTGGAGGAGCTGTGGGTGGAAGG - Exonic
1057695010 9:97316974-97316996 AGAGAGGAGCAGTGGGAGGCTGG - Intronic
1057748265 9:97769886-97769908 GGGGAGGAGTTGCGGGAGGGAGG - Intergenic
1059224512 9:112659530-112659552 GAGGAGGAGATGTGGCAGGCAGG + Exonic
1059388573 9:113984516-113984538 AGGGAGGAGCTGTAGGAGCCAGG - Intronic
1059408395 9:114116595-114116617 GGAGAGGAACCGTGGGAGGCGGG - Intergenic
1059431385 9:114252526-114252548 GGGGTGGCTCTGTGGGAGGCAGG - Intronic
1059613573 9:115924694-115924716 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059613578 9:115924710-115924732 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1060192019 9:121599461-121599483 CGGGCGGAGCTGTGGGCGGCTGG + Intronic
1060207090 9:121688517-121688539 GGGGAGGAATTGTGGGTAGAAGG - Intronic
1061153421 9:128842612-128842634 GTGGAGGCACTGGGGGAGGAAGG - Intronic
1061202797 9:129147233-129147255 AGTGAGGAACTGGGGGAGGAAGG + Intronic
1061401880 9:130373024-130373046 TGGGAGGAACTGGGAGAAGCAGG - Intronic
1062192303 9:135254301-135254323 GGGGCTGTCCTGTGGGAGGCTGG - Intergenic
1062394783 9:136348386-136348408 GGGGAGGCCCTGTGTGCGGCAGG + Intronic
1062422325 9:136488773-136488795 CGGGAGGACCTGTGGGGCGCTGG + Intergenic
1062464201 9:136674008-136674030 AGGGAGGGGCTGTGGGGGGCTGG - Intronic
1185713394 X:2322116-2322138 GGGGGGGAAGAGTGGGAGGGGGG - Intronic
1187455935 X:19441313-19441335 GGGGAAGAATTGAGGGAAGCTGG + Intronic
1188142905 X:26574138-26574160 GGGGAGGAAGGGAGGGAGGGAGG + Intergenic
1188217833 X:27501207-27501229 GACGAGGAGCTGTGGGGGGCAGG - Intergenic
1188318289 X:28703888-28703910 AGGTAGGAAATGTGGGAGGCAGG - Intronic
1188380004 X:29479663-29479685 GGGGGGGAACGTTGGGAGGCGGG - Intronic
1190062725 X:47221574-47221596 GGGGAGGGGCTGGGGGAGACTGG - Intronic
1190076723 X:47322423-47322445 TGGGAGGCAGTGTGGGAGGGAGG - Intergenic
1190829669 X:54048498-54048520 GGGGAGGAATTTTAGGAGTCGGG - Intronic
1191674815 X:63783671-63783693 GGGGAAGGACTGTGGCAGTCAGG + Intronic
1191722804 X:64248739-64248761 GGGGAGGGTGTGTGGGGGGCTGG + Intergenic
1192203495 X:69081841-69081863 GGGGAGTAACCCTGGGAGCCAGG - Intergenic
1192213672 X:69143249-69143271 GGGGAGAACCTGTGAGAGCCAGG - Intergenic
1192239628 X:69319099-69319121 GGGGCAGAACTGCTGGAGGCAGG - Intergenic
1192363100 X:70451696-70451718 GAGGAGGAACCCTGGGTGGCGGG + Intronic
1192370106 X:70506126-70506148 GGGGAGGAACCGAGGTATGCAGG - Intergenic
1193037844 X:76972757-76972779 GGAGGGGGGCTGTGGGAGGCAGG + Intergenic
1193082688 X:77421550-77421572 GGTGAGGGACTGTGGCAAGCCGG + Intergenic
1193330705 X:80232670-80232692 GGGTGGGTACTGTGGAAGGCAGG + Intergenic
1193441837 X:81550758-81550780 GGTGGGGAAGTGTGGGAGGAGGG + Intergenic
1195729518 X:107951892-107951914 TGGGAGGTACTTTGGGAGGTGGG + Intergenic
1196016367 X:110944512-110944534 GAGCAGGAACTGGGGGAGGAAGG - Intronic
1196675194 X:118412841-118412863 TGGGAGGAAGAGTGGGAGGAGGG - Intronic
1196916891 X:120546225-120546247 TGGGAGGAAGAGTGGGAGGGGGG + Intronic
1196934983 X:120720754-120720776 TGGGAGGAAGGGTGGGAGGTGGG - Intergenic
1197757067 X:130002840-130002862 GGGGAGGAAATGGGAGAGGGTGG + Intronic
1197769789 X:130082696-130082718 GGGCTGGGGCTGTGGGAGGCAGG - Intronic
1197834185 X:130677203-130677225 GAGGAGGAAGTGAGGGAGGAAGG - Intronic
1197960279 X:131996991-131997013 GAGGAGGCACGGTGGGAGGAGGG - Intergenic
1198733869 X:139764802-139764824 GGGGAGGGATTGGGGGAAGCTGG - Intronic
1199420321 X:147637052-147637074 CGGGAGCAGCTGTGGGATGCAGG - Intergenic
1199627040 X:149750529-149750551 GGGGAGGAATTGGGGGCGGTAGG - Intergenic
1200002638 X:153069923-153069945 GGGGAGAAGCGGTGGGGGGCAGG + Intergenic
1200005085 X:153080086-153080108 GGGGAGAAGCGGTGGGGGGCAGG - Intergenic
1200123574 X:153802712-153802734 GGGGAGGAAGAGTGGGAGGGAGG - Exonic
1200806983 Y:7443381-7443403 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1200807005 Y:7443471-7443493 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1201377476 Y:13339052-13339074 AGGCAGGAACTGTGTGATGCGGG - Intronic
1201698498 Y:16854170-16854192 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic