ID: 914679964

View in Genome Browser
Species Human (GRCh38)
Location 1:149932118-149932140
Sequence TCTGCTCTTTAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914679964_914679973 23 Left 914679964 1:149932118-149932140 CCCTCCTCCTTCTAAAGAGCAGA 0: 1
1: 0
2: 2
3: 81
4: 323
Right 914679973 1:149932164-149932186 CGAGGAGAAGAACTAAAGAAAGG 0: 1
1: 0
2: 3
3: 24
4: 303
914679964_914679969 -5 Left 914679964 1:149932118-149932140 CCCTCCTCCTTCTAAAGAGCAGA 0: 1
1: 0
2: 2
3: 81
4: 323
Right 914679969 1:149932136-149932158 GCAGAAAATGGCAGTCTTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 224
914679964_914679970 -4 Left 914679964 1:149932118-149932140 CCCTCCTCCTTCTAAAGAGCAGA 0: 1
1: 0
2: 2
3: 81
4: 323
Right 914679970 1:149932137-149932159 CAGAAAATGGCAGTCTTCTTGGG 0: 1
1: 0
2: 1
3: 28
4: 224
914679964_914679971 5 Left 914679964 1:149932118-149932140 CCCTCCTCCTTCTAAAGAGCAGA 0: 1
1: 0
2: 2
3: 81
4: 323
Right 914679971 1:149932146-149932168 GCAGTCTTCTTGGGAAACCGAGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914679964 Original CRISPR TCTGCTCTTTAGAAGGAGGA GGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
902630207 1:17700375-17700397 TGTGCTCTGGAGAAGGGGGATGG + Intergenic
902812193 1:18894630-18894652 TCTGCCCTGTGGAAGGAGGAGGG - Intronic
902843055 1:19087651-19087673 TGTCCTCTTTAGAGGCAGGAAGG - Intronic
903756617 1:25666556-25666578 TCTGCCTTTTCTAAGGAGGATGG - Intronic
903771320 1:25766229-25766251 TCTGCTCTTTAGCAGGCCGAGGG - Intronic
904695658 1:32329562-32329584 TCTGCACATTAGAAGAAGTAGGG + Intronic
906118740 1:43373273-43373295 TCTCTTCTTGAGAAAGAGGATGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908721032 1:67126171-67126193 TCTGTACTTTAGAATTAGGAGGG - Intronic
908755597 1:67466438-67466460 TGTGCTGTGTAGAAGGAAGATGG + Intergenic
909329666 1:74396307-74396329 TCTGCTGTTTAGAAGGAACGGGG - Intronic
909956687 1:81787406-81787428 CCAGCACTTTAGGAGGAGGAGGG + Intronic
911704556 1:100996361-100996383 TCTGATTTTTAAAAGGAAGAGGG + Intronic
913096718 1:115524541-115524563 TCTGCTCTTTTGTTTGAGGAAGG + Intergenic
913319303 1:117577288-117577310 TTTGCTGTTGGGAAGGAGGAAGG - Intergenic
913576905 1:120184402-120184424 TCTGCTCTCTGGTAGGAGGTGGG - Intergenic
913937135 1:125065483-125065505 ACTGCTCTTTCAAAGGACGAGGG - Intergenic
914449338 1:147776894-147776916 TCTATTGTATAGAAGGAGGAGGG - Intergenic
914558814 1:148795837-148795859 TCTGCTCTCTGGTAGGAGGTGGG - Intergenic
914614019 1:149334393-149334415 TCTGCTCTCTGGTAGGAGGTGGG + Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
915930866 1:160060179-160060201 TCCTCCCTTAAGAAGGAGGATGG + Intronic
916310705 1:163395918-163395940 TTTGCTCTTTAAAAGGAAAATGG + Intergenic
918682654 1:187374284-187374306 TCCCCTCTCTAGAGGGAGGAGGG - Intergenic
918878526 1:190083734-190083756 TCTGCTCATTTCAATGAGGAAGG + Intergenic
920068042 1:203282959-203282981 TCTGCTCTCTGGAGGGAGGAGGG - Intergenic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
921423720 1:214978277-214978299 TCTTCTCTTGAGCAGGAGGCAGG - Intergenic
922534302 1:226368473-226368495 CCTGCTCTTTAACAGGAAGATGG - Intronic
922642163 1:227245228-227245250 TCTGTTCTTAAGCAGAAGGAAGG - Intronic
922810697 1:228414100-228414122 TCTGCTCTTAGGAAGGCCGAGGG - Intronic
923375278 1:233355885-233355907 TTTGCATTTTAGAAGGAGAAGGG - Intronic
924496608 1:244596361-244596383 GCTGCTCTGTAGACGGAGCAGGG - Intronic
1065174156 10:23060952-23060974 TCTGCTGTTGAGAAGCAGGTTGG - Intergenic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1065982289 10:30911901-30911923 TCTGGCATTTGGAAGGAGGAGGG - Intronic
1068342178 10:55719402-55719424 TCTGCTCTATAAAAAGAGTAAGG + Intergenic
1068414193 10:56696752-56696774 TTTGTGCTTAAGAAGGAGGAAGG - Intergenic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1073166583 10:101459396-101459418 TCTACTCTTTAGTATTAGGAGGG + Intronic
