ID: 914677831

View in Genome Browser
Species Human (GRCh38)
Location 1:149917634-149917656
Sequence CCTCCCCATAAGCAAAGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 133}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914677826_914677831 -1 Left 914677826 1:149917612-149917634 CCCCTAGAGAGGGGATCGTCACC 0: 1
1: 0
2: 0
3: 5
4: 29
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677812_914677831 26 Left 914677812 1:149917585-149917607 CCACCACCAACCCACCAACCCCC 0: 1
1: 1
2: 16
3: 261
4: 1957
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677816_914677831 15 Left 914677816 1:149917596-149917618 CCACCAACCCCCCTCACCCCTAG 0: 1
1: 0
2: 10
3: 70
4: 738
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677817_914677831 12 Left 914677817 1:149917599-149917621 CCAACCCCCCTCACCCCTAGAGA 0: 1
1: 0
2: 1
3: 40
4: 419
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677814_914677831 20 Left 914677814 1:149917591-149917613 CCAACCCACCAACCCCCCTCACC 0: 1
1: 1
2: 13
3: 140
4: 1239
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677820_914677831 8 Left 914677820 1:149917603-149917625 CCCCCCTCACCCCTAGAGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 236
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677828_914677831 -3 Left 914677828 1:149917614-149917636 CCTAGAGAGGGGATCGTCACCCT 0: 1
1: 0
2: 0
3: 2
4: 77
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677815_914677831 16 Left 914677815 1:149917595-149917617 CCCACCAACCCCCCTCACCCCTA 0: 1
1: 0
2: 4
3: 50
4: 591
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677822_914677831 7 Left 914677822 1:149917604-149917626 CCCCCTCACCCCTAGAGAGGGGA 0: 1
1: 0
2: 1
3: 26
4: 174
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677825_914677831 4 Left 914677825 1:149917607-149917629 CCTCACCCCTAGAGAGGGGATCG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677823_914677831 6 Left 914677823 1:149917605-149917627 CCCCTCACCCCTAGAGAGGGGAT 0: 1
1: 0
2: 1
3: 13
4: 137
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677813_914677831 23 Left 914677813 1:149917588-149917610 CCACCAACCCACCAACCCCCCTC 0: 1
1: 1
2: 10
3: 149
4: 1373
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677827_914677831 -2 Left 914677827 1:149917613-149917635 CCCTAGAGAGGGGATCGTCACCC 0: 1
1: 0
2: 0
3: 0
4: 40
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133
914677824_914677831 5 Left 914677824 1:149917606-149917628 CCCTCACCCCTAGAGAGGGGATC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG 0: 1
1: 0
2: 1
3: 20
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914677831 Original CRISPR CCTCCCCATAAGCAAAGCAT CGG Intronic
900283672 1:1889354-1889376 GCTCCCCAAAAGAAAACCATAGG + Intronic
902369520 1:15997146-15997168 CCTCCCCATAACCTTCGCATTGG - Intergenic
907432821 1:54423757-54423779 CCTCCACATTAGCCAGGCATGGG - Intergenic
912154084 1:106895746-106895768 CCTCCCAATAAAAAAAGCCTGGG + Intergenic
912394525 1:109330979-109331001 CCTCCCAACAAGAAAAGCCTAGG + Intronic
913645420 1:120849964-120849986 CCTCCCCCTACACAAAGCAAGGG + Intergenic
914081310 1:144413574-144413596 CCTCCCCCTACACAAAGCAAGGG - Intergenic
914176218 1:145282113-145282135 CCTCCCCCTACACAAAGCAAGGG - Intergenic
914530944 1:148523599-148523621 CCTCCCCCTACACAAAGCAAGGG - Intergenic
914677831 1:149917634-149917656 CCTCCCCATAAGCAAAGCATCGG + Intronic
916894436 1:169147547-169147569 CCTGGCCATATGCCAAGCATTGG - Intronic
917371972 1:174302604-174302626 CTTGCCCATAAGAAAAGGATAGG + Intronic
917895701 1:179484808-179484830 CCACCCCATAACCAATGCAAAGG + Intronic
918315928 1:183322689-183322711 CTTCCCCATACCCAAATCATAGG + Intronic
920664102 1:207947497-207947519 CCTCCCCAAATGCAAAATATTGG - Intergenic
922189826 1:223308415-223308437 CCTCCCCAGAAGCCCAGCAGAGG + Intronic
923890790 1:238213308-238213330 CCTCTCCAGAAGGAATGCATGGG - Intergenic
1064260648 10:13783218-13783240 CCTCACCATAACCAAAGAACTGG + Intronic
1065667185 10:28075009-28075031 CCTCCTCAGAAGCCAAGCAGAGG - Intronic
1067026197 10:42846164-42846186 CCTCCCCATGGGCAGAGCTTGGG - Intergenic
1067766507 10:49091305-49091327 CCTCCCCAGGAGCACAGAATAGG + Intronic
1068198183 10:53745688-53745710 CCTCCCAAGAAGCCAAGCAGAGG - Intergenic
1077258191 11:1598844-1598866 CCTCCCCAGAAGCTGAGCAGAGG - Intergenic
1079552375 11:21715625-21715647 CCTCCTCAGAAGCTAAGCAGAGG + Intergenic
1080611240 11:33905896-33905918 CCTCTCCAGAAGCCAAGCAGAGG + Intergenic
1084803766 11:71564966-71564988 CCTCCCCAGAAGCTGAGCAGAGG + Intronic
1085057921 11:73418427-73418449 CCTCACCAGAAGCTAAGCAGGGG + Intronic
1088960786 11:114662637-114662659 CCTCCCCTCAAGCAAAGGAAGGG - Intergenic
1090883031 11:130851165-130851187 CTTCCCCATAAGCAAATGACCGG + Intergenic
1092455538 12:8639472-8639494 CCTGCCCTTAAGCAAATTATAGG + Intronic
1092517234 12:9227351-9227373 CCTCCCCAGAAGCCTAGCAGAGG - Intergenic
1093553008 12:20437504-20437526 CCTCCCCAGAAGCTGAGCAGAGG - Intronic
1095361570 12:41347254-41347276 CATTCCCAAAAGCAATGCATTGG + Intronic
1095546533 12:43377857-43377879 TCTCCCAATAGGCACAGCATTGG + Intronic
1097161178 12:57047711-57047733 CCTCCCCACAAGCTACGCATTGG - Exonic
1100290329 12:93207629-93207651 CCTCCCCAGAAGCTGAGCAGAGG + Intergenic
1106164609 13:27232255-27232277 CTTCCCCAAAAGCAAAACCTAGG - Intergenic
1108777314 13:53782781-53782803 TCAGCCCATCAGCAAAGCATTGG - Intergenic
1112515403 13:100048961-100048983 CCTCCCCAGAAGCCAAGCAAAGG - Intergenic
1112915128 13:104539127-104539149 CCTCCTCAGAAGCCAAGCAGAGG - Intergenic
1112999968 13:105623595-105623617 CCTAACTTTAAGCAAAGCATCGG + Intergenic
1114454134 14:22844621-22844643 CCTCCCCAGGAGACAAGCATTGG + Exonic
1115450089 14:33537993-33538015 CCTGCCCATAAGCTAAGCATCGG + Intronic
1120915078 14:89703394-89703416 TCTCCCCAGAAGCTAAGCAGAGG - Intergenic
1121778065 14:96603809-96603831 CCTGCCCAGATGCTAAGCATGGG - Intergenic
1126069114 15:44850209-44850231 TCTCAGCATAAGAAAAGCATAGG + Intergenic
1128766011 15:70251614-70251636 CCTCACCATATGCAAAGCCCTGG - Intergenic
1128800248 15:70492660-70492682 CCTCCCCACAGGCCAAGCACAGG + Intergenic
1131756031 15:95563785-95563807 CCTCCCCAGAAACACAGCCTAGG + Intergenic
1131788869 15:95942421-95942443 CATTCCCAAAAGCAAAGTATGGG + Intergenic
1132361591 15:101220610-101220632 CCTCTCCATGAGCAGAGCAGAGG + Intronic
1133079593 16:3307972-3307994 CTTCCCCATAAGAAAAGAATAGG - Intronic
1133165922 16:3947120-3947142 TCTCCCCATGAGCAAACTATGGG - Intergenic
1133436418 16:5784071-5784093 CCTCCCTAGAAGCCAAGCAGAGG - Intergenic
1133541899 16:6764113-6764135 CCTCTCCATACGCAAAGACTGGG - Intronic
1135937812 16:26795920-26795942 CATCACCTTAAACAAAGCATAGG - Intergenic
1139164808 16:64553347-64553369 CCTCCCCATTATCATTGCATTGG - Intergenic
1141575872 16:84963305-84963327 CCTCCCTCTAAGCCAAGCAAGGG - Intergenic
1141850153 16:86639721-86639743 CTTCCTCAGAAGCAAAGCCTGGG + Intergenic
1142907573 17:3055429-3055451 CCTCCAAATAAGAAAAGAATAGG - Intergenic
1142926992 17:3248830-3248852 CCTCCAAATAAGAAAAGAATAGG + Intergenic
1143074194 17:4326468-4326490 CATTCCCATTAGCAATGCATGGG - Intronic
1144349588 17:14382207-14382229 CCCCCCAAGAAGCAAAGCAATGG + Intergenic
1144535355 17:16083673-16083695 CCTCCCCAGAAGGCGAGCATAGG - Intronic
1144760904 17:17706715-17706737 CCTGCCCATAGACAAACCATTGG + Intronic
1148855467 17:50576746-50576768 CCTCACCAATAGCAAAGCCTTGG - Intronic
1150132487 17:62676614-62676636 CTTCCCCATAAACAGATCATTGG + Intronic
1151196901 17:72438172-72438194 CGTACCCATTAGCAAAGCAGAGG + Intergenic
1151878526 17:76880907-76880929 GCTCCCCAGAAGCAGAGCCTGGG - Intronic
1152604093 17:81280340-81280362 GATCCCCACAAGCAGAGCATTGG - Intronic
1152790479 17:82276024-82276046 CCTCCCCAGAAGCTGAGCAGAGG + Intergenic
1153678931 18:7481548-7481570 CCTCCTCATAAGCAATTCATGGG + Intergenic
1155107936 18:22686349-22686371 CCTCACCAGAAGCCAAGCAAAGG - Intergenic
1155971496 18:32087785-32087807 CCTGCCCTTAAGCAAATTATAGG + Intergenic
1156191223 18:34723245-34723267 ACTTGCCATAAGCAAAGCATCGG + Intronic
1158814895 18:61083922-61083944 TCTCCAAATAACCAAAGCATAGG - Intergenic
1160447880 18:78941378-78941400 CCTCCCCAGAAGCCAAGCAGAGG + Intergenic
1163058738 19:14742702-14742724 CCACCCAATAAGGCAAGCATGGG - Intronic
1167078136 19:47261344-47261366 GCTCCCCATAACCAAAGCCGGGG - Intronic
926831912 2:16972418-16972440 ATTCCTCATAAGCAATGCATTGG - Intergenic
926854000 2:17232094-17232116 CCTCCCCAGAAGCCAAGCAGAGG + Intergenic
927055199 2:19360364-19360386 TCTCCAAATAAGCAAAGCTTGGG + Intergenic
928292308 2:30050208-30050230 CCTACATATATGCAAAGCATGGG + Intergenic
928396796 2:30948911-30948933 CTTCCCCAGAAGCCATGCATGGG + Intronic
930479084 2:51924492-51924514 CCTAACCAGAAGCCAAGCATAGG + Intergenic
930906513 2:56574813-56574835 CCTCCCCAGAAGCTGAGCAGAGG + Intergenic
932100909 2:68898301-68898323 CCTCCCCAGAAGCTGAGCAGAGG - Intergenic
932334822 2:70924206-70924228 CCTCCCTAGAAGGAAAGAATGGG + Intronic
933468065 2:82681626-82681648 CATCCCCATCAGCAATGTATGGG - Intergenic
933893775 2:86792391-86792413 CATCCCCAGAAACACAGCATGGG + Intronic
935234421 2:101126436-101126458 CCTGCCCATAAGCAAATCTTGGG + Intronic
940064039 2:149607133-149607155 CCTCCCCAGAAGCTAAGCAGGGG - Intergenic
940341344 2:152584933-152584955 CCCCACCATAAGCAAAGCTTTGG - Intronic
943012505 2:182467416-182467438 CCTTCCCAAAAGGAAAACATTGG + Intronic
948786909 2:240357416-240357438 CCTCCCCTCAAGCAATGCATTGG - Intergenic
1169880263 20:10340066-10340088 CCTCCCCAGAAGCCAAGCAGAGG - Intergenic
1170468278 20:16642987-16643009 CCTCCCCATGAGCAGCTCATCGG - Intergenic
1174501816 20:50990684-50990706 CCTCTATATAAGCAAAGCTTAGG - Intergenic
1177099908 21:16887640-16887662 CTTTCCCATAAACATAGCATAGG - Intergenic
1177720629 21:24902449-24902471 CCACCCCATAAACTAAGTATGGG - Intergenic
1180939726 22:19651409-19651431 ACTTCCCATAAGCAAAGCCTAGG + Intergenic
949097948 3:108791-108813 CCTCCTCAGAAGCAGAGCAGAGG - Intergenic
949797270 3:7864558-7864580 CCTCACCAGAAGCCAAGCAGAGG + Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954692813 3:52404719-52404741 CCTCCCCACAAGCCAAGGACAGG - Intronic
956189917 3:66598650-66598672 CCTCACCATCAGGAAAGCATTGG + Intergenic
968801674 4:2747052-2747074 CCTCCTCATCATCAAAGCAAGGG - Intronic
968850778 4:3075961-3075983 CCTCCCCATCAGCAACGTGTTGG - Intronic
973178692 4:47241633-47241655 CATCCCCATAGGGAAAGCAGAGG + Intronic
973343915 4:49033575-49033597 CCTCCCAAAAAGTAAAGAATGGG + Intronic
977355472 4:95940855-95940877 CCACACCATCAACAAAGCATAGG - Intergenic
979398487 4:120218606-120218628 CCTCCCCAGAAGCTGAGCAGAGG + Intergenic
979670355 4:123354721-123354743 CCACCCCAAGAGCAAAGCAGAGG + Intergenic
988296403 5:29368661-29368683 CCTCCCTAGAAGCCAAGCAGAGG - Intergenic
988851526 5:35185794-35185816 CCTCCCCACAAGCAATCAATGGG - Intronic
989467352 5:41772781-41772803 CCTCCACATATGAAAAGCACTGG - Intronic
990437939 5:55812833-55812855 CCTCCCCATAGTGAAAGCAGGGG + Intronic
990850640 5:60199923-60199945 TCTTGCCATAAGCAAAGAATAGG - Intronic
996722305 5:126641732-126641754 CCTCCCCAGAAGCCAAGCAATGG + Intergenic
997236593 5:132275578-132275600 CCTCCCCTAGAGCAAAGCCTCGG + Intronic
999135286 5:149314738-149314760 CTTCACCATAAGCATAGCACCGG - Intronic
1000980469 5:167811466-167811488 CCTCCCCAGAAGCCAAGCAGAGG + Intronic
1004053662 6:12112986-12113008 CCTCCCCCTGAGCAAAGCCTTGG - Intronic
1004062542 6:12211958-12211980 TCTCCCAACAAGGAAAGCATTGG - Intergenic
1008148082 6:47916329-47916351 CCACCCCAGAATCCAAGCATTGG + Intronic
1009465821 6:63967701-63967723 AATCCCCATAAGCAAAACAGAGG + Intronic
1011883464 6:92060219-92060241 CCTACCAATAAGAACAGCATGGG - Intergenic
1011958520 6:93055659-93055681 CCTCCCGATAAAAAAAGCACAGG - Intergenic
1014397573 6:120945050-120945072 CCTCCCCAGAAGCTGAGCAGAGG - Intergenic
1016040887 6:139431048-139431070 CCTCCTCTTAAGGAAATCATGGG + Intergenic
1028541589 7:91948383-91948405 CCTTCCCATCAGCAATGTATAGG + Intronic
1029011439 7:97265922-97265944 CCTCCCCACCACCAAAGCATAGG + Intergenic
1030209392 7:106981323-106981345 CCTCCCCAAAAGACAAGCAAAGG + Intergenic
1032394765 7:131581503-131581525 CCTCTCCATAAATAAAGCACAGG + Intergenic
1032421557 7:131783806-131783828 CCTCACCATAAGAAAATGATGGG - Intergenic
1033860772 7:145623893-145623915 CTTCCTCATAAGCAAAGAAGGGG + Intergenic
1037747785 8:21660817-21660839 CCTCCCCAGAAGCAGAGCGGCGG - Intergenic
1039269502 8:35865676-35865698 CCTCACCAGAAGCAGAGGATGGG - Intergenic
1039506993 8:38059391-38059413 CCTCCCCAGAAGCCAAGCTGAGG + Intronic
1040744764 8:50627968-50627990 CCTCCCCAGGATTAAAGCATGGG + Intronic
1042465823 8:69129440-69129462 CCCCCTCATAGGCAAAGGATTGG + Intergenic
1047559054 8:125966639-125966661 CCTTCCCATCAACAAAGCCTGGG - Intergenic
1047680998 8:127254008-127254030 CCAGCCCATAAGCACAGCAAGGG - Intergenic
1049225626 8:141449254-141449276 ACTCCCCAGAACCCAAGCATGGG + Intergenic
1050337710 9:4605598-4605620 CCTACCCATAGGAAAAGCACTGG + Intronic
1055191517 9:73530313-73530335 CCTCCCCAGAAGCCAGGCAGAGG + Intergenic
1057138329 9:92710832-92710854 CCTCCTCATCAGGATAGCATAGG + Intergenic
1058786738 9:108395092-108395114 ACTCCACATCAGCACAGCATAGG - Intergenic
1060057395 9:120426549-120426571 CATCCACATAAGAAAAGCCTTGG - Intronic
1186475252 X:9852280-9852302 CCTTCCTAAAAGCAAAGCATGGG - Intronic
1187181892 X:16950496-16950518 CGTTCCCATCAGCAATGCATTGG + Intronic
1193939034 X:87657778-87657800 CCACCTCATAGGCAAAGCATGGG - Intronic
1195666009 X:107431753-107431775 TCTACCTATAAACAAAGCATGGG + Intergenic
1198505781 X:137300037-137300059 CATTCCCATCAGCAATGCATTGG - Intergenic
1200375409 X:155774776-155774798 AGTCCCCAACAGCAAAGCATAGG + Exonic