ID: 914675542

View in Genome Browser
Species Human (GRCh38)
Location 1:149904895-149904917
Sequence CACTCCCCACTCCCCGTGTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914675542_914675549 3 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675549 1:149904921-149904943 GCTCTGGAGGTCAGGATGGCAGG 0: 1
1: 0
2: 1
3: 31
4: 377
914675542_914675550 4 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675550 1:149904922-149904944 CTCTGGAGGTCAGGATGGCAGGG 0: 1
1: 0
2: 2
3: 40
4: 385
914675542_914675554 13 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675554 1:149904931-149904953 TCAGGATGGCAGGGCAGGGAGGG 0: 1
1: 1
2: 13
3: 97
4: 824
914675542_914675551 8 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675551 1:149904926-149904948 GGAGGTCAGGATGGCAGGGCAGG 0: 1
1: 0
2: 10
3: 100
4: 799
914675542_914675556 18 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675556 1:149904936-149904958 ATGGCAGGGCAGGGAGGGGAAGG 0: 1
1: 1
2: 32
3: 516
4: 5855
914675542_914675552 9 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675552 1:149904927-149904949 GAGGTCAGGATGGCAGGGCAGGG 0: 1
1: 0
2: 6
3: 76
4: 691
914675542_914675557 22 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675557 1:149904940-149904962 CAGGGCAGGGAGGGGAAGGAAGG 0: 1
1: 2
2: 25
3: 606
4: 3674
914675542_914675547 -5 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675547 1:149904913-149904935 GAGTGAGGGCTCTGGAGGTCAGG 0: 1
1: 0
2: 2
3: 60
4: 582
914675542_914675553 12 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675553 1:149904930-149904952 GTCAGGATGGCAGGGCAGGGAGG 0: 1
1: 0
2: 13
3: 99
4: 858
914675542_914675555 14 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675555 1:149904932-149904954 CAGGATGGCAGGGCAGGGAGGGG 0: 1
1: 2
2: 15
3: 166
4: 1287
914675542_914675548 -1 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675548 1:149904917-149904939 GAGGGCTCTGGAGGTCAGGATGG 0: 1
1: 0
2: 5
3: 64
4: 478
914675542_914675546 -10 Left 914675542 1:149904895-149904917 CCAAACACGGGGAGTGGGGAGTG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 914675546 1:149904908-149904930 GTGGGGAGTGAGGGCTCTGGAGG 0: 1
1: 0
2: 4
3: 70
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914675542 Original CRISPR CACTCCCCACTCCCCGTGTT TGG (reversed) Exonic
901229946 1:7636150-7636172 GACCCCCCACCCCCGGTGTTGGG + Intronic
902348361 1:15835558-15835580 CCCTGCCCTCTCCCCGTGCTGGG + Intergenic
905908814 1:41639855-41639877 CTCTGCCCACTCTCCTTGTTGGG - Intronic
906294264 1:44639569-44639591 CCCTACCCACTCCTCCTGTTTGG - Intronic
911196786 1:95002734-95002756 CCTTCCCCACTCCCACTGTTTGG + Intronic
911482766 1:98464995-98465017 TACTCCCCACCCCCCATCTTTGG - Intergenic
914675542 1:149904895-149904917 CACTCCCCACTCCCCGTGTTTGG - Exonic
915121479 1:153632094-153632116 CACTCTCAACTCCCCTTATTTGG + Exonic
915551532 1:156638217-156638239 CACTCCACACTCCCTGTCTGCGG + Intergenic
915973162 1:160367854-160367876 AACTCCCCACCCCCCATGCTGGG - Intronic
916792730 1:168137486-168137508 CACTCCCCACTCCCCGGGGCTGG - Exonic
918428717 1:184436654-184436676 CACTCCCCTCTCCCCTTCCTAGG + Intronic
919809546 1:201399848-201399870 CCCTCCCCACTCCCTGGCTTCGG + Intergenic
920214319 1:204351179-204351201 CACACCCCACTCCCCCTGCCTGG - Intronic
920352816 1:205348971-205348993 CACTCCCCACTCCCTGAATAAGG - Intronic
923336077 1:232971309-232971331 CACTCTCCACTCCCCCTGATAGG - Intronic
924438853 1:244070243-244070265 GTCTCCCCTTTCCCCGTGTTCGG + Intergenic
924654720 1:245963496-245963518 CCCTCCCTACTCCCCATGATGGG - Intronic
1069981751 10:72257481-72257503 CACACCCCTGTCCCAGTGTTGGG - Intergenic
1070312924 10:75286948-75286970 CACACCTCACTCCCAGTGGTGGG - Intergenic
1073326732 10:102647594-102647616 CTCCACCCACTCCCCCTGTTTGG - Intronic
1075688332 10:124379140-124379162 CACTCCCCCCTCACCGTTCTTGG - Intergenic
1076640215 10:131910814-131910836 CCCTCACCACTCCCCGAGGTTGG - Intronic
1076679524 10:132164458-132164480 CATGCCACACTCCCCGTGGTGGG - Intronic
1076798730 10:132811067-132811089 CCATCCCCACTCCCCATGTCAGG - Intronic
1077373393 11:2193988-2194010 AGCTCCCCACCCCCCGGGTTTGG - Intergenic
1077808301 11:5611155-5611177 CAGTGCCCCCTCGCCGTGTTGGG + Exonic
1079392849 11:20037154-20037176 CCCTCCCCACCCCCCATCTTTGG + Intronic
1081397131 11:42599635-42599657 CACTCCCCCCACCCCATGATAGG + Intergenic
1082851020 11:57764901-57764923 AACTCCCCACTACCCTTGTTGGG + Intronic
1083770617 11:64864881-64864903 CACTCCCCCCTCCCCCTGGATGG + Intronic
1084529549 11:69718863-69718885 CACTGCCCACTCCCCCTCTCTGG - Intergenic
1085038982 11:73315891-73315913 CAGCCCCCTCTCCCCGTGTAGGG + Intronic
1091249790 11:134133664-134133686 CAGTCCCCACTCCCCTTGGGTGG - Intronic
1092062079 12:5559579-5559601 CTCTCCCCTCTCCACATGTTGGG - Intronic
1102908275 12:116694045-116694067 CCCTCCCCACTCCCAGTGCCGGG - Intergenic
1104309346 12:127640339-127640361 CACTCCCCATTGCCAGTGATTGG + Intergenic
1104623367 12:130334820-130334842 CACTCCCTGCTTCCCTTGTTGGG + Intergenic
1104873136 12:132014910-132014932 CACACCCCACCCCCCGTCCTGGG + Intronic
1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG + Intronic
1105425684 13:20292691-20292713 GCCTCCCCACTCCCCGTGGCGGG + Intergenic
1109346645 13:61123129-61123151 CCCTCCCCCCTCCCCGAATTTGG + Intergenic
1113026071 13:105942821-105942843 CAGTCCCCACCTCCAGTGTTGGG - Intergenic
1114466914 14:22929482-22929504 CACTCCCCATCCCTCCTGTTCGG - Exonic
1119103428 14:71901696-71901718 CACTCCCATCTCCCTGTTTTTGG + Intergenic
1119500033 14:75117685-75117707 ATCTCCCCACTGCCAGTGTTTGG - Intronic
1122871748 14:104641958-104641980 CACTCCTCACTCACCCTGTGGGG - Intergenic
1124892953 15:33749621-33749643 CACTCCCAACTCCCCGTCTGAGG + Intronic
1125738502 15:41944928-41944950 CACAAACCTCTCCCCGTGTTGGG - Intronic
1126189227 15:45862360-45862382 CACTCCACACTACCCGTATTAGG + Intergenic
1129361172 15:75025291-75025313 CACCACCCACTTCCCTTGTTTGG + Intronic
1130622662 15:85479751-85479773 GACTCCCCACCCCCCTTTTTAGG + Intronic
1130842558 15:87715104-87715126 CACTCACCACTCCCCAGTTTTGG - Intergenic
1130844719 15:87734084-87734106 CAGTCCCCACTCTCACTGTTGGG - Intergenic
1131494930 15:92900120-92900142 CCCTCCCCCCTCCCCCTGTTGGG + Exonic
1131669355 15:94602847-94602869 CACTCTCCAATCCCCGCTTTGGG - Intergenic
1132712609 16:1276280-1276302 CACTCCCACCTCCCCTTGGTGGG + Intergenic
1132799928 16:1747000-1747022 CTCTCCCTCCTCCCTGTGTTTGG + Intronic
1132931762 16:2462341-2462363 CACTCCCCAGGCCCCGTTCTTGG + Intronic
1137247524 16:46717755-46717777 CACTCCCCACTCCCCCAGGCTGG + Intronic
1139644182 16:68316007-68316029 CACTCCACAGACCCCGTGGTCGG - Exonic
1139945763 16:70640849-70640871 CCTTCCCCACTCCCCATTTTGGG + Intronic
1144947436 17:18977100-18977122 CTCTCCCCACTCCCCAGGTTGGG - Intronic
1146018099 17:29249644-29249666 CACTCCCCACTCTCCTCATTGGG + Intronic
1147054121 17:37821057-37821079 CACTGCCCATTCCCTGTGCTCGG - Intergenic
1147239979 17:39084516-39084538 CACTGCCCACTCCTGATGTTCGG + Intronic
1148124653 17:45230543-45230565 TTCTCCCCTCTCCCCTTGTTGGG + Intronic
1148441532 17:47714037-47714059 CACACACCCCTCCCCTTGTTAGG - Intergenic
1148675607 17:49443004-49443026 CCCTCCCCACTAGCCCTGTTGGG + Intronic
1148804504 17:50257490-50257512 CACTCCCCACTGCAAGTCTTGGG - Intergenic
1149550892 17:57538560-57538582 CACTCCCCACTCCCCGCAAGTGG + Intronic
1151972781 17:77467431-77467453 CACTCCCCAACCCCAGTGCTGGG - Intronic
1152612399 17:81322323-81322345 CACTCCCCACCACCCTTGCTGGG + Intronic
1152633595 17:81421405-81421427 CACCCCCGCCTCCCGGTGTTTGG - Intronic
1152747734 17:82049017-82049039 CACTACCTACTCACCGTGTGGGG + Exonic
1152848029 17:82614313-82614335 CCCTCCTCACTCCCTGTGTCGGG - Intronic
1153040752 18:811813-811835 CACTCCCCACCCCTTGTCTTTGG - Intronic
1153460201 18:5324912-5324934 CACTCACCACTCCCCTTGGTTGG - Intergenic
1156258710 18:35424355-35424377 CACCCCCCACACCCAGTCTTGGG + Intergenic
1156407347 18:36795491-36795513 GACTCCCCACTTTCCCTGTTGGG + Intronic
1156880401 18:42070754-42070776 CTCTCCCCTCTCCCCATCTTAGG + Intronic
1157067947 18:44373975-44373997 CACTCACCACTTCCCTTGGTTGG + Intergenic
1158848478 18:61469843-61469865 TACATCCCTCTCCCCGTGTTCGG - Intronic
1161438289 19:4277142-4277164 CTCTCCCCACTCCCCTCCTTGGG + Intergenic
1161955737 19:7493878-7493900 CACTCCCCTCTCCCCCAGTGGGG + Intronic
1164132570 19:22378584-22378606 CACTCCCCCCTCCCCATGACAGG + Intergenic
1164564017 19:29313030-29313052 CACTCCCCTCTCCCAGTCCTAGG - Intergenic
1165441921 19:35833357-35833379 CACTCCCCAATCTCAGTCTTGGG + Intronic
1168095190 19:54110368-54110390 TACTCCCCACTCCAAGTCTTAGG + Intronic
1168250913 19:55141471-55141493 CACTCCCCACTCCCGTCTTTGGG - Intronic
1168402827 19:56095758-56095780 CTCTCCCCACTACCCTGGTTTGG + Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
927199347 2:20568709-20568731 CATTCCACACTCACCGTGATAGG + Intronic
928245883 2:29626639-29626661 CACTCTCCCCTCCCCATGTGAGG + Intronic
930016696 2:46975569-46975591 CCCTCCCCACTCCCTGTGGTGGG + Intronic
932014137 2:68007203-68007225 ACCTCCCCACTGCCTGTGTTTGG - Intergenic
932441847 2:71742576-71742598 CACTCCTGACTCTCTGTGTTAGG - Intergenic
933939551 2:87233989-87234011 CACTCCCCTCTCTCCGTGGCAGG - Intergenic
936353584 2:111731784-111731806 CACTCCCCTCTCTCCGTGGCAGG + Intergenic
946334041 2:219025816-219025838 CTCTCCCCAGTCCCAGTGTCGGG + Intronic
947463131 2:230320398-230320420 CACTCCCCCCACCCCATGATAGG + Intergenic
947525596 2:230875038-230875060 ACCTCCCCACCCGCCGTGTTAGG + Intronic
948466285 2:238153300-238153322 CACCCCCCCCACCCCGTCTTGGG + Intergenic
1168828326 20:829301-829323 CTCTCACCACTCCCCATGGTGGG + Intergenic
1169142307 20:3233500-3233522 CACTACCCACTCACCATCTTGGG + Exonic
1169426129 20:5498726-5498748 CACTCTCCACTCCCAGAGTCTGG + Intergenic
1171245799 20:23608661-23608683 CCCTCCCCATTCCCCCTGCTTGG + Intergenic
1172285081 20:33734541-33734563 CCCTCCCCACTCCCCATTTCTGG - Intronic
1173681691 20:44886324-44886346 CTAGCCCCAGTCCCCGTGTTTGG + Intronic
1174815690 20:53684972-53684994 CACTTCCAACTCCCTGTGTTTGG + Intergenic
1175331380 20:58166982-58167004 CACTCCCCACTCCAGGGGTGTGG + Intergenic
1176054474 20:63136502-63136524 CACTCCCCACCTCCCGGGGTTGG - Intergenic
1179506840 21:41846857-41846879 CACTCCTCACTCCTCCTGGTTGG - Intronic
1180248978 21:46566938-46566960 CACACCTCACTGCCTGTGTTTGG + Intronic
1180934903 22:19619027-19619049 CACTCCTTCCTCCCCGTGGTGGG + Intergenic
1183364293 22:37399091-37399113 CCCTCCCCACTCCCAGGGATGGG + Intronic
1183459318 22:37940485-37940507 CCCTCCCCACCTCCAGTGTTTGG - Intronic
1185327303 22:50233204-50233226 CACTCCCCACTCCCTGCACTGGG + Intronic
952051963 3:29394884-29394906 CACTCCGCATTCCACCTGTTGGG + Intronic
952901201 3:38112668-38112690 CACTCCCTACTCCAAGTCTTGGG - Intronic
953373861 3:42412457-42412479 CACTCCCCACCCCAGGGGTTGGG + Intergenic
957320773 3:78627464-78627486 GAGGCCCCACTCCCCCTGTTCGG - Exonic
962321787 3:134396624-134396646 AACTTCCCACTCTCCGAGTTTGG + Intergenic
963166526 3:142210129-142210151 CTCTCCCCCATCCCCCTGTTAGG - Intronic
963284498 3:143419946-143419968 CATTCCATACTCCCTGTGTTCGG - Intronic
963890941 3:150635302-150635324 CACTGCCCTCTCCCCGTCTGGGG - Intergenic
964970830 3:162558222-162558244 CTCTCCCCACTCCCAGTGGAAGG - Intergenic
967107837 3:186268578-186268600 CAGTCCTCACTCCCCTGGTTCGG + Intronic
969488878 4:7487415-7487437 CACTTCCCCCTCCCCTTGTCTGG + Intronic
970447704 4:16137788-16137810 CACTGCCCCCACCCTGTGTTAGG + Intergenic
973618660 4:52705916-52705938 TACCCCCAACTCCCCGTATTTGG + Intergenic
980041769 4:127948191-127948213 CTCTCCACACTCCCCATGTGAGG - Intronic
981781377 4:148434841-148434863 CACTCCCCATTTCCTGTTTTAGG - Intronic
984685907 4:182667792-182667814 CACTCCCCCCACCCCATGATAGG - Intronic
985039812 4:185878857-185878879 CCCTCCCCACTTTCCGTGTGTGG + Intronic
986363809 5:7008966-7008988 CACTCCCCACTTCCCCTGTCAGG - Intergenic
992383927 5:76265739-76265761 CACTCCCCACTCCCCAGGTGAGG + Intronic
993913119 5:93708450-93708472 CATCCCCCACTCCCCATGTGTGG - Intronic
995138663 5:108707898-108707920 CACACCCCACTCCCACAGTTGGG + Intergenic
995269231 5:110202558-110202580 CACTCCCTAATCCCTGTGATTGG + Intergenic
995297593 5:110538994-110539016 AACTCTCCAATCCCCCTGTTGGG + Intronic
996188065 5:120504165-120504187 CCCTCCCCACTCCCGATATTTGG + Intronic
1001468140 5:171987110-171987132 CCATCCCCACTCCCCGTGCCTGG + Intronic
1002077191 5:176715264-176715286 CTCTGCCCTCTCCCCGTGGTTGG + Intergenic
1002608969 5:180401406-180401428 CACTTCCCAGCCGCCGTGTTTGG + Intergenic
1004925912 6:20415019-20415041 CCCCCGCCACTCCCCGTGGTAGG + Intronic
1008887905 6:56451013-56451035 CTCTCCCCACTGACCCTGTTAGG + Intergenic
1011653843 6:89531756-89531778 CTCTCCTCACTCCCTGTATTAGG + Intronic
1013820321 6:114146648-114146670 CAGTCCCCACTTCCACTGTTGGG - Intronic
1015466001 6:133549487-133549509 CACGCCCAACTCCCTGTGTCAGG + Intergenic
1018471038 6:164098177-164098199 CAGTCCCACCTCCCCGTGTGTGG - Intergenic
1022942892 7:35256623-35256645 AACTCCCCACTCTCCGCTTTGGG - Intergenic
1035374644 7:158399876-158399898 CGCTTCCCACTCCCCTTGCTGGG - Intronic
1036068736 8:5415858-5415880 CAATCCCCACTCCCCGCCCTCGG + Intergenic
1044692421 8:94894560-94894582 CAAGCCCCACTCCCGGTGTACGG - Intronic
1048572777 8:135669134-135669156 CAGACCACACTCCCCGTGTATGG - Intergenic
1058734449 9:107881545-107881567 CACTCCCCATAACCCCTGTTTGG + Intergenic
1059657197 9:116367739-116367761 CACTCACCTCTACCCGTGTGGGG - Exonic
1060993441 9:127862037-127862059 CACCCAGCACTCCCAGTGTTGGG + Intergenic
1188126779 X:26377891-26377913 CTCTCCCCACTCCCCATGACAGG + Intergenic
1189380656 X:40500202-40500224 CACTGCCCTCTCCCAGGGTTTGG + Intergenic
1189381718 X:40506945-40506967 CACTCCCCTCTCCCCAGGGTGGG - Intergenic
1193070352 X:77299650-77299672 CCCTCCCCACTCCGAGAGTTAGG + Intergenic
1193612357 X:83647864-83647886 CACTCCCCACCTCCAGTATTGGG + Intergenic
1195014943 X:100769154-100769176 AACTCCCAACTCCCTGAGTTGGG - Intergenic
1195267082 X:103192651-103192673 CACTCCCCACTTCCAGTTCTTGG + Intergenic
1197465999 X:126805182-126805204 CACTCCCCACACCCCATGACAGG - Intergenic
1198503848 X:137281374-137281396 CCCTCCCCACCCCCAGTTTTGGG - Intergenic