1073514813 10:104066812-104066834 TCTGCTGTTTAGAAGGAATAGGG - Intronic
1075335625 10:121607069-121607091 TCTACTCCTTAGATGGAGAACGG + Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1077372675 11:2190823-2190845 TCCGCTTTTAACAAGGAGGAAGG + Intergenic
1078677884 11:13442419-13442441 TCTGCTATTTACAAGTTGGATGG + Intronic
1078837566 11:15045829-15045851 TCTGGTCCTTGGAAAGAGGAAGG + Intronic
1084156040 11:67313039-67313061 TTTGCTTTGTAGCAGGAGGAAGG - Intergenic
1084620362 11:70265813-70265835 TCTGCTCTCTAGAAGGTGCCTGG - Intergenic
1088117118 11:106325094-106325116 TCTGCTCAGTAAAAGGAGGATGG - Intergenic
1089040704 11:115446727-115446749 ACTGCTCTTTCGAAAGAGCAAGG + Intronic
1089399702 11:118157339-118157361 TGAGCTCATTGGAAGGAGGAGGG + Intergenic
1091223088 11:133942155-133942177 TTTCCTCTCGAGAAGGAGGATGG + Intronic
1091388542 12:110885-110907 TCTGCTGTTTAGAAGGAACGGGG + Intronic
1091826715 12:3518281-3518303 CCTGCTGTTTACAAGGAAGAGGG - Intronic
1092269135 12:7008380-7008402 TCTGTGCTTGAGAAGAAGGATGG + Intronic
1095038526 12:37419580-37419602 ACTGCTCTTTCAAAGGATGAGGG - Intergenic
1095038993 12:37422007-37422029 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1095049042 12:37541175-37541197 ACTGCTCTTTCAAAGGGGGAGGG + Intergenic
1095049815 12:37545587-37545609 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1095694435 12:45128882-45128904 TCTGCTGTTAATAAGGAGGCCGG - Intergenic
1095839793 12:46680640-46680662 TCTGGGCATTTGAAGGAGGAAGG + Intergenic
1095984865 12:47992695-47992717 TCTGCACAGTTGAAGGAGGAAGG - Intronic
1096445357 12:51685730-51685752 TCAGCCCTTTAGAAGGACTAGGG + Intronic
1097879330 12:64672764-64672786 TCAGCACTTTGGAAGGCGGAGGG - Intronic
1099765879 12:86982922-86982944 TCTGCTCTTTAAAAGGAGTTTGG - Intergenic
1100872180 12:98921605-98921627 TCTGCTCTTTATACAGAGGATGG - Intronic
1101208461 12:102512759-102512781 CCTTCTGTTTAGAAGGAGAAAGG - Intergenic
1101346979 12:103894888-103894910 AGAGCTCTTTAGAAGGAGGAAGG - Intergenic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1103419438 12:120768551-120768573 TCTGCTCTTAAGAGCAAGGAGGG - Intronic
1104337784 12:127916553-127916575 TATCCTTATTAGAAGGAGGAAGG + Intergenic
1106400895 13:29428925-29428947 TCTGCCCTTGCAAAGGAGGAGGG - Intronic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1110690980 13:78429506-78429528 TCTGCTGTTTAGAAGCAATAGGG + Intergenic
1112393091 13:99003001-99003023 TCTGCTCTTCTGATGGAGGGAGG + Intronic
1112581566 13:100680529-100680551 TCTGCTCTTCACAAGGGAGAAGG - Intergenic
1113343085 13:109446284-109446306 TCTGCTCCTTAGGAGGGGTAGGG - Intergenic
1113866979 13:113532772-113532794 TCTGCGACTTAGAAGGAGGGAGG - Intronic
1113905537 13:113817554-113817576 TGTGCCCCTTAGAGGGAGGAGGG - Intergenic
1115465853 14:33713399-33713421 TTTGCTTTTTTGAGGGAGGAGGG + Intronic
1115805375 14:37045050-37045072 TTGGCACTTTAGAAGGAGCATGG - Intronic
1116607566 14:47021287-47021309 GCTTCTGTTTAGAATGAGGATGG - Intronic
1118295752 14:64567425-64567447 TCAGCTCTTTAAAAGAAAGACGG + Intronic
1119661218 14:76453150-76453172 AAAGCTCTTTAGAAGGAGAAGGG + Intronic
1119774282 14:77238907-77238929 TCAGCTTTTTAGAATGGGGAGGG + Intronic
1122615903 14:103017787-103017809 TCTGCTCTGTAGCAGAAGGAAGG - Intronic
1122914763 14:104853672-104853694 TCAACTCTTTAACAGGAGGACGG + Intergenic
1123823257 15:24054437-24054459 TTTGCTGTTTAGAAGCAGGGAGG - Intergenic
1124070989 15:26393148-26393170 TCTGCCCTTTATACAGAGGAGGG - Intergenic
1124986830 15:34626314-34626336 TTTGCTCTTTGGAAGGATGGCGG - Intergenic
1130093817 15:80841433-80841455 CCTGCCCTTTAGGAGGAGCAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130234930 15:82124937-82124959 CCTGCTCTTTGAAAGGAGGGAGG + Intergenic
