ID: 914678487

View in Genome Browser
Species Human (GRCh38)
Location 1:149922206-149922228
Sequence GAGTGGATATTGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914678487_914678496 12 Left 914678487 1:149922206-149922228 CCAGCTTCCCTCAATATCCACTC 0: 1
1: 0
2: 2
3: 19
4: 238
Right 914678496 1:149922241-149922263 TATCAATTTCCATTAGTATTTGG 0: 1
1: 0
2: 2
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914678487 Original CRISPR GAGTGGATATTGAGGGAAGC TGG (reversed) Intergenic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
901401904 1:9020472-9020494 GAGTGGATCATGAAGGCAGCAGG - Intronic
901784162 1:11613566-11613588 CAGTGGACTTTGAGGAAAGCAGG - Intergenic
901977993 1:13010643-13010665 GGGTGGATAATGAGGTCAGCAGG + Intronic
902004093 1:13218294-13218316 GGGTGGATAATGAGGTCAGCAGG - Intergenic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902661280 1:17905771-17905793 GAGTGGATAATGGGGTCAGCAGG + Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903874610 1:26464896-26464918 GGGTGGATCGTAAGGGAAGCAGG + Intronic
904278454 1:29399972-29399994 GAGTGGTTATTTAGGGTATCTGG + Intergenic
904895568 1:33814912-33814934 GACTGGATAGTGAGGGAAGAGGG - Intronic
905031822 1:34889458-34889480 AAATGGATGTTGGGGGAAGCAGG - Intronic
905949827 1:41940813-41940835 GAGAGGATAAAGAGAGAAGCTGG + Intronic
905984770 1:42269919-42269941 GGGTGGAGAATGATGGAAGCAGG - Intronic
906416931 1:45627144-45627166 GAATGGCTAGTGAAGGAAGCAGG - Intergenic
909716221 1:78710350-78710372 TAGTGGTTATTGTGGGCAGCAGG + Intergenic
910566287 1:88646680-88646702 GAGTTGATATTGAGAACAGCTGG + Intergenic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912976778 1:114338045-114338067 CAGTTGATATTCAGGGAATCTGG + Intergenic
913310459 1:117485834-117485856 GAATGGATATTGAGGGACTGTGG - Intronic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
915569675 1:156737738-156737760 GAGTGGAGATTTACTGAAGCAGG - Exonic
915946437 1:160155750-160155772 GGGTGGATTGTGAGGGAGGCTGG - Intronic
916628954 1:166591300-166591322 TAGTGGATATTGTGGGCACCTGG - Intergenic
916911353 1:169350466-169350488 GAGGGGATCTTGAAGAAAGCAGG + Intronic
916941261 1:169680949-169680971 GAGTGGAGATAAACGGAAGCAGG - Intronic
918422385 1:184377160-184377182 GAGTGGATTTTGAGGGAACATGG + Intergenic
918725410 1:187915504-187915526 GATTGGATCCTGAGGAAAGCAGG - Intergenic
920220059 1:204390411-204390433 GGGTGGATGTTGAGGGAATGGGG - Intergenic
920689721 1:208136603-208136625 GCCTGTATATTGAGGGGAGCGGG + Intronic
922243871 1:223776348-223776370 GAGTGGATTTTGAGGGCAAAGGG + Intergenic
923946839 1:238897933-238897955 GGGTGAATAAGGAGGGAAGCAGG + Intergenic
924049052 1:240061931-240061953 GAGGGAATAGGGAGGGAAGCTGG - Intronic
924563155 1:245173726-245173748 GAATGGCTATAGAGGGATGCAGG + Intronic
924885388 1:248210133-248210155 GTGTGGATGCTGAGTGAAGCTGG - Intergenic
1064483148 10:15759575-15759597 GAGAGTCTGTTGAGGGAAGCAGG + Intergenic
1064856073 10:19768379-19768401 GAGTATATATTTAGGGAAACTGG + Intronic
1066444139 10:35466308-35466330 GAGAGGATATTCAGGGCAGAGGG + Intronic
1067271088 10:44791765-44791787 GAGTGAATATTGAGAGAAATAGG - Intergenic
1068997670 10:63225989-63226011 GAGTGTATGTGGAGGGAAGGGGG - Intronic
1069717218 10:70529080-70529102 GAGTGGATATTGAGGGACAATGG + Intronic
1069915570 10:71784684-71784706 AAGAGGATGATGAGGGAAGCAGG - Intronic
1070381226 10:75882150-75882172 GAGTGGTTGTTGAAGGAAGACGG + Intronic
1073072710 10:100805101-100805123 GAATAGATATGGAGGGAAGATGG + Intronic
1073115047 10:101087235-101087257 GAGTGGAGAACAAGGGAAGCGGG - Intergenic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074524503 10:114252336-114252358 GAGTAGAGATTGAGGGGAGGAGG + Intronic
1078440078 11:11357449-11357471 GGGTGGAGATTGATGGAAGGCGG - Intronic
1079803036 11:24895504-24895526 GAGTGGGGAGTGAGGGAGGCAGG - Intronic
1080244955 11:30169353-30169375 GAGGGGATATTCAGGAAAGAAGG + Intergenic
1080812433 11:35717974-35717996 GAGTGGAGATTCAGGGCACCAGG + Intronic
1083493432 11:63030077-63030099 GTGTGGATATGGGAGGAAGCAGG + Intergenic
1083684636 11:64368938-64368960 GAGTGGAATTTGAGGGGAGTAGG + Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085526369 11:77166519-77166541 GTGTGGATACTCAGAGAAGCTGG + Intronic
1088329923 11:108640840-108640862 GAGTGTATATTCAGGGCAACTGG - Intergenic
1089736100 11:120551147-120551169 GAGATGAGAGTGAGGGAAGCCGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091213729 11:133886709-133886731 GAGTGGATATTGAGAGACTGAGG - Intergenic
1092082239 12:5725784-5725806 GAAGGGATGTTGAGGCAAGCAGG - Intronic
1093082475 12:14828917-14828939 GAATGGATATTAATGAAAGCAGG - Exonic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1097309064 12:58098881-58098903 GAGTGTTTATAAAGGGAAGCAGG - Intergenic
1097346826 12:58502522-58502544 GAGTGGACAGTGAGGGACCCAGG + Intergenic
1098605287 12:72382113-72382135 TAGTTGATATTAAGGGAACCAGG + Intronic
1101570290 12:105947373-105947395 GAGTGGATATTTTGGAAACCCGG - Intergenic
1102786491 12:115609243-115609265 GAGTGGATATTGGCAGAAGGGGG - Intergenic
1103912606 12:124360635-124360657 GGGTGGACAGTGAGGGAAGTGGG - Intronic
1103940668 12:124499684-124499706 GAGTGAATATGGGGGGAAGTGGG + Intronic
1105970379 13:25424273-25424295 GAATGGATATTGGGCCAAGCAGG - Intronic
1106956153 13:34941968-34941990 AAGAGGATATTGAGAGAAGGAGG + Intergenic
1109119525 13:58436595-58436617 GATGGGATATAGAGGGATGCAGG + Intergenic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1109758151 13:66788967-66788989 CAGTGGATTTTTAGGGAACCAGG - Intronic
1111997320 13:95177561-95177583 AAATGGATCTTCAGGGAAGCAGG + Intronic
1111998144 13:95184991-95185013 AAATGGATCTTCAGGGAAGCAGG + Intronic
1113918964 13:113894985-113895007 GAGTTGACATTGGGGGAGGCTGG - Intergenic
1114192924 14:20454190-20454212 GAGTGTATATTCAGGGCAACTGG + Intronic
1114711251 14:24780729-24780751 GACTGGAGATAGAGGGAAACAGG + Intergenic
1116895012 14:50307644-50307666 GAGTTGATAATTAGTGAAGCTGG - Intronic
1119046825 14:71325850-71325872 AAGTTGAAATTGCGGGAAGCAGG + Intronic
1119158012 14:72429340-72429362 GAGTGGATGTTGAGGGCCCCAGG + Intronic
1120832390 14:89008869-89008891 GAGTGGATAAGGAGGTGAGCAGG + Intergenic
1121916006 14:97837424-97837446 GAGTGGAGAGGGAGGGCAGCAGG + Intergenic
1122279125 14:100610799-100610821 GAGGGGGTACTGAGGGGAGCAGG + Intergenic
1122578615 14:102757312-102757334 GGGTGGCTATTGAGGAATGCTGG - Intergenic
1125094733 15:35838156-35838178 GATTGGATACTGAAGGAAGGAGG + Intergenic
1125291483 15:38152894-38152916 GAGTGTATATTAGGGGAAACTGG + Intergenic
1125721934 15:41849374-41849396 GAGTGGGGATTGGGGAAAGCAGG + Intronic
1125749199 15:42017234-42017256 GAGTAGATATTGAAGGAGGCAGG - Intronic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1129175548 15:73837498-73837520 GAGTCTATGCTGAGGGAAGCTGG + Intergenic
1129494088 15:75960204-75960226 GAGTGATTAATGAGGGAAGTAGG + Intronic
1130970362 15:88727475-88727497 GAGTGATGATTAAGGGAAGCTGG + Intergenic
1133656241 16:7867372-7867394 GCTTGGATATTCATGGAAGCAGG + Intergenic
1134821259 16:17249185-17249207 GAGGGTATATTGAAGGGAGCTGG + Intronic
1135095638 16:19562274-19562296 GATCAGATATTGAGGGCAGCTGG + Intronic
1136984389 16:35085137-35085159 AGGTGGAAAGTGAGGGAAGCTGG + Intergenic
1141127282 16:81409548-81409570 GAGGGGGTATTGGGAGAAGCAGG + Intergenic
1141319097 16:82989956-82989978 AAATGGCTATTGAGGGGAGCTGG - Intronic
1142365838 16:89649214-89649236 GTGGGGAGGTTGAGGGAAGCTGG - Intronic
1144260203 17:13511226-13511248 GAGTGGATATTTAGGGTTTCTGG - Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1148866145 17:50629722-50629744 GAGTGGATGGTGGGGGCAGCAGG + Intergenic
1150623439 17:66825006-66825028 GAGAGGCTATTGAGAGAAGGAGG - Intergenic
1151326405 17:73382379-73382401 TAGAGGATATTTAGGGAAGGAGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152806620 17:82359831-82359853 GAGGGGAACTTGAGGGAAACTGG - Intronic
1153063039 18:1013752-1013774 GAGTGGGTTTTGGAGGAAGCTGG + Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156804755 18:41164744-41164766 GAAAGGATATGGTGGGAAGCAGG + Intergenic
1156914443 18:42448491-42448513 GAGTGGTGATTTAGGGTAGCAGG - Intergenic
1158173089 18:54621097-54621119 GAGTGCCTAATGAGGGAATCTGG + Intergenic
1158213041 18:55071234-55071256 GAATGGAAATCGAGGGCAGCTGG - Intergenic
1159103524 18:63980779-63980801 AAGAGGATATAGAGGGAAGGAGG - Intronic
1160954156 19:1682423-1682445 GAGTGGAGAGTGAGTGAAGACGG - Intergenic
1161709147 19:5838123-5838145 GAGGGGAGATTGGGGGAAACGGG + Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1166373278 19:42313924-42313946 GTGTGGATATTGGGGGAACGGGG + Intronic
1166704824 19:44902977-44902999 GCATGGATATGGTGGGAAGCTGG + Intronic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
926843262 2:17106024-17106046 GAGTGGATGGAGAGGTAAGCGGG + Intergenic
927533350 2:23831877-23831899 GATATGATATTGAAGGAAGCAGG - Intronic
932497306 2:72152613-72152635 GAGTGGGCATTGAGGGACTCTGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
