ID: 914679647

View in Genome Browser
Species Human (GRCh38)
Location 1:149930061-149930083
Sequence TAGTTGAAGCCTAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914679647_914679653 -3 Left 914679647 1:149930061-149930083 CCCTCCTCATTAGGCTTCAACTA 0: 1
1: 0
2: 1
3: 7
4: 143
Right 914679653 1:149930081-149930103 CTAGGCCTCGGGACTGATTAAGG 0: 1
1: 0
2: 0
3: 4
4: 57
914679647_914679656 9 Left 914679647 1:149930061-149930083 CCCTCCTCATTAGGCTTCAACTA 0: 1
1: 0
2: 1
3: 7
4: 143
Right 914679656 1:149930093-149930115 ACTGATTAAGGTTGATTTTAGGG 0: 1
1: 0
2: 1
3: 20
4: 246
914679647_914679655 8 Left 914679647 1:149930061-149930083 CCCTCCTCATTAGGCTTCAACTA 0: 1
1: 0
2: 1
3: 7
4: 143
Right 914679655 1:149930092-149930114 GACTGATTAAGGTTGATTTTAGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914679647 Original CRISPR TAGTTGAAGCCTAATGAGGA GGG (reversed) Intronic
901707778 1:11089260-11089282 TATTTGAATCCTAATAAGAAAGG + Intronic
904865830 1:33578176-33578198 AAGTTGAAGCCATATGTGGAGGG - Intronic
906831593 1:49037484-49037506 AAGTAGAAGCCAAGTGAGGAGGG - Intronic
909314199 1:74195351-74195373 AAGTTGAAGCCAAATGAATAGGG - Intronic
911743858 1:101417533-101417555 TAATTAAAGCCAAATGAGGTGGG + Intergenic
912225843 1:107732999-107733021 GAGATGAAGCCTACAGAGGAAGG + Intronic
914679647 1:149930061-149930083 TAGTTGAAGCCTAATGAGGAGGG - Intronic
914748755 1:150518212-150518234 TAGTTGGAGGGTAAAGAGGATGG - Intergenic
915618840 1:157065897-157065919 TATTTGTAGCTTAATGGGGATGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916741272 1:167649186-167649208 TAGTTGAAGGGTGAGGAGGAGGG + Intronic
916924159 1:169499833-169499855 TGGCTGAAGCCAAATGAGCAAGG - Intergenic
917856479 1:179105052-179105074 TAGTTCAAGCATCATGTGGACGG + Exonic
919439279 1:197609022-197609044 TAGCTGAAGTCTAATTTGGAGGG - Intronic
920676383 1:208041256-208041278 TAGAGGAAGGCTAAAGAGGAGGG + Intronic
922454839 1:225766322-225766344 TAATTGAAGTCTACTGAGGTAGG + Intergenic
1064341607 10:14490550-14490572 TGTTTGAAGCCTAATGATGCAGG + Intergenic
1064879942 10:20040082-20040104 TGGTTAAAGGTTAATGAGGAAGG - Intronic
1065325031 10:24543345-24543367 AACGTGAACCCTAATGAGGATGG + Exonic
1067381428 10:45777168-45777190 TAGCTGAAGCCCTAAGAGGATGG + Intronic
1067773384 10:49143871-49143893 TATTTAAAGGCTAATGAGGCTGG + Intergenic
1067889129 10:50117801-50117823 TAGCTGAAGCCCTAAGAGGATGG + Intronic
1069769888 10:70891484-70891506 CAGTTGAAGGGTGATGAGGATGG + Intergenic
1073423564 10:103442801-103442823 TTTTTGAGGCCTAATGAAGAGGG + Intronic
1075529648 10:123218556-123218578 TTGTTGCAGCCTGATGAGGGTGG + Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1084657350 11:70527254-70527276 TAGTTAAAGCCTCCTGGGGAGGG + Intronic
1087698061 11:101403534-101403556 TCATTGCAGCCTAAGGAGGAGGG + Intergenic
1089692972 11:120198105-120198127 TAGTTGAATCCAGATGTGGAGGG + Intergenic
1090675735 11:128994102-128994124 TATTTGAAAGCTAATGAGCATGG + Intronic
1090725657 11:129524967-129524989 TTGTTGAAGGCCAATGATGAAGG + Intergenic
1091033137 11:132209451-132209473 TATCTGAAGCTCAATGAGGATGG + Intronic
1091252749 11:134157276-134157298 TTTTTGAATCCTAATGAGAATGG - Intronic
1091664309 12:2407998-2408020 TTGTTACAGCCTGATGAGGATGG - Intronic
1093393582 12:18652770-18652792 TACTAGAAACCTAATGAGGTGGG + Intergenic
1095073851 12:37892934-37892956 GAGTTGGAGCCTACTGAGGCAGG - Intergenic
1096772323 12:53943828-53943850 TAGGTGAAAGCTAATGAGGAGGG - Intronic
1101145124 12:101833361-101833383 TAGTTGGAGCCTAAAGATAAAGG - Intergenic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1108091727 13:46856564-46856586 GAGTTAAAGCCTACTGGGGAAGG - Intronic
1108737479 13:53299473-53299495 TATTTTAAGTCTAATGAGCATGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1114348394 14:21822657-21822679 TAATTTAAGCCGAATGAGTATGG + Intergenic
1115478868 14:33842274-33842296 TGGTTGAAGCCAAAAGACGATGG + Intergenic
1119130235 14:72165357-72165379 TAGTTGCATCATCATGAGGAAGG + Intronic
1120584044 14:86288538-86288560 TACTTGAAGCCAAATTAGAATGG - Intergenic
1121337461 14:93086081-93086103 TAGTATCAGCCTAATGAGCAAGG + Intronic
1121872801 14:97425062-97425084 TATCTGAAGCCTACTGATGATGG + Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122366835 14:101199342-101199364 TAGTTGGGGCCAAATGAGGGTGG - Intergenic
1124593968 15:31078481-31078503 TTTTTGAAGGCTACTGAGGAAGG - Intronic
1125011109 15:34876776-34876798 TGGTTGAAGCTTAGTGAGTAAGG - Intronic
1125857539 15:42964693-42964715 TGGCTGAAGCCTAAGGGGGAGGG - Intronic
1126075022 15:44900735-44900757 GTGGTGAAGCCTAGTGAGGATGG + Intergenic
1126083344 15:44987087-44987109 GTGGTGAAGCCTAGTGAGGATGG - Intergenic
1128749653 15:70139960-70139982 TACTTTAAGCCTCATGAGGTGGG - Intergenic
1128772775 15:70294888-70294910 AGGTTAAAGCCTAATGAGAATGG + Intergenic
1129463452 15:75711363-75711385 CAGTTGAAGCCCAAGGAGGTGGG + Intronic
1129721435 15:77880039-77880061 CAGTTGAAGCCCAAGGAGGTGGG - Intergenic
1140318734 16:73927097-73927119 TTGTTGAAGCATTTTGAGGATGG + Intergenic
1147920505 17:43913756-43913778 TAGGTGAACCCCAATGAGGAGGG - Intergenic
1152599657 17:81255682-81255704 TTTTTGAAGCCAAATGAGGGAGG - Intronic
1156441442 18:37192697-37192719 TAATTAAAGCCTAATTAGTATGG - Intronic
1157160541 18:45310144-45310166 TCGTTGAAGCATCATTAGGATGG - Intronic
1159479380 18:68968088-68968110 TATGTGTTGCCTAATGAGGAAGG + Intronic
1159700517 18:71620935-71620957 ATGTTTAAGCTTAATGAGGAAGG - Intergenic
1159893550 18:73975180-73975202 AAGTTGAAGTTTGATGAGGAAGG + Intergenic
1162274929 19:9645516-9645538 TAGCAGAAGCCTCTTGAGGATGG + Intronic
1164518404 19:28956625-28956647 TGGTTAAAGGATAATGAGGAAGG + Intergenic
