ID: 914682303

View in Genome Browser
Species Human (GRCh38)
Location 1:149947175-149947197
Sequence CAGAACAAGGAGATCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 364}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914682303_914682307 7 Left 914682303 1:149947175-149947197 CCATCCCAGATCTCCTTGTTCTG 0: 1
1: 0
2: 1
3: 27
4: 364
Right 914682307 1:149947205-149947227 AAATGAAATGAAGACACACCAGG 0: 1
1: 0
2: 3
3: 45
4: 441
914682303_914682310 18 Left 914682303 1:149947175-149947197 CCATCCCAGATCTCCTTGTTCTG 0: 1
1: 0
2: 1
3: 27
4: 364
Right 914682310 1:149947216-149947238 AGACACACCAGGGTAGATGTGGG 0: 1
1: 0
2: 1
3: 13
4: 144
914682303_914682308 8 Left 914682303 1:149947175-149947197 CCATCCCAGATCTCCTTGTTCTG 0: 1
1: 0
2: 1
3: 27
4: 364
Right 914682308 1:149947206-149947228 AATGAAATGAAGACACACCAGGG 0: 1
1: 0
2: 2
3: 26
4: 441
914682303_914682309 17 Left 914682303 1:149947175-149947197 CCATCCCAGATCTCCTTGTTCTG 0: 1
1: 0
2: 1
3: 27
4: 364
Right 914682309 1:149947215-149947237 AAGACACACCAGGGTAGATGTGG 0: 1
1: 0
2: 0
3: 20
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914682303 Original CRISPR CAGAACAAGGAGATCTGGGA TGG (reversed) Intronic
900423021 1:2563853-2563875 CTGAACAAGGAGTTCCAGGATGG + Intronic
901457675 1:9372677-9372699 CAGAGCAGAGAGAGCTGGGAGGG - Intergenic
902240338 1:15084103-15084125 CAAAACAAGTAGAACAGGGAAGG + Intronic
903267756 1:22168328-22168350 AAGATCAAGGTTATCTGGGAAGG - Intergenic
903579007 1:24357241-24357263 CAGAACGAGGTGATGTGTGAAGG + Exonic
903684372 1:25120164-25120186 CAGGGCCAGGAGATCAGGGAGGG - Intergenic
903790576 1:25890210-25890232 CAGAAGAAGGAGCTTGGGGAAGG + Intronic
904266673 1:29322309-29322331 CTGGACCATGAGATCTGGGAGGG - Intronic
905325457 1:37148730-37148752 GAGAACAGGGAGATAGGGGAAGG + Intergenic
905473932 1:38212634-38212656 CAGAATCAGGAGATCTGAGCTGG - Intergenic
907472615 1:54683851-54683873 CAGGTCAGGGAGATCAGGGAGGG - Intronic
907496505 1:54848729-54848751 CAAACCAAGGAGCTCTGGGTTGG + Intergenic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
911762562 1:101633003-101633025 CAGAACAAAGAGCCCTGAGATGG - Intergenic
912128261 1:106568275-106568297 AAGACCAAGGAGAGCTGTGATGG + Intergenic
913018446 1:114763300-114763322 CAGAAGAAGAAAATGTGGGAAGG + Intergenic
913487968 1:119351136-119351158 CAAAACAAGGATAGCAGGGAGGG + Intergenic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
914850432 1:151310053-151310075 CAGATCTGGGAGGTCTGGGAGGG + Intronic
915230772 1:154443897-154443919 CAGGGCAGGGAGATCTGTGAGGG - Intronic
915686689 1:157641189-157641211 TACAACAAGGGGAGCTGGGAGGG - Intergenic
915925769 1:160018274-160018296 CTGAACAAGGAAGTCTGGGGAGG - Intergenic
916189831 1:162167789-162167811 CTGATCCAGGAGAGCTGGGAAGG + Intronic
916537491 1:165717414-165717436 GAGAGCAGGTAGATCTGGGAGGG - Intergenic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917261341 1:173173209-173173231 GAGAAACAGGAGATTTGGGAGGG - Intergenic
918090288 1:181286861-181286883 CATAACAAGAAGTTTTGGGAAGG - Intergenic
918237679 1:182596536-182596558 CTGTACAGGGACATCTGGGAAGG + Intergenic
918978629 1:191525509-191525531 CAGAACACGGAGGACTGGTAAGG + Intergenic
919353592 1:196492777-196492799 CTGAATAAGTAGATCTGGCACGG - Intronic
919793271 1:201305924-201305946 CAGAACATGGAGCTCCTGGAGGG + Intronic
919854128 1:201694175-201694197 CAGAACACGGAGAGCTGGAGGGG + Intronic
920214898 1:204355121-204355143 TTGAACAAGGAGACTTGGGAGGG + Intronic
920301377 1:204991186-204991208 CAGGACAAGGAAAGCAGGGAAGG - Intronic
920499387 1:206476822-206476844 CGGAACAAGGAGATCATGTACGG + Exonic
920691975 1:208154114-208154136 GAGAACAAGGTGACCGGGGAGGG - Intronic
920833715 1:209488379-209488401 CAGTGCAAGGCAATCTGGGATGG - Intergenic
921651899 1:217689688-217689710 CAGAACCAGGAGATATTGAAAGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924843990 1:247746830-247746852 CAGAATAAGGGGACCTGAGAAGG - Intergenic
1063200294 10:3780985-3781007 CAGAACATTTAGAACTGGGAAGG - Intronic
1064245336 10:13663460-13663482 AAGAACAAGGGCATCTGAGAGGG + Exonic
1064248875 10:13691622-13691644 CAGAATCAGGAGCTCTGAGAGGG + Intronic
1064743750 10:18459282-18459304 CAGAAAAATGATAGCTGGGAGGG - Intronic
1065918525 10:30371512-30371534 CAGAACAGAGAGACCTGGGCTGG + Intronic
1066526369 10:36283887-36283909 CAGACCCAGGAGATACGGGAAGG + Intergenic
1068040749 10:51820989-51821011 AACTACAAGGAGATTTGGGAGGG - Intronic
1068455287 10:57247204-57247226 CAGCAGTAGGAGAGCTGGGAGGG - Intergenic
1068802473 10:61157766-61157788 AAGAAGAAGGTGATCTTGGAAGG + Intergenic
1070313698 10:75292161-75292183 GAGAACAAGGAGGGCTGTGATGG - Intergenic
1071263651 10:83944073-83944095 TACAACAAAGAGATTTGGGACGG - Intergenic
1073578860 10:104645680-104645702 CAGGGCAGGGTGATCTGGGAGGG - Intronic
1074185832 10:111098780-111098802 CAGTCCAGGGAGAACTGGGATGG + Intergenic
1076867075 10:133172743-133172765 CAGCACAGGGAGATTTGGGGAGG + Intronic
1077699848 11:4431370-4431392 AAGACCAAACAGATCTGGGATGG - Intergenic
1077719277 11:4610480-4610502 CAGAGGAAGGAGGTCAGGGATGG + Intergenic
1078329867 11:10410344-10410366 CAGAACAAGGAGGTAAGGGTAGG + Intronic
1079447504 11:20570229-20570251 CAAGCCAAGAAGATCTGGGAAGG - Intergenic
1081574827 11:44312445-44312467 GACAACCACGAGATCTGGGACGG - Intergenic
1081716086 11:45251660-45251682 GACAGCAAGGGGATCTGGGAAGG - Intronic
1082013884 11:47469898-47469920 GAGAAGAAGGGGATGTGGGAAGG + Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084773237 11:71357680-71357702 CTGAACAAGGAGTCCTGGGCTGG + Intergenic
1084782100 11:71416844-71416866 CAGACCATGGAGGTCTGGGAAGG - Intergenic
1085136235 11:74091415-74091437 CAGAATAAGCTGATCAGGGAGGG + Intronic
1085174707 11:74475752-74475774 CAAAAGAAGGAATTCTGGGAAGG - Intergenic
1085228068 11:74940707-74940729 AAGAACAAGTAGATGTGAGATGG + Intronic
1085281712 11:75335286-75335308 CAGAAGAAGCAGATCTTGGCCGG + Intronic
1086986705 11:93258508-93258530 CAGAGCAAGGAGGTCTGTCAAGG - Intergenic
1087104498 11:94396488-94396510 CAGCACATGGATATTTGGGAAGG - Exonic
1088329642 11:108637573-108637595 CAGAATACGAAGATCTGGAAAGG + Intergenic
1088687565 11:112297921-112297943 CTGAACCAGGAGGTCTGGGAGGG + Intergenic
1088752064 11:112852389-112852411 CAGAAATAGGAGATCCGAGAGGG + Intergenic
1088804459 11:113339411-113339433 TAGAACAAGGGGATCTGGTCAGG - Exonic
1089671974 11:120062916-120062938 CAGAAAACGGGGATCTGAGAAGG - Intergenic
1089732974 11:120530934-120530956 CACAAAAAGGAGATCTGCTACGG + Intronic
1090361799 11:126177818-126177840 AAGAACAAGGACATCTCTGAAGG - Intergenic
1090902058 11:131041222-131041244 CAGAACAAGGATTTCAGAGACGG + Intergenic
1091770762 12:3149779-3149801 CAGACTCAGAAGATCTGGGATGG - Intronic
1095636548 12:44440831-44440853 CAGAACAATGACATCTGGAATGG + Intergenic
1096181706 12:49554744-49554766 CAGGCCAAGGAGAGCTGGCAGGG - Intronic
1096197314 12:49657009-49657031 CAAAACCAGGAGAGCTAGGAGGG - Intronic
1096655834 12:53091583-53091605 CAGAGGAAGGAGAGCTGGAAAGG - Intergenic
1098121447 12:67244424-67244446 CAGAAAAAGGAGCTCTGGCAGGG + Intergenic
1099158513 12:79209784-79209806 CAGATCAAGGAAAACTTGGATGG + Intronic
1099292057 12:80786353-80786375 TAAACCAAGAAGATCTGGGAAGG + Intergenic
1099508851 12:83509122-83509144 CAAAGCAAGGAGAGCTGGAAAGG + Intergenic
1099738743 12:86602467-86602489 TAGAACAAGGAAATTTTGGAAGG - Intronic
1099872830 12:88370115-88370137 AAAGCCAAGGAGATCTGGGAAGG - Intergenic
1100409428 12:94300261-94300283 CAGGACTAGGTGATCTGAGAAGG + Intronic
1101210237 12:102528396-102528418 AGGAAAAAGGAGATATGGGATGG - Intergenic
1102633214 12:114300170-114300192 CAGAAAAAGGATATCTAGGCTGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1104844190 12:131838651-131838673 CAGGACAGGGAGGTCTGGCAGGG - Exonic
1106979715 13:35263768-35263790 CAGCAAAAGGAGATCTCAGAGGG + Intronic
1107154117 13:37146411-37146433 CAGAACAAGGTGCTATGGCAAGG - Intergenic
1108081146 13:46737522-46737544 CAGCACAAAGGGATGTGGGATGG - Intronic
1108143638 13:47453167-47453189 CAGATTCAGCAGATCTGGGATGG - Intergenic
1108816440 13:54297652-54297674 CAGCAAAAGCAGATCTGAGAGGG - Intergenic
1110169709 13:72485954-72485976 CAGATCATGGAGCTCTGTGAGGG - Intergenic
1110274992 13:73632987-73633009 CAGTATAATGATATCTGGGATGG - Intergenic
1111065946 13:83091425-83091447 CAGAAAAAGGCAATGTGGGAAGG - Intergenic
1111378962 13:87420535-87420557 CAGAACAAGGTGTATTGGGATGG + Intergenic
1111458276 13:88511544-88511566 CAGAAGCAGGAGATTTGAGATGG - Intergenic
1111706446 13:91755359-91755381 CAGAAGAAGGAAATGTTGGAAGG - Intronic
1111785562 13:92782252-92782274 CACAAGAAGGAGATTTGGTAAGG - Intronic
1111950131 13:94703366-94703388 CGGAACAGAGAGATCTGGAAGGG - Intergenic
1113435644 13:110289135-110289157 CAAAATGAGGAGATCTGGAATGG - Intronic
1113582529 13:111439172-111439194 CAGACTCAGGAGGTCTGGGATGG + Intergenic
1113779272 13:112966884-112966906 CTGATCCAGGAGGTCTGGGATGG - Intronic
1114416686 14:22549565-22549587 AAGAACTAGGAGGTCTGGGGTGG + Intergenic
1114693359 14:24605844-24605866 CAGAACAGGGTGATCTAGAAGGG + Intergenic
1114831128 14:26143217-26143239 CAGAACAAAGAAACCTAGGAGGG - Intergenic
1114969899 14:28013151-28013173 CAGAAGGAGGAAAGCTGGGAGGG - Intergenic
1118701512 14:68438319-68438341 CACAAAGAGGAGATCTGGAAGGG + Intronic
1118701531 14:68438416-68438438 GAGAAAAAGGAGGCCTGGGAGGG + Intronic
1118764353 14:68899959-68899981 CAGCAGCAGGAGATGTGGGAAGG + Intronic
1118769069 14:68929555-68929577 CTGACAAAGGAGATCCGGGATGG + Intronic
1120574105 14:86159317-86159339 AAAAAGAAGGAGATCTGGGAAGG - Intergenic
1120757458 14:88257529-88257551 CAGAAACACGATATCTGGGAGGG - Intronic
1121331025 14:93049900-93049922 CAGCACAAGCAGATTTGGAAGGG + Intronic
1121669574 14:95697817-95697839 CTGAACGAGGAGAGCTGTGAGGG + Intergenic
1121824314 14:96998264-96998286 CAGCAGAAGGAGATCTGGGGTGG + Intergenic
1123993879 15:25704664-25704686 CTGAAAAAGGAGTTATGGGAGGG + Intronic
1126466617 15:48966354-48966376 CAGATCAATGAGATCAGGGCTGG + Intergenic
1128688025 15:69701358-69701380 CAGAGCTTGGAGAACTGGGATGG + Intergenic
1129231827 15:74201343-74201365 CAGAGCAGGGAGATAAGGGATGG + Intronic
1129243128 15:74263432-74263454 GAGAACAAGGAGATCTGTCTAGG - Intronic
1129313435 15:74727290-74727312 CAAAACAAGGGGGTCAGGGAAGG + Intergenic
1129676638 15:77635254-77635276 TAAAACAGGGAGAGCTGGGAGGG - Intronic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1130910076 15:88264857-88264879 CAGCCCAGGGAGTTCTGGGATGG + Intergenic
1131769303 15:95717727-95717749 CAGAAACTGGAGATATGGGAGGG - Intergenic
1133303673 16:4797488-4797510 GAGAACACGGAGATCTGCAAGGG + Exonic
1134868656 16:17631765-17631787 GAGAACAATAAGAGCTGGGAGGG + Intergenic
