ID: 914677261

View in Genome Browser
Species Human (GRCh38)
Location 1:149914654-149914676
Sequence TTGTTGAAGCCTGTAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914677261_914677267 9 Left 914677261 1:149914654-149914676 CCCATGTTTACAGGCTTCAACAA No data
Right 914677267 1:149914686-149914708 TTCTCTCAACATAGTCTAATGGG 0: 1
1: 0
2: 2
3: 11
4: 126
914677261_914677266 8 Left 914677261 1:149914654-149914676 CCCATGTTTACAGGCTTCAACAA No data
Right 914677266 1:149914685-149914707 TTTCTCTCAACATAGTCTAATGG 0: 1
1: 0
2: 2
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914677261 Original CRISPR TTGTTGAAGCCTGTAAACAT GGG (reversed) Intronic
No off target data available for this crispr