927482236 2:23463437-23463459 TTGTTGAGGGCTAATGAGGGAGG + Intronic
929041135 2:37745883-37745905 TAGTTGGAGCCAATTGATGAAGG + Intergenic
931925354 2:67066329-67066351 TAGTTGAAGTATAAGGATGAAGG - Intergenic
932944118 2:76207370-76207392 TATCTGAAGTATAATGAGGAGGG - Intergenic
933842617 2:86299607-86299629 AACTTGTAGCCTAATGAGGAAGG - Intronic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
941374790 2:164714322-164714344 TAGTAAAAGCCCAATGATGAGGG + Intronic
941552715 2:166936955-166936977 TATTGGTAGCTTAATGAGGATGG + Intronic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
944512770 2:200480938-200480960 TAGTTTAATCCTTATGAAGATGG + Exonic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
946705231 2:222452221-222452243 TGGTTGAAGCCTAATCAGAGAGG - Intronic
947517700 2:230821880-230821902 TTGTTGGAGCCTAACTAGGAAGG - Intergenic
948438404 2:237968863-237968885 GAGTTGAAGCATATTGAAGAAGG + Exonic
1168758416 20:331772-331794 TAGTTGATGCCTAATCAAAAAGG - Intergenic
1170397148 20:15938734-15938756 ATGTTTAAGCTTAATGAGGAAGG + Intronic
1172385700 20:34532604-34532626 CAGTTGAAGCTTCCTGAGGATGG - Intronic
1174276245 20:49406636-49406658 GAGTTGGAGCCTAATCAGGGAGG - Intronic
1174959976 20:55144913-55144935 TAGTTGAAGATCAATGAGAAAGG - Intergenic
1179124436 21:38578531-38578553 TAGCTGAAGCCTCAGGAGGCAGG + Intronic
1182892220 22:33828551-33828573 TCTTTGAAGCCTAGTGATGAAGG + Intronic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
950718740 3:14867733-14867755 CAGTGGAAGACAAATGAGGATGG - Intronic
952169403 3:30790073-30790095 TGGTTAAAGCTTAGTGAGGATGG - Intronic
952205277 3:31175123-31175145 TATTTCACGCCCAATGAGGAAGG - Intergenic
953962262 3:47275559-47275581 TAGCTGAGGCCTAATCTGGAGGG + Intronic
959499152 3:107085562-107085584 TGGTTGAAGGTTAATAAGGAAGG + Intergenic
960406282 3:117264234-117264256 AAGTTGAATCCTAATGAGGAAGG + Intergenic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
963705265 3:148678980-148679002 TAGTTGAAACATAATGGAGAGGG - Intergenic
964867107 3:161273914-161273936 TTCTTGAAGACTAATTAGGAGGG - Intergenic
971921308 4:32943201-32943223 ATGTTTAAGCTTAATGAGGAAGG + Intergenic
978133897 4:105233884-105233906 TAGTTGAATTCTAAAGAGCATGG - Exonic
979341709 4:119532729-119532751 TAGTGGATGCCTCATGAGAAAGG + Intronic
982186009 4:152800192-152800214 TAGTAGAATACTAATGAGTAGGG - Intronic
982339053 4:154274673-154274695 TAGTAGATGCTTAATGAGTACGG + Intronic
985102755 4:186474725-186474747 TAATTGAGGCTTTATGAGGAAGG + Intronic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
991350534 5:65716253-65716275 TGGCTGAAGCCAAATGAGAAAGG + Intronic
993237245 5:85328328-85328350 TAATTGAAGTGAAATGAGGATGG + Intergenic
994820474 5:104644388-104644410 TGGTTGGAGCCTGGTGAGGAAGG + Intergenic
996647629 5:125835496-125835518 TCCTTGCAGCCTAAGGAGGAAGG - Intergenic