1135505037 16:23029020-23029042 GAGAAGAAGGAGACCTGGGCAGG - Intergenic
1136541283 16:30928703-30928725 CAGAACAAGGTGAGCAGGAAGGG - Intronic
1137027216 16:35489035-35489057 CAGGCCATGCAGATCTGGGAGGG + Intergenic
1138084998 16:54125396-54125418 CTTAAAAAGGAGATCTGGGCAGG - Intergenic
1138428609 16:56953062-56953084 CAGAGCCAGGATTTCTGGGAGGG - Intergenic
1141613804 16:85198731-85198753 CAAAACAAGGAGGCCTGGCAAGG - Intergenic
1143309776 17:5978673-5978695 CTGAACAGGGAGGTCTGAGATGG + Intronic
1143858530 17:9870942-9870964 CAGAAAGAGCAGTTCTGGGAAGG + Intronic
1143863813 17:9909636-9909658 AAAGACAAGGAGACCTGGGAGGG - Intergenic
1144838330 17:18170079-18170101 CTGCAGAAGCAGATCTGGGAAGG - Intronic
1149970974 17:61218074-61218096 CAGAACAAGAAGAACTGAGATGG + Intronic
1150571144 17:66388160-66388182 CATAACAAGGATATGTGGGTGGG + Intronic
1151446712 17:74170955-74170977 GAAGACAAGGAGCTCTGGGAAGG + Intergenic
1153651923 18:7248482-7248504 CACACCAAGGAAGTCTGGGAGGG - Intergenic
1154181488 18:12143325-12143347 GTGAACGAGGAGATCGGGGACGG - Intergenic
1154182416 18:12148259-12148281 GTGAACGAGGAGATCGGGGACGG + Intergenic
1155038272 18:22043568-22043590 CAGAACCAGGATAGATGGGAAGG - Intergenic
1156511818 18:37643307-37643329 GATAACAAGCAGATCAGGGAGGG - Intergenic
1157195553 18:45617655-45617677 CACATCAGGGAGATCAGGGAGGG - Intronic
1160579855 18:79877545-79877567 GAGAACAAGGGGGTCAGGGAAGG - Intronic
1161802784 19:6425044-6425066 CAAATGAAGGAGATCTGAGAAGG + Intergenic
1161973711 19:7597175-7597197 CAGAACAGGTTGATCTGGGAAGG - Intronic
1162066498 19:8129027-8129049 CAGGACACGGAGATCTGCAAAGG - Exonic
1162274162 19:9639823-9639845 TAAGCCAAGGAGATCTGGGAAGG + Intronic
1162788027 19:13047889-13047911 CGGAACAAGAGGACCTGGGAAGG - Intronic
1164004051 19:21133043-21133065 CTTGCCAAGGAGATCTGGGAAGG + Intergenic
1164557359 19:29263796-29263818 AAGAAAAAGGAGATTTGGAATGG - Intergenic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1168064243 19:53910042-53910064 AGGAATAAGGAGATCTGGGCGGG + Intronic
1168093242 19:54099644-54099666 GAAAATAAGGATATCTGGGATGG + Intronic
1168139256 19:54374397-54374419 CAGAACTAAGGGAACTGGGAGGG - Intergenic
1168158756 19:54493844-54493866 CAGAACTAAGAGAACTGGGAGGG + Intergenic
924997079 2:371886-371908 CAGCACAAGTAGTTCTGAGAAGG - Intergenic
925020485 2:564203-564225 CAGAAAAAGGAAAGGTGGGAAGG + Intergenic
925138153 2:1533892-1533914 CACAGAAAGGAGATCTGGGGAGG - Intronic
925138844 2:1536663-1536685 CACAGAAAGGAGATCTGGGGAGG - Intronic
925669996 2:6301132-6301154 CAGAAGAAGCACATGTGGGAAGG + Intergenic
930855065 2:56006870-56006892 CAGAACAAGGAAAGTTAGGAGGG - Intergenic
930952241 2:57156836-57156858 CAGACTAAGGAGATCTCAGATGG - Intergenic
931115235 2:59159328-59159350 CAAAGCAGGGAGATTTGGGAGGG + Intergenic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
933124459 2:78586725-78586747 GAGAACTAGGACATGTGGGAAGG + Intergenic
933783761 2:85821685-85821707 CAGAACAAGGAAAGCTGTCAGGG + Intergenic
933796965 2:85927440-85927462 CAGGACAAGGCTATGTGGGATGG + Intergenic
934042891 2:88144606-88144628 CAGAATAAGAAGACCTGGGCAGG + Intergenic
934166182 2:89296382-89296404 CAGGGCAAGGAGAACTGGGTGGG - Intergenic
934201093 2:89886074-89886096 CAGGGCAAGGAGAACTGGGTGGG + Intergenic
934515418 2:94983246-94983268 CATAACGATGAGGTCTGGGAAGG + Intergenic
934571102 2:95373970-95373992 CTGAACAAGGGGATATAGGAGGG - Intronic
935601601 2:104927785-104927807 CAGGACAAGGAGTTAGGGGAGGG + Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
937184480 2:120027466-120027488 CAGAAGAGGGAGATCTGTAAGGG + Intronic
937267541 2:120626008-120626030 CTGACCAAGGGGTTCTGGGATGG - Intergenic
937463854 2:122112139-122112161 CATAACTAGGCCATCTGGGATGG + Intergenic
937720189 2:125085989-125086011 AAGAAGAAGGAAATGTGGGAAGG + Intergenic
938164239 2:129012017-129012039 CAGAAGGAGAAGATATGGGAGGG + Intergenic
938391977 2:130914056-130914078 CAGAACAAGTGGAGCAGGGATGG + Intronic
938801986 2:134772154-134772176 CAAAAGAAGCAGATTTGGGAGGG + Intergenic
939668566 2:144980780-144980802 GAGAAAAAGGAGATTTGGGAAGG - Intergenic
940433735 2:153625810-153625832 CAGAATGAGGAGATGTTGGAGGG + Intergenic
940451948 2:153849695-153849717 CAGAAGAAGAAGTTCAGGGAGGG + Intergenic
943317309 2:186406067-186406089 AAGAAAGAGGAGATCTGAGAAGG - Intergenic
945418567 2:209605787-209605809 GAGAACATGAAGATCTGGCATGG - Intronic
945754693 2:213831678-213831700 CAGTTCAAGGAGATAAGGGAAGG - Intronic
945855779 2:215068183-215068205 CTGATTAAGGAGATCTGGGGTGG - Intronic
946561891 2:220923277-220923299 CATAAAAAGGAGATTTGGCATGG - Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
947977197 2:234377063-234377085 CAGGACAAGAAGAGCAGGGAGGG - Intergenic
948651029 2:239443945-239443967 GACAACAAGGAGCTCTGGGCAGG - Intergenic
948892308 2:240913404-240913426 CAGAACAAGGAACTCGAGGAGGG - Intergenic
1170224517 20:13977027-13977049 GAGAACAAGGTGAGCAGGGAAGG + Intronic
1170308223 20:14963358-14963380 CAGGGGAAGGAGACCTGGGAGGG + Intronic
1170506347 20:17029752-17029774 AAAAAGAAGGAGATCTGGGGAGG + Intergenic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1173850484 20:46214748-46214770 CAGAGCCTGGAGGTCTGGGAAGG - Intronic
1175357624 20:58381346-58381368 CATAACAAGGTGATCGGGGGTGG + Intergenic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1177478549 21:21655729-21655751 CAGAGCAAGGTGCTTTGGGAAGG - Intergenic
1177489455 21:21803650-21803672 CAGATGAAGTAGATCTAGGAAGG + Intergenic
1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG + Intergenic
1178242368 21:30917599-30917621 CAAAACAAGGAGGTTTGGAATGG - Intergenic
1179456908 21:41506723-41506745 CTGTCCCAGGAGATCTGGGAAGG - Intronic
1180094961 21:45552189-45552211 CAGACCAGAGAGATCTGCGATGG + Intergenic
1181079137 22:20402176-20402198 CAGAACACGGGGGTCGGGGAAGG + Intronic
1181694046 22:24584197-24584219 TAAAACAAGGAGAGCTGGGAGGG + Intronic
1182021646 22:27086650-27086672 CTGCACAAGGAGATCGGGGACGG + Intergenic
1182064009 22:27417668-27417690 CAGAAGAGGGTGATTTGGGATGG - Intergenic
1182833021 22:33319102-33319124 AAGGACAAGGATATCTGGGGTGG - Intronic
1182965388 22:34516703-34516725 CAGAACTTGGAGAACTTGGATGG - Intergenic
1183862938 22:40682564-40682586 GAAAACAAGGAGACCTGGGGTGG + Exonic
1183976038 22:41512929-41512951 CAGGACAGTGAGGTCTGGGATGG - Intronic
1184205746 22:43001489-43001511 CAGAAGAAGCAGGACTGGGAGGG + Intronic
1184459178 22:44627577-44627599 CGGAGCAGGGAGAGCTGGGAAGG - Intergenic
1184668994 22:46003117-46003139 CAGCTCAAGGGCATCTGGGAGGG - Intergenic
1185104151 22:48857865-48857887 CTGAACATGGAGCTCAGGGATGG - Intergenic
949264828 3:2144511-2144533 CAGATCAAGGGGTTCAGGGATGG + Intronic
949564837 3:5235066-5235088 CAGAATCAGCAGATCTGGGGTGG + Intergenic
949658362 3:6248070-6248092 CAGACCCAGGAGGCCTGGGATGG - Intergenic
949757798 3:7433326-7433348 AAGAACACGGAGCTCTGGGAAGG - Intronic
950183669 3:10932181-10932203 CTGACCAAGGTAATCTGGGAAGG - Intronic
950367397 3:12497265-12497287 AGGGACAAGGAGGTCTGGGATGG - Intronic
950457506 3:13101474-13101496 GGAAACAAGGAGGTCTGGGAAGG + Intergenic
951690055 3:25385922-25385944 CAGAATCCAGAGATCTGGGAGGG + Intronic