1130850349 15:87786724-87786746 TCAGCTTTTTAGAAGAAGGCTGG + Intergenic
1130953865 15:88613046-88613068 TCTGCTGTATGGATGGAGGAGGG - Intergenic
1133987941 16:10682631-10682653 GCTGTCCTTTAGAAGAAGGATGG + Intronic
1134108483 16:11500199-11500221 TCTGGTCTCTATAAGGAGGATGG - Intronic
1135404367 16:22187627-22187649 TCAGCTATTTAGAAGGCTGAGGG - Intronic
1136495939 16:30644251-30644273 TTTGCTCTAGAGAAAGAGGAAGG - Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1140383387 16:74511171-74511193 TCTGCTTTTTAGAAGGACAGAGG + Intronic
1141268661 16:82519727-82519749 TGTGCTCTGAAGATGGAGGAAGG + Intergenic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1142252928 16:89000963-89000985 GCTCCTCGTTAGAAGGAGAAAGG - Intergenic
1142376304 16:89708732-89708754 GCTGCACTGTAGAAGCAGGAGGG - Intronic
1143296021 17:5872775-5872797 TGTGCTCATTAAAAGGAGGAAGG - Intronic
1143840793 17:9730216-9730238 TTTTCTCTTAAGAAGGAGAATGG + Intergenic
1144360117 17:14484167-14484189 TCCTCTCTTTACCAGGAGGAAGG + Intergenic
1145306233 17:21676811-21676833 AGTGCTCTTTCAAAGGAGGAGGG - Intergenic
1145306669 17:21679283-21679305 ACTGCTCTTTCAAAGTAGGAGGG - Intergenic
1145307137 17:21681609-21681631 ACTGCTCTTTCAAAGGAAGAGGG - Intergenic
1145307366 17:21682774-21682796 ACTGCTCTTTCAAAGGAAGAGGG - Intergenic
1145307589 17:21683939-21683961 ACTGCTCTTTCAAAGGAAGAGGG - Intergenic
1145370059 17:22300466-22300488 ACTGCTCTTCCAAAGGAGGAGGG + Intergenic
1145370433 17:22302673-22302695 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1145378932 17:22376527-22376549 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1145379410 17:22378897-22378919 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1145379888 17:22381267-22381289 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145380368 17:22383642-22383664 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145380847 17:22385989-22386011 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145381326 17:22388364-22388386 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145382059 17:22392139-22392161 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145382534 17:22394503-22394525 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145383387 17:22398689-22398711 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145383756 17:22400424-22400446 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145383901 17:22401157-22401179 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145384339 17:22403359-22403381 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145384658 17:22404821-22404843 ACCGCTCTTTCAAAGGAGGAGGG + Intergenic
1145385441 17:22408894-22408916 ACTGCTGTTTCAAAGGAGGAGGG + Intergenic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1146674542 17:34764295-34764317 TCTGTTTCTTAGAAGGAGGAGGG - Intergenic
1146796431 17:35784586-35784608 TCTGCACAGTAGAAGGAGCAGGG + Intronic
1147437076 17:40423121-40423143 TCTGCTCTTTGGCAAGGGGAGGG + Intergenic
1147630977 17:41931410-41931432 GCTGCTCTGTGGAAGGAGGCCGG - Intronic
1148336451 17:46845150-46845172 ACTGCTCAAAAGAAGGAGGAAGG - Intronic
1149999114 17:61421448-61421470 TCAGCACTTTAAAAGGAGGCAGG - Intergenic
1150226455 17:63527182-63527204 TCAGCTCTTGATGAGGAGGATGG + Intronic
1150346727 17:64410505-64410527 ATTGCTCTTTAGAATGTGGAAGG + Intronic
1151271302 17:72998227-72998249 TATCCTCGTTAAAAGGAGGATGG - Intronic
1152879588 17:82807591-82807613 GCTGCTCTGTAGGAAGAGGAAGG - Exonic
1153907319 18:9673726-9673748 TCTGCTCTTTGCAAAGAGGTTGG - Intergenic
1155227119 18:23738362-23738384 TCTTCTCTCCAGAAGGAGGGAGG - Intronic
1155415797 18:25598000-25598022 CCTGCTCTAGAGAAGGAGGCAGG - Intergenic
1155802386 18:30124217-30124239 TCTGCTTTTTAGAAAGGGAATGG - Intergenic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1156867426 18:41904487-41904509 TCAGCTCTTTATATGCAGGAAGG + Intergenic
1156912927 18:42432253-42432275 TTTGCTCTTTAGTATGTGGAGGG + Intergenic
1157466429 18:47950415-47950437 TTTGCTCTTTGGAAATAGGAAGG + Intergenic
1157887865 18:51385660-51385682 TCTACTATTTAGAAGCAGGTGGG + Intergenic
1163738585 19:18996910-18996932 TGTGCTCTTGAGAGGGAGGGAGG + Intronic
1164023768 19:21331586-21331608 TCTGATCTCTAGAAGGAAGGAGG - Intergenic
926198224 2:10776230-10776252 TGTGCTATTTCGGAGGAGGAGGG - Intronic
926272992 2:11381332-11381354 TTTACTTTTGAGAAGGAGGAAGG - Intergenic
926936102 2:18087819-18087841 TCTGCTGTTTAGAAGGAATAGGG + Intronic
927090851 2:19711449-19711471 ACTGCTCTTTGGAATCAGGAAGG - Intergenic
927095276 2:19743625-19743647 TCTGCTCTGTAGAATGGAGATGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
934164495 2:89281892-89281914 CCTGCTCTTTAGAAGAAGACAGG - Intergenic
934202779 2:89900632-89900654 CCTGCTCTTTAGAAGAAGACAGG + Intergenic
935391049 2:102553050-102553072 TCTTCTCATTAGAAGGAACAAGG + Intergenic
936697479 2:114967328-114967350 TCTGCTCTGTGGAAGCAGGAAGG + Intronic
937200905 2:120204051-120204073 TCTGCTCTAGAGAGGGTGGAAGG + Intergenic
938841750 2:135171423-135171445 TCTGCTCCTTAGAAGAAAGGTGG + Intronic
938895262 2:135742577-135742599 ACTGCTGTTTAGATGGAGGTAGG + Intronic
942679232 2:178459308-178459330 TCTGCAATTTTGTAGGAGGAGGG + Intronic
942896837 2:181067280-181067302 TTTTCTCTTTGGAAGGAGGTAGG + Intronic
944090374 2:195903149-195903171 TCTGCTCTATTGGTGGAGGAAGG + Intronic
944364739 2:198904737-198904759 TAAGCTCTTTAGTAGGAGCAGGG + Intergenic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
945999024 2:216465292-216465314 GCTGCTCGTTAAAAGGAGGGTGG + Intronic
946611455 2:221462852-221462874 TCTGCTCTTTAGGCTGATGAAGG + Intronic
946770629 2:223085109-223085131 GCTGCTATTTAGAATGAGAAAGG + Intronic
946870228 2:224078347-224078369 TCTGCTTTTGTGAAGGAGGTGGG + Intergenic
1168929953 20:1613373-1613395 TGTGCTTATAAGAAGGAGGAAGG - Intronic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1170307731 20:14958730-14958752 ACTGCTGTTTAGAATGAGCATGG - Intronic
1171191016 20:23159552-23159574 AGTGCTCCTTAGAAGGAGGCTGG + Intergenic
1171523728 20:25794313-25794335 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171524190 20:25796756-25796778 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171524586 20:25799005-25799027 ACTGCTCTTTCAACGGAGGAGGG - Intronic
1171531927 20:25858800-25858822 CCTGCTCTTTCAAAGGAGGAGGG - Intronic
1171532241 20:25860445-25860467 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171532564 20:25862114-25862136 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171533326 20:25866272-25866294 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171533768 20:25868654-25868676 ACTGCTCTTTCAACGGAGGAGGG - Intergenic
1171543580 20:25984678-25984700 ACTGCTCTTTCAAAGGGGGAGGG + Intergenic
1171543966 20:25986881-25986903 ACTGCTCTTTCAATGGAGGAGGG + Intergenic
1171544330 20:25989101-25989123 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171552241 20:26056878-26056900 ACTGCTCTTTCAACGGAGGAGGG + Intergenic
1171552637 20:26059127-26059149 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171553099 20:26061570-26061592 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171573536 20:26276632-26276654 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171793373 20:29548170-29548192 ACTGCTCTTTCAACGGAGGAGGG + Intergenic
1171806719 20:29687735-29687757 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171807031 20:29689347-29689369 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171837329 20:30168794-30168816 CCTGCTCTTTCAAAGGAGGAGGG - Intergenic
1171846617 20:30281288-30281310 ACTGCTCTTTCAAAGGAGGAAGG + Intergenic
1171847063 20:30283734-30283756 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171847247 20:30284611-30284633 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1171855084 20:30336209-30336231 ACTGCTCTTTCAACGGAGGAGGG - Intergenic
1172001300 20:31779785-31779807 AGTGTTCTTTAAAAGGAGGATGG + Intronic
1172322279 20:34005044-34005066 GCTGCTCTCTGGAAGGAGGCAGG - Intronic
1172382776 20:34510525-34510547 TCTGCTCTTTTGCAGGGGGTGGG + Exonic
1174246268 20:49183677-49183699 TCTGGACTTTAGAATGGGGATGG + Intronic
1174890645 20:54388422-54388444 TCTGCTGTTAAGAAAAAGGAGGG - Intergenic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1176679481 21:9811725-9811747 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176679769 21:9813133-9813155 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176680051 21:9814542-9814564 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176680335 21:9815951-9815973 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1176680619 21:9817360-9817382 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1176680904 21:9818765-9818787 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176681187 21:9820172-9820194 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1176681472 21:9821591-9821613 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176681760 21:9823000-9823022 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1176682034 21:9824409-9824431 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176682315 21:9825810-9825832 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176682595 21:9827219-9827241 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176682874 21:9828638-9828660 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683153 21:9830035-9830057 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683432 21:9831445-9831467 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683713 21:9832854-9832876 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683991 21:9834257-9834279 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176684270 21:9835666-9835688 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176684548 21:9837067-9837089 ACTGCTCTTTCAAAGGCGGAGGG - Intergenic
1177279961 21:18968756-18968778 TTTGTTTTTTGGAAGGAGGAAGG + Intergenic
1178523278 21:33303789-33303811 TCTGGCCTTTGGCAGGAGGAGGG + Intergenic
1178935276 21:36856397-36856419 TCTGCTATTTAGACTGCGGAAGG + Intronic
1181693844 22:24583072-24583094 TCTTCTCATTTGAAGGAGGTAGG - Intronic
1182181305 22:28351637-28351659 TCTGCTCTTCAGCTTGAGGAGGG - Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
1182234425 22:28864367-28864389 TCTAGTCTTTGGAGGGAGGATGG + Intergenic
1185102833 22:48850666-48850688 TCTTCTCTTTAGATGGAAAAGGG + Intronic
949359274 3:3214654-3214676 TCTGCTCTCTAGAGGGTAGAAGG - Intergenic
950201994 3:11050984-11051006 TCTGGTATTGAGGAGGAGGAGGG - Intergenic
951881236 3:27483620-27483642 TCTTCTCCTTCTAAGGAGGACGG - Intronic
952526011 3:34211318-34211340 TCTGCCCTCCACAAGGAGGAAGG - Intergenic
953357147 3:42265274-42265296 TCGGCTCTTTCGAAGGAGAGAGG + Exonic
955807121 3:62748386-62748408 TGTGCATTTTAGAAGGAGTAAGG - Intronic
960884731 3:122382981-122383003 GCTGCTCTGTAGGAGGAGGGAGG - Intronic
963179030 3:142334493-142334515 TCTGCTGTTTACAAGGATTATGG - Intronic
965377342 3:167941767-167941789 TCTGCTATTAGGCAGGAGGAAGG + Intergenic
966485449 3:180464041-180464063 TCTCCTTTATAGAAGTAGGAAGG + Intergenic
968012346 3:195292442-195292464 TTTGCTTTTCAGAAGGAGAAAGG - Exonic
969842394 4:9892065-9892087 CCTGCTCCTTAGAGGGAGGCAGG + Intronic
969968201 4:11018523-11018545 TGTGCTCTTTAGAGAGAGGATGG + Intergenic
970309694 4:14769147-14769169 TCTGCTGTTTACAAGGATGAAGG + Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
973641564 4:52908062-52908084 TGAGCTCTGTAGAAGGAAGAGGG - Intronic
974177852 4:58346565-58346587 TCTGCTTTTGGGAAGGAAGATGG + Intergenic
976296882 4:83481580-83481602 CCTGCTGTTTAGTAGGAAGATGG - Intronic
977399197 4:96510171-96510193 TCTGCCCTTTGGAAAGGGGAGGG + Intergenic
978153267 4:105462508-105462530 TATGCTATTTAGAAAGATGAAGG - Intronic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
979754994 4:124329095-124329117 TCTGCTCTCTAGATGGAAAATGG - Intergenic
981786943 4:148490144-148490166 TCTGCTTTTTAGATGGGGGGTGG + Intergenic
983115476 4:163810849-163810871 TCTGCTTTGTGGAAGGTGGATGG - Intronic
985433548 4:189905029-189905051 TCAGCTCTTCAGAAGGCAGAAGG + Intergenic
987919536 5:24261272-24261294 TCTGATCGCTAGAATGAGGAGGG + Intergenic
988536156 5:32071015-32071037 TCTGCTCTGTAGATTGAAGAAGG + Intronic
988659152 5:33245950-33245972 TCAGCACTTTAGAAGGCTGAGGG - Intergenic
988752950 5:34210342-34210364 TACTCTCTTTAGAAGGAGTACGG + Intergenic
988848742 5:35157460-35157482 TCTGCTCTGTTAAGGGAGGAGGG - Intronic
990818044 5:59807376-59807398 TCTGCCCTCTAGAAGAAGCATGG - Intronic
991740726 5:69671149-69671171 TACTCTCTTTAGAAGGAGTACGG + Intergenic
991756893 5:69883301-69883323 TACTCTCTTTAGAAGGAGTACGG - Intergenic
991792300 5:70250890-70250912 TACTCTCTTTAGAAGGAGTACGG + Intergenic
991820186 5:70547255-70547277 TACTCTCTTTAGAAGGAGTACGG + Intergenic
991836296 5:70759183-70759205 TACTCTCTTTAGAAGGAGTACGG - Intergenic
991884748 5:71251215-71251237 TACTCTCTTTAGAAGGAGTACGG + Intergenic
992370083 5:76134782-76134804 TCTGCTCTTTGGAAGAACAAGGG + Intronic
995598820 5:113774819-113774841 TCTGCTATATACAAGGAGAAGGG + Intergenic
997944938 5:138191802-138191824 TCTGCTGTTTAGATGAAGGTTGG - Intronic
998181611 5:139949954-139949976 TTTGCTATTTAGACAGAGGAAGG - Intronic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
1000049954 5:157554309-157554331 GCTGCTCTTCAGCAGGAGCACGG - Intronic
1000282154 5:159791550-159791572 TCTGCTTCTTTGAAGGGGGATGG + Intergenic
1001332164 5:170770114-170770136 TCTGCATTTTAGAAAGAGGGTGG + Intronic
1001426964 5:171629172-171629194 CCTGCTCTTTAGACGTAGGCAGG - Intergenic
1001997029 5:176170341-176170363 GATGCTTTTTGGAAGGAGGATGG - Intergenic
1002917914 6:1543996-1544018 TTTGGTCTTTAGAATAAGGATGG + Intergenic
1003238418 6:4319437-4319459 TCTTCTCTTTCAAATGAGGAAGG - Intergenic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1004541808 6:16557729-16557751 ACTGCACTTTAGTGGGAGGAAGG + Intronic
1005551115 6:26917121-26917143 TACTCTCTTTAGAAGGAGTACGG + Intergenic
1005887628 6:30108794-30108816 TCTGTGCTGAAGAAGGAGGAAGG + Intronic
1006185707 6:32180546-32180568 TCTGCCCTGGGGAAGGAGGATGG + Exonic
1007901148 6:45414148-45414170 TCTCCTTTTTAGATGAAGGAAGG + Intronic
1009321967 6:62302768-62302790 TCTTCTCTTTTGAATCAGGAAGG + Intergenic
1009900314 6:69801181-69801203 TCTGATCTCTGGAAGGAAGATGG + Intergenic
1010253537 6:73733049-73733071 TCTGCAAGTTACAAGGAGGAAGG - Intronic
1010519259 6:76812411-76812433 TCGGCTCCTTAAAAGGAGGCAGG - Intergenic
1012931868 6:105325897-105325919 TCTGGACTTGAGAAGGAGGCAGG + Intronic
1013099760 6:106975848-106975870 TCTGCTCTTTAAACGAATGACGG - Intergenic
1016138528 6:140578535-140578557 ACTGCTCTTTATCAGGATGAGGG + Intergenic
1017134181 6:151133816-151133838 TCTCCCCTTTAGGAGCAGGAAGG + Intergenic
1018336100 6:162791743-162791765 ACTGCATTCTAGAAGGAGGATGG + Intronic
1019157434 6:170048733-170048755 TCCTCTTTTTGGAAGGAGGAGGG - Intergenic
1019494545 7:1331681-1331703 TCCGCTCTTTACAGGGAGGTGGG - Intergenic
1019817818 7:3214010-3214032 TCTGCACTTTAGGAGGCTGATGG + Intergenic
1020384007 7:7577764-7577786 GCTGCTGTTGAGAAGGAGCAGGG + Intronic
1021664011 7:22955699-22955721 TTTGCTCTAGAAAAGGAGGAAGG + Intronic
1022512288 7:30946627-30946649 TGTGCTCTTTGGAAGGAAGTTGG + Intronic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1024051060 7:45623787-45623809 TCTCCTCTTTCGAAGAGGGAAGG + Intronic
1024086146 7:45893460-45893482 TCAGCTAGTTTGAAGGAGGACGG + Exonic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024719988 7:52125427-52125449 TCTGTTCTTTAGAAGGATAGAGG + Intergenic
1024971455 7:55075144-55075166 TCTGCCCTTTAGAAGAATGCAGG - Intronic
1025239321 7:57257961-57257983 TCTGGTTTCTGGAAGGAGGATGG - Intergenic
1025284178 7:57649215-57649237 AGTGCTCTTTCAAAGGAGGAGGG - Intergenic
1025284615 7:57651656-57651678 ACTGCTCTTTCAAAGGACGAGGG - Intergenic
1025294955 7:57769757-57769779 GCTGCTCTTTCAAAGGGGGAGGG + Intergenic
1025295346 7:57771960-57771982 ACTGCTCTTTCAATGGAGGAGGG + Intergenic
1025295722 7:57774168-57774190 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1025300900 7:57819174-57819196 ACTGCTCTTTCAACGGAGGAGGG + Intergenic
1025301354 7:57821582-57821604 ACTGCTCTTTCCAAGGACGAGGG + Intergenic
1026212995 7:68323468-68323490 TCTGGTCTTGAGAGGGAGCAGGG - Intergenic
1026423245 7:70262437-70262459 TCAGGTCTTTAAAAGGCGGAGGG - Intronic
1027793781 7:82666198-82666220 TCTGCTCTGATGATGGAGGATGG - Intergenic
1028221911 7:88207281-88207303 TCTGATCTTTAGAAACAGCAAGG + Intronic
1028310286 7:89323876-89323898 TGTTCTCTTTAAATGGAGGAAGG + Intronic
1028697766 7:93736235-93736257 TCTGCTCTTTTGTGGTAGGATGG - Intronic
1028919863 7:96298941-96298963 TCTGCTCTTAAAGTGGAGGATGG - Intronic
1029107802 7:98192914-98192936 TCTTCTGTTTCGAAGGAGGTAGG - Exonic
1029793871 7:102873648-102873670 TCTGCTCTTTGGACCGTGGAAGG - Intronic
1030732813 7:113009601-113009623 TCTACTCTCAAGAAAGAGGAGGG - Intergenic
1031214361 7:118871084-118871106 GCTGCTGTTTAGAAGGAAGAGGG - Intergenic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1037266333 8:17065501-17065523 TCTGCTCTTTAAAAGATGAATGG + Intronic
1037673428 8:21034920-21034942 TCAGCCTTTTTGAAGGAGGATGG - Intergenic
1037677459 8:21064086-21064108 TCAGCTTCTAAGAAGGAGGATGG - Intergenic
1038327617 8:26584382-26584404 GCTTCTTTTTAGAATGAGGATGG + Intronic
1039572706 8:38600419-38600441 TCTGCCCTGGGGAAGGAGGATGG - Intergenic
1041275804 8:56156683-56156705 CCTGCTCTATAAAAGGCGGATGG - Intergenic
1041362031 8:57064812-57064834 TCTACATTTTATAAGGAGGATGG - Intergenic
1042293834 8:67198876-67198898 TCTGCTCTTTAAAAGGACGCTGG - Exonic
1043052782 8:75404250-75404272 TCTGCTTTTTTGAAAGAGGCCGG + Intergenic
1045825224 8:106389035-106389057 TCTTCTTATTAGAAGGATGAGGG - Intronic
1046163440 8:110397028-110397050 TCTGATCATCAGAAGGAGGCAGG + Intergenic
1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG + Intergenic
1048879994 8:138864200-138864222 GCTGTACTTTAGAAGGAGAATGG - Intronic
1049544660 8:143224658-143224680 TCTGCTCTGTAGAAGGAGCTTGG + Intergenic
1050070292 9:1804157-1804179 TCTGCTTGATAGAAGAAGGAAGG - Intergenic
1050292874 9:4175057-4175079 CCTGCTCTTTAAAAGAAGGAAGG - Intronic
1052895914 9:33748349-33748371 TGTGCACCTTAGAGGGAGGATGG - Intergenic
1053784758 9:41645952-41645974 ACTGCTCTTTCTAAGGAGGAGGG + Intergenic
1053784939 9:41646832-41646854 ACCGCTCTTTCAAAGGAGGAGGG - Intergenic
1053792911 9:41699498-41699520 ACTGCTCTTTCAACGGAGGAGGG - Intergenic
1054152266 9:61615327-61615349 ACTGCTCTTTCAACGGAGGAGGG + Intergenic
1054160073 9:61667350-61667372 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054160259 9:61668230-61668252 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054160717 9:61670661-61670683 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054161012 9:61672072-61672094 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054161463 9:61674522-61674544 ACTGCTCTTTCAAAGGAGGAAGG - Intergenic
1054173026 9:61857480-61857502 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054173485 9:61859897-61859919 ACTGCTCTTTCTAAGGAGGAGGG + Intergenic
1054173663 9:61860777-61860799 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054181322 9:61911519-61911541 ACTGCTCTTTCAACGGAGGAGGG - Intergenic
1054447879 9:65386530-65386552 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054448340 9:65388962-65388984 ACTGCTCTTTCTAAGGAGGGGGG + Intergenic
1054448518 9:65389842-65389864 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054472038 9:65546470-65546492 ACTGCTCTTTCAACGGAGGAGGG + Intergenic
1054656272 9:67669623-67669645 ACTGCTCTTTCAACGGAGGAGGG + Intergenic
1054663877 9:67720004-67720026 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054664057 9:67720884-67720906 ACTGCTCTTTCTAAGGAGGAGGG - Intergenic
1054664516 9:67723301-67723323 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1055490288 9:76797890-76797912 TCTGCTCTTAGGAAGGAGGAGGG - Intronic
1056050526 9:82763773-82763795 TCTGCCGTTTAGAAGGATGTGGG - Intergenic
1056551738 9:87658475-87658497 CCTGCCCTTTAGAAGGAGCTGGG + Intronic
1058472986 9:105300074-105300096 TCTGATATTTAGAAGTAGAAAGG + Intronic
1060132683 9:121119793-121119815 TCTGCTCTTAAGAAAGATGAAGG - Intronic
1203664650 Un_KI270754v1:14260-14282 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203664934 Un_KI270754v1:15667-15689 ACTGCTCTTTCAAATGAGGAGGG - Intergenic
1203665219 Un_KI270754v1:17076-17098 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203665499 Un_KI270754v1:18483-18505 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1203666068 Un_KI270754v1:21303-21325 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1203666357 Un_KI270754v1:22712-22734 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203666646 Un_KI270754v1:24119-24141 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1203667216 Un_KI270754v1:26942-26964 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1203667506 Un_KI270754v1:28351-28373 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203667795 Un_KI270754v1:29758-29780 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1203668364 Un_KI270754v1:32581-32603 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1203668654 Un_KI270754v1:33990-34012 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203668937 Un_KI270754v1:35400-35422 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1203669213 Un_KI270754v1:36807-36829 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203669500 Un_KI270754v1:38216-38238 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203669786 Un_KI270754v1:39623-39645 ACTGCACTTTCAAAGGAGGAGGG - Intergenic
1185619573 X:1445225-1445247 AATCCTCTTTATAAGGAGGACGG - Intronic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186033141 X:5391669-5391691 CCTACTCTTTCGAGGGAGGAGGG + Intergenic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1187777397 X:22777445-22777467 TCTGCTAATTAGAAGTAGGTGGG - Intergenic
1188115164 X:26233560-26233582 TATGCTCTGTACAAGCAGGACGG - Intergenic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1191666658 X:63709403-63709425 TCCGTGGTTTAGAAGGAGGAGGG - Intronic
1192853282 X:74980530-74980552 TCTGCTTTTCTGAAGGAGAAGGG - Intergenic
1195208716 X:102629664-102629686 TCTGATTTTTAGGAGTAGGAAGG - Intergenic
1197133160 X:123029553-123029575 TCTGCTGTTCACAAGGAGTAAGG + Intergenic
1197655635 X:129113258-129113280 GCTGCTCTTTACTAGGTGGAAGG + Intergenic
1198313618 X:135444770-135444792 TTTGCTATTTAAAAGGATGAAGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199941965 X:152636511-152636533 TCTGCTCATTAAAAGAAGGCAGG + Intergenic