937060385 2:118976465-118976487 GAGGGGAAATTGAGGGATCCAGG - Intronic
937627913 2:124064536-124064558 GAGTGAAAATTGATGGATGCAGG - Intronic
937758468 2:125570006-125570028 GATTGGCTATTGAGGAAAGGAGG + Intergenic
937980408 2:127611407-127611429 GGGTGGACATGGGGGGAAGCAGG + Intronic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
940052467 2:149479006-149479028 GAGTGGATTGTGAGGAAATCGGG - Intergenic
940652061 2:156450381-156450403 GAATGTATATAGAGAGAAGCAGG + Intronic
940677872 2:156746872-156746894 GGGTGGATATTCTGGGAAGCAGG - Intergenic
941241145 2:163039680-163039702 GAATGGATATACATGGAAGCTGG - Intergenic
941709155 2:168693539-168693561 GAATGGATATTCAGGGCAGATGG - Intronic
943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG + Intergenic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
946827755 2:223696115-223696137 GAGTGGATAATGAGGAAGGTGGG - Intergenic
947744177 2:232499216-232499238 GAGGGGATGTTGAGGGAGGTGGG - Intergenic
948751967 2:240138136-240138158 GAGTGGACAGTGTGGGACGCAGG + Intergenic
1169870226 20:10241346-10241368 GAGGGGATATTGATGGACCCGGG - Intronic
1174466267 20:50719970-50719992 GAGTGGATATTGAGGAAATGAGG - Intergenic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1176090762 20:63317695-63317717 GAGAGGATGGTGAGGGAAGCCGG - Intronic
1178233358 21:30812947-30812969 GAGTGGATACGGGGGGAACCTGG + Exonic
1178408400 21:32344860-32344882 GAGTGGGTAGTGTGGGGAGCAGG - Intronic
1181863775 22:25839723-25839745 GAGTGGAGATTTTGGGGAGCAGG + Intronic
1182449867 22:30413273-30413295 GAATGGATATGCAGGGAAGTAGG + Intronic
1184127990 22:42501054-42501076 GAGTGGAAATTTAGGGCAGGCGG - Intergenic
1184136779 22:42554369-42554391 GAGTGGAAATTTAGGGCAGGCGG - Intronic
1184976455 22:48065885-48065907 GAGGGAATATAGAGGGAAGCTGG + Intergenic
949264312 3:2138986-2139008 GAGTGGATTTTCAGGAAAGCAGG + Intronic
949566312 3:5248061-5248083 GACTGGGTATTCAGTGAAGCAGG - Intergenic
949903636 3:8840066-8840088 GAGTGGATAGTGAGTGAATCGGG - Intronic
952671192 3:35971491-35971513 GAGTGTATACTTAGGCAAGCAGG + Intergenic
952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG + Intergenic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953340808 3:42132737-42132759 GAGAGGATATAGACAGAAGCAGG - Intronic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
956900621 3:73712098-73712120 GTGTTAATATTAAGGGAAGCTGG - Intergenic
959672551 3:108995726-108995748 GGGTGAATATGGAGGGAAACGGG + Intronic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
961542427 3:127609063-127609085 GAGAGGATATGGAGGGTTGCTGG + Intronic
961609026 3:128121868-128121890 GAGTGGAAATTGAGGGAGAATGG - Intronic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
965397796 3:168181227-168181249 GAGTGGGGAATGAAGGAAGCTGG + Intergenic
967115320 3:186332373-186332395 CAGTGGAAATTTAAGGAAGCAGG + Intronic
967365559 3:188682564-188682586 GAATGGGGTTTGAGGGAAGCTGG + Intronic
967844747 3:194034773-194034795 GACTGGATTTGGAGGGAAGTAGG + Intergenic