951762754 3:26163637-26163659 TAAACCAAGAAGATCTGGGAAGG + Intergenic
952963663 3:38608114-38608136 CAGGACAAGGAGACCCGGGGTGG + Intronic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
956997758 3:74847731-74847753 CAGGAGAAGGAGATCAGGTATGG + Intergenic
957030666 3:75236641-75236663 AAAAACCAGGAGATTTGGGAGGG + Intergenic
958965960 3:100558501-100558523 CCGAACAAGGAACTCTAGGAAGG - Exonic
960306575 3:116069239-116069261 CAGAACTAGGACATGTGGAAAGG - Intronic
961095167 3:124148296-124148318 CAGAAATAGGATAACTGGGAAGG + Intronic
961239090 3:125394737-125394759 GAGAACAAATAGATCTGGGCTGG + Intergenic
962523923 3:136221145-136221167 TAAGCCAAGGAGATCTGGGAAGG + Intergenic
962852742 3:139319934-139319956 CCTAACAAGGAGTTCTGGCAAGG - Intronic
962934792 3:140069881-140069903 TAGAACAAGGCTATATGGGAAGG + Intronic
963134261 3:141886296-141886318 CAGAACGAAGAGATTGGGGAAGG - Intronic
964587289 3:158320231-158320253 GAGAAAAAGGATATCAGGGACGG + Intronic
965487722 3:169299119-169299141 GAGAACTAGGAGTTCTAGGAAGG - Intronic
966397692 3:179519300-179519322 TAAACCAAGAAGATCTGGGATGG - Intergenic
966398402 3:179524201-179524223 TAAGCCAAGGAGATCTGGGAAGG + Intergenic
966816887 3:183896740-183896762 CAGAACGAGGAGAAATGGAATGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968047671 3:195632965-195632987 CTGAATCAGAAGATCTGGGAGGG - Intergenic
968306941 3:197656959-197656981 CTGAATCAGAAGATCTGGGAGGG + Intergenic
969932552 4:10645126-10645148 GAGAGGAAGGAGATCAGGGAAGG - Intronic
970010264 4:11450839-11450861 ATGAACAAGGAGAACTGAGAAGG - Intergenic
970375323 4:15451265-15451287 GAGAAGGAAGAGATCTGGGAGGG - Intergenic
970963583 4:21901883-21901905 CAGATCAATGGGATCGGGGAGGG - Intronic
975874260 4:78817501-78817523 TAGCACAAGGAGGTCTGGAAGGG + Intronic
976599185 4:86922603-86922625 TACAACAAGGAGATCTAGGAAGG - Intronic
977395057 4:96460434-96460456 GAGGACAAGGAGATATGGAAAGG - Intergenic
977726296 4:100300670-100300692 CAAATCAAGGAGATTGGGGAAGG - Intergenic
978126377 4:105140893-105140915 CTGATTAAGGAGGTCTGGGATGG - Intergenic
979757110 4:124354658-124354680 TAGAACCAGGAGAGCTGGTACGG + Intergenic
980046727 4:127997460-127997482 CAGTACAAGGAGTTCTTTGAGGG + Intronic
980478908 4:133359060-133359082 CTGAAAAGGGAGATCTGGTATGG + Intergenic
981085111 4:140675695-140675717 CAGATTCAGAAGATCTGGGATGG + Intronic
981141421 4:141273993-141274015 GAAAACAAGGAGCTCTGGGTTGG - Intergenic
981752078 4:148102443-148102465 CAGGGCCAGGAGATCTGGGAGGG - Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
984322227 4:178209561-178209583 TAAGTCAAGGAGATCTGGGAAGG - Intergenic
984931016 4:184847089-184847111 CTGAACAGGCAGATCTGGGTGGG - Intergenic
987071965 5:14346191-14346213 CAGAACCAGAAGATCAAGGAAGG + Intronic
987146359 5:14994671-14994693 GAGAAAAATGAGATCTGGAAAGG + Intergenic
988472874 5:31557158-31557180 CAGAAACAGGAGTTCTGTGATGG + Intergenic
989625173 5:43422680-43422702 CAGAAAAAGGAGAGCAGTGAGGG + Intergenic
991656979 5:68913835-68913857 CTGAATAAGGAGTCCTGGGAAGG - Intergenic
995379225 5:111513038-111513060 CAGAACTGAGAGAGCTGGGAAGG + Intergenic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
998140667 5:139697766-139697788 CAGCACAGGGAGCTCTGGGTGGG - Intergenic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
999940862 5:156541370-156541392 AGGAACAAAGAGATCAGGGAGGG + Intronic
1000412936 5:160952804-160952826 CAGAATGAGGAGATTTGGGTGGG + Intergenic
1001354271 5:171004660-171004682 TAAGCCAAGGAGATCTGGGAAGG + Intronic
1005438283 6:25837921-25837943 GAGAAAAAGGAGATTTGAGAAGG + Intronic