998707715 5:144782910-144782932 TTGTGGAAGCCAAATGATGAAGG + Intergenic
999467824 5:151823675-151823697 AAGTTGGAGCCAAATGATGAAGG - Intronic
1004922801 6:20392727-20392749 ATGATTAAGCCTAATGAGGAAGG - Intergenic
1010828905 6:80507349-80507371 TTGTTGATGCCTAGGGAGGAAGG + Intergenic
1014941388 6:127443890-127443912 TATTGGAAAACTAATGAGGATGG + Exonic
1017646962 6:156548109-156548131 GGGTTGAAGCCTAACGATGAAGG - Intergenic
1018037715 6:159895627-159895649 TATTTGATTCCTAATGAGGTTGG - Intergenic
1018258681 6:161948444-161948466 TAGTTCAAGTCTACTGAGGCAGG + Intronic
1020447191 7:8281362-8281384 AAGTTGAGGCCTAAAGAGAAAGG - Intergenic
1022742681 7:33138112-33138134 TATTGGCAGCCTAATGAGGCAGG + Intronic
1023499651 7:40833865-40833887 TAATTGAATCCTAATGAGTTTGG - Intronic
1026417239 7:70195139-70195161 TAATTTAAGCATATTGAGGAAGG - Intronic
1027477689 7:78653848-78653870 TACTAAAAGTCTAATGAGGATGG - Intronic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1028896242 7:96045316-96045338 TAGCTGAAGTCTAGTGAGGGTGG + Intronic
1031786921 7:126045161-126045183 CAGTTTAAGCCTTATCAGGAAGG + Intergenic
1031851551 7:126870444-126870466 AAGATGAAGCTTAATGAGGAAGG - Intronic
1033821021 7:145134215-145134237 TGGTGGAAGGCGAATGAGGAGGG - Intergenic
1034878572 7:154746397-154746419 TATTTGACACCTAATGAGGTGGG + Intronic
1037218102 8:16483060-16483082 TACTTGAAGCATAATGTGGGTGG - Intronic
1037557576 8:20040674-20040696 TAGTTGAAGCTTCCAGAGGAAGG - Intergenic
1039331340 8:36540355-36540377 TAATTGAAGGCTAAGGAGGCAGG + Intergenic
1044493131 8:92844518-92844540 TATTTGAATCCTAAAGTGGAGGG + Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1051921248 9:22268369-22268391 TGGTTGAAGACTGTTGAGGATGG - Intergenic
1052423638 9:28275442-28275464 GAGTTGAAGACTGATGAGGCTGG - Intronic
1055040192 9:71862272-71862294 ATGTTGAAACCTAGTGAGGATGG - Intergenic
1055161725 9:73137667-73137689 TACTTGAAGTCAAATGAGTAAGG - Intergenic
1056339999 9:85619408-85619430 TAGTTTAAAAATAATGAGGAAGG - Intronic
1059700303 9:116769462-116769484 TAGCTAAAGGCAAATGAGGAGGG + Intronic
1060711012 9:125864028-125864050 CAATTGAAGGATAATGAGGAAGG + Intronic
1061229386 9:129305337-129305359 TAGTTCAAGTCTCATCAGGAGGG + Intergenic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1203445057 Un_GL000219v1:46145-46167 TGGGTGAAGTCTAGTGAGGAGGG + Intergenic
1186996938 X:15133500-15133522 TAGATGAAGCCTAATGATTGAGG + Intergenic
1190482659 X:50892798-50892820 TAGTTGAAGGTTAATAAAGAAGG - Intergenic
1194326892 X:92530197-92530219 TAGATGAAGCCTAATTAGAAGGG - Intronic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1197300154 X:124769520-124769542 TAATTGAAGCCTAAACAGAATGG + Intronic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1200635611 Y:5649406-5649428 TAGATGAAGCCTAATTAGAAGGG - Intronic