969602179 4:8182951-8182973 GAGTGGGTTTTGAAGGAGGCAGG + Intronic
970007951 4:11428547-11428569 GAGTGGATGCAGAGGGAACCAGG - Intronic
972454424 4:39239396-39239418 GAATATATATTGAGGGAATCTGG - Intronic
972954459 4:44371916-44371938 GAGCAGAGATTGAGGGAATCAGG - Intronic
973913220 4:55605033-55605055 CTGTGGACATTGAGGAAAGCTGG - Intronic
974732488 4:65886628-65886650 TAGTGGAAATTGAGAGAATCTGG - Intergenic
975351255 4:73349899-73349921 GAGTGGATGTTGAGGGCAGAGGG + Intergenic
975599363 4:76083233-76083255 GAGTGGAAATTGAGGAAAGGTGG - Intronic
976400408 4:84600870-84600892 GAATGGAAATGGAGGGAGGCTGG + Intronic
977305515 4:95318832-95318854 GAAAGGATATTGAAGAAAGCAGG + Intronic
977505242 4:97893813-97893835 GAATGGATGTTGAGGGAGACAGG + Intronic
979829282 4:125280821-125280843 GAGTGGATGCTGAGGGGAGCAGG - Intergenic
983577137 4:169271391-169271413 GAGTGGAGGCTGGGGGAAGCAGG + Intergenic
984009162 4:174349620-174349642 GAATGGATCTTGAAGGAGGCTGG - Intergenic
985419401 4:189768929-189768951 CAGTGGATATTTAGTGAAGAGGG + Intergenic
986252837 5:6076551-6076573 CAGTGAATATTGAGTGAATCTGG - Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986631077 5:9774928-9774950 GAGTGAATATTGGTGGTAGCTGG - Intergenic
989122554 5:38018942-38018964 GAGTCTACATTGAGTGAAGCTGG + Intergenic
989137419 5:38168637-38168659 GAGTGGAAATTGAGGCAGGGAGG - Intergenic
991432433 5:66562357-66562379 AAGTGGAGACTGAGGGAAGGAGG - Intergenic
993777850 5:92023851-92023873 GAGTGGATTTTGAGGGGATCTGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1000064222 5:157681278-157681300 GAGAGGTTACTGAGGGAGGCAGG - Intergenic
1000676840 5:164131932-164131954 GAGTGGAGATTTAGGGTATCTGG + Intergenic
1003596178 6:7476128-7476150 GTGAGGCTAATGAGGGAAGCAGG + Intergenic
1003669099 6:8139296-8139318 GAGAGTCTGTTGAGGGAAGCAGG + Intergenic
1006397561 6:33797025-33797047 GAGTGGATATGGGGGGAAAGGGG + Intronic
1008346918 6:50438897-50438919 GAGTGGCTAATGAGGAAAGAGGG + Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013345178 6:109253175-109253197 GAGTGCAAAGTGAGGGAAGGTGG - Intergenic
1015129409 6:129792886-129792908 GAGTGGATATATAGGGAATGTGG + Intergenic
1015639530 6:135316175-135316197 CAGTGGATCTTGGAGGAAGCAGG - Intronic
1017496852 6:154991112-154991134 GAGTGGATGTTGAGGAAAGTGGG + Intronic
1018062126 6:160098425-160098447 TGGTGGATTTTGAGGGATGCAGG + Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1020035216 7:4959810-4959832 GAGTGGAAAGTGGGGGAAGTTGG + Intergenic
1021312465 7:19111108-19111130 GGGGTGATATTGTGGGAAGCTGG - Intronic
1021876563 7:25054891-25054913 GAGTGTATGTTGAAGGAAGCAGG - Intergenic
1022125187 7:27349471-27349493 GAGTGGATACTGAGTGGGGCTGG - Intergenic
1023367159 7:39475425-39475447 GAGGGGCTTTTGAGGGAAGATGG + Intronic
1023503965 7:40880863-40880885 GATTGGATATTGATGGAACCAGG + Intergenic
1023737577 7:43248471-43248493 TAGTGGAAGTTTAGGGAAGCTGG - Intronic
1024359040 7:48448390-48448412 GAGTTGACATTCAGGGAATCAGG - Intronic