1005566781 6:27103968-27103990 CAGAACAAGCAAATCTTGAAGGG - Intergenic
1007715853 6:43855712-43855734 CCTAACAGGGAGCTCTGGGAAGG + Intergenic
1007950272 6:45866023-45866045 CAGAAAAAGGAGAGAAGGGAAGG - Intergenic
1008759613 6:54837916-54837938 TAGGACAAGGAGAGGTGGGAGGG + Intergenic
1008878556 6:56356151-56356173 CAGAATAATGAGTTCTGTGAAGG + Intronic
1009752060 6:67887056-67887078 CAAGCCGAGGAGATCTGGGAAGG + Intergenic
1011029905 6:82910596-82910618 CAGAACCAGGAGAGCAGTGAGGG - Intronic
1011328163 6:86173573-86173595 CAGAACAAGGTGAGCAGGGTAGG - Intergenic
1011791449 6:90903348-90903370 CAGAAGAATGAGATGTGAGAAGG + Intergenic
1012718521 6:102709432-102709454 CAAAACCAGGAGATCTGAGATGG - Intergenic
1012769036 6:103405274-103405296 CAGCAGAAGGAGAGCTGGAAAGG + Intergenic
1013088255 6:106875168-106875190 GAGGAAAAGGAGATTTGGGAGGG - Intergenic
1013189630 6:107791156-107791178 CAGAGCAAGAAGAACAGGGATGG + Intronic
1014424188 6:121283879-121283901 AAGAACAAGCAGATCTATGAGGG + Exonic
1014563117 6:122914623-122914645 GAGAAAGAGGAGATTTGGGAGGG + Intergenic
1014585635 6:123194572-123194594 AAAAACAAGGAGATGTGGAAAGG - Intergenic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015157563 6:130113401-130113423 GAGAACAAGGCTATGTGGGATGG - Intronic
1018476234 6:164144882-164144904 CAGAAGGAGGAGATGTCGGATGG - Intergenic
1019103620 6:169650977-169650999 GAGAACAAGCAGAGCAGGGAAGG + Intronic
1019652638 7:2168749-2168771 AACACCAAGGAGCTCTGGGAGGG + Intronic
1020613390 7:10428560-10428582 CAGACCAAGGACACCAGGGAGGG - Intergenic
1020726580 7:11822209-11822231 TAGACAAAGGAGATTTGGGAAGG - Intronic
1020853338 7:13385257-13385279 CAGAGCAAGGAAATGAGGGAAGG + Intergenic
1020905024 7:14053569-14053591 CTGACCAGGGAGAACTGGGATGG - Intergenic
1021513330 7:21457223-21457245 AAGAAAAAGGAAATCTGGCAGGG - Intronic
1022140204 7:27487055-27487077 CAGAGCAGGTAGATGTGGGAGGG - Intergenic
1022648779 7:32256070-32256092 CAGGGCAAGGAGATCAGGGAAGG + Intronic
1024338041 7:48229279-48229301 AAGAACAAGGAGCTTTGGGGAGG - Intronic
1025227483 7:57177892-57177914 CAGACAAAGGAGATATGGGGAGG + Intergenic
1026223343 7:68419336-68419358 TAGAACAGGGAGATAGGGGAGGG - Intergenic
1026576251 7:71573979-71574001 AAGAAGAAGGAGATCACGGATGG - Intronic
1026938016 7:74270184-74270206 CAGGTCAAGGTGATTTGGGAGGG + Intergenic
1029317199 7:99725706-99725728 TAAGCCAAGGAGATCTGGGAAGG - Intronic
1029514158 7:101015670-101015692 CAGAAGACGGCCATCTGGGAAGG + Exonic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030312313 7:108081168-108081190 CAGCTAAAGGAGATCTGGGAGGG - Intronic
1032468464 7:132161535-132161557 CTGATCTAGGAGGTCTGGGATGG + Intronic
1033330277 7:140411739-140411761 CAGACCCAGTAGATCTGGGGTGG - Intronic
1033496473 7:141902082-141902104 CAAAAAAAGGAGGTGTGGGAGGG - Intergenic
1033761182 7:144438508-144438530 GGGAGCAAGGAAATCTGGGAAGG - Intergenic
1035031700 7:155865235-155865257 CAGCAGAAGGAGATCTGGCAAGG - Intergenic
1035781681 8:2233006-2233028 CAGAAGAAGAGGGTCTGGGAGGG + Intergenic
1035810414 8:2486358-2486380 CAGAAGAAGAGGGTCTGGGAGGG - Intergenic
1036675205 8:10825946-10825968 CAGATCTAGGAGATCTGAGATGG - Intronic
1036821961 8:11948045-11948067 CTTGACAAGGAGATTTGGGATGG + Intergenic
1037915555 8:22770708-22770730 CTGATCAAGGAGAGGTGGGATGG - Intronic
1038737008 8:30179263-30179285 CAGAGCAAAGAGTTCTGGCAAGG + Intronic
1038902446 8:31858682-31858704 CTGAACAATTACATCTGGGAAGG + Intronic
1040276843 8:46018188-46018210 CAGCACATGGGGTTCTGGGAAGG + Intergenic
1040648060 8:49421937-49421959 CTAAGCAAGAAGATCTGGGAAGG - Intergenic
1040974060 8:53170356-53170378 CTAACCAAGGAGTTCTGGGATGG - Intergenic
1041444808 8:57939306-57939328 CAAAACAAGTGGATGTGGGACGG - Intergenic
1041603969 8:59758181-59758203 TAGGACAAGGAGCTGTGGGACGG + Intergenic
1042746587 8:72114446-72114468 CAGAAGAAGAAAATCTGGCAAGG - Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043658799 8:82708420-82708442 CACTACAAGGAAATATGGGAAGG - Intergenic
1044660055 8:94586479-94586501 GAGAGCAAGGACTTCTGGGAAGG + Intergenic
1045176580 8:99731602-99731624 CAGAATAAGAAGACCTGGTAAGG + Intronic
1045482502 8:102603343-102603365 CTGAACCAGGAGCTCTGGAAGGG - Intergenic
1046784839 8:118254753-118254775 CAGGCCAAGGAGATCAAGGAGGG - Intronic
1047410106 8:124617463-124617485 GAGAACCATGAGAGCTGGGAAGG + Intronic
1049477362 8:142802967-142802989 GAGGGCAGGGAGATCTGGGAAGG + Intergenic
1049868778 8:144957531-144957553 TAAGCCAAGGAGATCTGGGAAGG + Intergenic
1050118251 9:2282440-2282462 CAGAAAAAGGATATCTAGGCAGG + Intergenic
1050526816 9:6553580-6553602 AAGAACAAGGCTTTCTGGGAGGG - Intronic
1051127463 9:13820869-13820891 CAGGCCAATGAGATCTCGGATGG + Intergenic
1051386529 9:16515174-16515196 CAGAGCATGGAGATCCGAGAGGG + Intronic
1051509458 9:17861306-17861328 CAGAAAAGAGAGATCTGGGCAGG + Intergenic
1052218932 9:25997120-25997142 CAAACAGAGGAGATCTGGGAAGG - Intergenic
1052384363 9:27806896-27806918 GAGAACAAGGAGATTTGAGTAGG + Intergenic
1054718687 9:68582349-68582371 CAGAACAAGGTGACCTGGCAGGG + Intergenic
1055038323 9:71841820-71841842 AAGAAAATGCAGATCTGGGACGG - Intergenic
1055075534 9:72211625-72211647 CAGAACTACGACATCTGGGAAGG + Intronic
1057068150 9:92074052-92074074 CAAGCCGAGGAGATCTGGGAAGG - Intronic
1057852142 9:98574028-98574050 GAAAAGAAGGAGATCAGGGAAGG + Intronic
1058718571 9:107743096-107743118 CAAAATATGGAGCTCTGGGAGGG + Intergenic
1060802010 9:126550883-126550905 CAGAAACAGGAGCTCTGAGAGGG + Intergenic
1061043504 9:128152599-128152621 CAGAACAAGGGGGCCTGGGAGGG - Intronic
1061164745 9:128915874-128915896 GAGACCCAGGAGATCAGGGAAGG + Intronic
1061303193 9:129718144-129718166 CAGAACTAGCAGCTCTGGTAAGG - Intronic
1061763723 9:132868524-132868546 GAGAACAAGGATCTCGGGGAGGG - Intronic
1061920510 9:133779955-133779977 CAGAACACAGAGATGAGGGAAGG + Intronic
1062158285 9:135066218-135066240 GAGAACATGGAGATCTTGGAGGG - Intergenic
1185668767 X:1788784-1788806 CTGAACTAGGAGGTCTGGGGAGG - Intergenic
1186497638 X:10024586-10024608 CAGAGCAAGGACATCTCGAAAGG + Intronic
1187562197 X:20413343-20413365 CAGATCCAGGAGGTCTGGGGTGG - Intergenic
1188891134 X:35611891-35611913 TAAGCCAAGGAGATCTGGGAAGG - Intergenic
1189031770 X:37459039-37459061 TAAGCCAAGGAGATCTGGGAAGG + Intronic
1190598433 X:52067812-52067834 CGGAAGAAGAAGATTTGGGAAGG - Intronic
1190610391 X:52186261-52186283 CGGAAGAAGAAGATTTGGGAAGG + Intronic
1191802607 X:65098439-65098461 AAGAACAGGGGGATCTGGCAAGG + Intergenic
1192118755 X:68435050-68435072 CAGGACATGGACATCTGTGAAGG + Intergenic
1192775370 X:74239224-74239246 CAGAGTTAGGAGATCTTGGATGG - Intergenic
1193052762 X:77118540-77118562 GAGAACAGGGAGATCTGAGAGGG - Intergenic
1195253982 X:103075962-103075984 CTGAACCAGGAGATCTGGCTGGG - Exonic
1195724278 X:107898091-107898113 CAGTACATGAAGAACTGGGAGGG - Intronic
1196020134 X:110982749-110982771 AAGCACAAGGAGCTCTAGGAAGG + Intronic
1197164451 X:123361234-123361256 CAGAAGAAGAAGACCTGGAAGGG - Intronic
1201433981 Y:13936887-13936909 CAAATCAAGGAGATATGGGCAGG - Intergenic
1201511362 Y:14768155-14768177 CAGAAAAAGGAGATGAGTGATGG - Intronic