1024951578 7:54866655-54866677 GTGGGGCTATTGAGAGAAGCTGG - Intergenic
1027556775 7:79673844-79673866 GAATAGCTATAGAGGGAAGCAGG + Intergenic
1030257462 7:107526903-107526925 GAAGGGATAATGAGGGAATCTGG + Intronic
1031562837 7:123258749-123258771 GAGAGGAGAATGAGGGAAGAAGG + Intergenic
1032788913 7:135227570-135227592 AAGTGAATATTAAGGAAAGCTGG + Intergenic
1033573432 7:142656682-142656704 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1035299379 7:157887413-157887435 GAGTGGGTACTGGGGGAAGTGGG - Intronic
1035299413 7:157887522-157887544 GAGCGGGTACTGGGGGAAGCGGG - Intronic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1036999021 8:13695458-13695480 GGGTGGATGTGGAGGGATGCTGG + Intergenic
1037892569 8:22631204-22631226 TACTGGATATTGAGGAAACCAGG - Intronic
1039652767 8:39360165-39360187 GAATGGATATTGTGTTAAGCAGG - Intergenic
1041752497 8:61276228-61276250 GGGTGGATATTGATGGCAACTGG - Intronic
1042857752 8:73285335-73285357 GGGATGAGATTGAGGGAAGCGGG - Intergenic
1044211762 8:89558969-89558991 GAGTGGATAGAGAAGGAAGTGGG - Intergenic
1046635475 8:116670499-116670521 AAGTGCATGATGAGGGAAGCTGG + Intronic
1047829804 8:128616982-128617004 GAGGGAATAGTGAGGGAAGTTGG + Intergenic
1048796034 8:138151185-138151207 GAGAGGATGTTTAGGTAAGCTGG - Exonic
1049702232 8:144020544-144020566 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049702394 8:144021141-144021163 GAGAGGATACTGAAGGAAGAGGG - Intronic
1052886038 9:33649076-33649098 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1053003747 9:34591368-34591390 GACGGGATCTTGAGGGGAGCAGG + Intergenic
1054923575 9:70565944-70565966 GAATGAATGATGAGGGAAGCTGG - Intronic
1056705746 9:88951607-88951629 CAGTAGATTTTGAGTGAAGCAGG + Intergenic
1059918320 9:119129135-119129157 GAGGGGAAAATGAGGGAAACTGG + Intergenic
1060903871 9:127287209-127287231 GAGTGGATTTTGGTGGCAGCTGG + Intronic
1061987384 9:134137306-134137328 GACTTGATCTTGAGGAAAGCGGG - Intronic
1062180924 9:135190766-135190788 GAGTGGCCATTGAGGAAGGCAGG - Intergenic
1185966412 X:4609852-4609874 GAGTAGACATTGAGTAAAGCAGG + Intergenic
1187865967 X:23723651-23723673 GAATGGATCATGGGGGAAGCAGG - Intronic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1189238437 X:39506991-39507013 GAGCTGATAATGAGGGAAGAGGG + Intergenic
1190423927 X:50313637-50313659 GAGTGGATATTGAAGAATCCAGG - Intronic
1191975161 X:66863583-66863605 GAGTGAATGGCGAGGGAAGCAGG - Intergenic
1193320999 X:80121055-80121077 AAGTAGATATGGAGGGATGCAGG - Intergenic
1194234259 X:91362493-91362515 GAGTGGACATTGAGTGGAGGTGG - Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195894756 X:109733708-109733730 GAGTGTCTTTTGAGGGCAGCTGG - Intergenic
1197844123 X:130783016-130783038 TAGTGGGTATTGAGGGGAACAGG + Intronic
1199179523 X:144836860-144836882 GAGTTGATATTTACCGAAGCTGG + Intergenic
1199668254 X:150119332-150119354 TAGTGGGTGTTGAGGGGAGCTGG + Intergenic
1199760368 X:150899739-150899761 GAATGGATATTGAGGGGAGGTGG - Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic