ID: 914684047

View in Genome Browser
Species Human (GRCh38)
Location 1:149962364-149962386
Sequence TAGGAGGAGGATAATGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914684047_914684060 17 Left 914684047 1:149962364-149962386 CCCAGTTCATTATCCTCCTCCTA 0: 1
1: 0
2: 2
3: 20
4: 237
Right 914684060 1:149962404-149962426 GTGGGTAATAATGCTATGAATGG 0: 1
1: 0
2: 2
3: 10
4: 108
914684047_914684053 -2 Left 914684047 1:149962364-149962386 CCCAGTTCATTATCCTCCTCCTA 0: 1
1: 0
2: 2
3: 20
4: 237
Right 914684053 1:149962385-149962407 TACCATTCCCACTCCCAAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 121
914684047_914684054 -1 Left 914684047 1:149962364-149962386 CCCAGTTCATTATCCTCCTCCTA 0: 1
1: 0
2: 2
3: 20
4: 237
Right 914684054 1:149962386-149962408 ACCATTCCCACTCCCAAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 138
914684047_914684051 -5 Left 914684047 1:149962364-149962386 CCCAGTTCATTATCCTCCTCCTA 0: 1
1: 0
2: 2
3: 20
4: 237
Right 914684051 1:149962382-149962404 TCCTACCATTCCCACTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914684047 Original CRISPR TAGGAGGAGGATAATGAACT GGG (reversed) Intronic
901757833 1:11452099-11452121 TGGGAGGAGGATGATGAATTTGG + Intergenic
906502256 1:46349870-46349892 GAGGAGGAGGAACTTGAACTAGG + Intronic
907623564 1:56007112-56007134 TAGGAGGGGTAGAATGAAATGGG - Intergenic
908175921 1:61555078-61555100 TAGGAGGAAGAGAATTAAGTTGG - Intergenic
908275921 1:62470977-62470999 ACGGAGGAGGATAAAGAAGTGGG - Intronic
908943111 1:69460659-69460681 TAGGAAGACGAAAAGGAACTGGG - Intergenic
909135398 1:71792915-71792937 CAAGAAGAGGAAAATGAACTTGG - Intronic
910464905 1:87488262-87488284 TAGGATGAGGATGATAATCTAGG + Intergenic
912606141 1:110991201-110991223 TAGAAGGAGGATAATTACCTTGG - Intergenic
914425416 1:147571502-147571524 TGGGAGGAGCTCAATGAACTGGG + Intronic
914684047 1:149962364-149962386 TAGGAGGAGGATAATGAACTGGG - Intronic
915527480 1:156484973-156484995 TTGGAAGAGGATAGTGAACTGGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916230086 1:162533010-162533032 TAGCATGAGTATATTGAACTTGG + Intergenic
920608426 1:207413112-207413134 TAGGAGAAGGAAAATAAACAAGG + Intergenic
921564969 1:216705923-216705945 TAGGATGATGATAATGTACCTGG - Intronic
921979092 1:221235707-221235729 TAGGAGAAGAATGAAGAACTGGG - Intergenic
1063057358 10:2520499-2520521 TCGGAGGAGCAGAATGTACTAGG + Intergenic
1063758056 10:9038713-9038735 TTTGAGGAGGATAAAGAGCTGGG - Intergenic
1065806280 10:29396171-29396193 TAGGAGAAAGGGAATGAACTTGG - Intergenic
1067837759 10:49652145-49652167 AAGGAGGAGCAGACTGAACTGGG + Intronic
1070201712 10:74212972-74212994 TAGGAGGAGGATATGGAAGAGGG + Intronic
1073006739 10:100330429-100330451 TAGGAGGAGGATGTGGAGCTGGG + Exonic
1074187502 10:111109326-111109348 TAGGAGGAGGCTGAGGAAGTGGG + Intergenic
1074205707 10:111281081-111281103 TAGGAGGAGGAAGATGAAGGAGG - Intergenic
1074361839 10:112830048-112830070 AGGGAGGAGGAGAATGGACTAGG - Intergenic
1074485982 10:113880509-113880531 CAGGATGAGTATGATGAACTTGG - Intronic
1077079076 11:715471-715493 TATGAGAAGGTTAATAAACTTGG - Intronic
1079313952 11:19391524-19391546 TTGGAGGAGGATGTTGAAGTGGG + Intronic
1084723148 11:70922177-70922199 TAGGAGATGGATAAGGAAATTGG + Intronic
1085703686 11:78767439-78767461 TAGGTGGAGGATAAATCACTAGG + Intronic
1087622677 11:100560264-100560286 TAGGAGGTGGAAAAAGAAGTGGG - Intergenic
1088591800 11:111409726-111409748 TAGGAAGAGGATACTGACATGGG - Intronic
1090068962 11:123527101-123527123 TGGGAGGAGGAGGATGAGCTTGG + Intronic
1091587545 12:1824794-1824816 TAGGCAGAGGCTAAGGAACTAGG + Intronic
1094205977 12:27841050-27841072 AAGGAGGGGGATAATCATCTTGG + Intergenic
1095631406 12:44381267-44381289 TAGGAGGAGAACAATGAACTTGG - Intronic
1095909106 12:47407924-47407946 GAGGAGGAGGGAAAAGAACTGGG + Intergenic
1101265455 12:103080666-103080688 CAGGAGGAGAATGATGCACTGGG - Intergenic
1101705448 12:107216633-107216655 TGGTAGCAGGATAATGAAGTAGG - Intergenic
1103113411 12:118303221-118303243 GAGGAGGAGGATAAGGAATGGGG - Intronic
1103290248 12:119839782-119839804 TAGGAGAAGAAAAATAAACTTGG + Intronic
1106670797 13:31903085-31903107 TGGGAGGAGTATAATGTGCTTGG - Intergenic
1107232467 13:38126590-38126612 TGGGAGGAATATAATGGACTTGG + Intergenic
1107523566 13:41207090-41207112 TAGAAGAAGGATAATTACCTGGG - Intergenic
1108224287 13:48271684-48271706 TGAAAGGAGAATAATGAACTTGG + Intergenic
1108916508 13:55620031-55620053 TAGGAGGAGGATTCAGAATTTGG + Intergenic
1110849195 13:80224638-80224660 TAGGAGGAGGATGAGGAAGTTGG + Intergenic
1112509185 13:99993616-99993638 TAGGAGGGGAAAAATGAAGTAGG - Intergenic
1113441801 13:110334956-110334978 GAGGAGGAAGATAAAGAGCTGGG + Intronic
1115201417 14:30858338-30858360 GAGGAGGAGGAAAATAAACTGGG - Intergenic
1119410169 14:74425705-74425727 TGGGAGGGGGCTGATGAACTGGG - Intronic
1126049803 15:44675523-44675545 GAGGAGGAAGAGAATGATCTTGG - Exonic
1126507559 15:49424209-49424231 TAGGAAGAGGTCAATGACCTAGG + Exonic
1127137742 15:55942512-55942534 AAGGAGGAGGAGAATGAAGGGGG - Intronic
1127794819 15:62428465-62428487 TAGGAGCAGGATTGTAAACTTGG + Intronic
1128272571 15:66323920-66323942 TGGCATGAGGATCATGAACTCGG + Intronic
1128899004 15:71402258-71402280 TAGGGAGAGGATAATGAAAGAGG - Intronic
1129964453 15:79721504-79721526 TAGGAGGAGGATAACAAATTAGG + Intergenic
1130068789 15:80629053-80629075 CAGGAGGAGGAGAATGAAGGGGG + Intergenic
1130156761 15:81357260-81357282 GAGGAGGTGCATAATGACCTAGG - Intronic
1132018355 15:98338968-98338990 AAGGAAGAGGAAAATGAAATGGG + Intergenic
1132322409 15:100935638-100935660 TGGGAGGAAGAGAATGCACTGGG + Intronic
1132472597 16:114118-114140 AAGGAGGAGGACAATGATCCTGG + Intronic
1134161633 16:11895109-11895131 AAGGAGAAGGGTAATGAACTAGG - Intronic
1134464001 16:14456877-14456899 TAGGAGGAGGAAAATAAAACAGG - Intronic
1134741940 16:16555431-16555453 TATGAGGAAGGTAAGGAACTAGG - Intergenic
1134925618 16:18157025-18157047 TATGAGGAAGGTAAGGAACTAGG + Intergenic
1135101446 16:19609813-19609835 TTGGAGGAGGATAATGCCTTAGG + Intronic
1136157345 16:28392020-28392042 GAGGAGGAGGACAATGAAGGCGG - Exonic
1136205741 16:28723261-28723283 GAGGAGGAGGACAATGAAGGCGG + Exonic
1136220674 16:28825879-28825901 GAGTAGGAGGAGAATGAAATAGG + Intronic
1137968380 16:52959240-52959262 GAGGAGGAGGATAAGGAAAGAGG - Intergenic
1138800643 16:60023833-60023855 TAAGAGGAGGATAATTGTCTTGG - Intergenic
1140748854 16:78005277-78005299 GTAGAGGAGGAGAATGAACTTGG + Intergenic
1140933894 16:79653129-79653151 TTGGAGCAGGACAATGAACTGGG + Intergenic
1141281920 16:82636665-82636687 TAGTAGGAGAATATTCAACTGGG + Intronic
1144913133 17:18699600-18699622 TTGGAGGAGGAGAAAGAAATAGG + Intronic
1147884461 17:43675501-43675523 CTGGAGGAAGAGAATGAACTTGG + Intergenic
1148558315 17:48591691-48591713 GAGGAGGAGGAGAATGAAAAGGG + Exonic
1148797727 17:50205115-50205137 TAGGGGGAAGATGATGAAGTAGG + Intergenic
1149169731 17:53794568-53794590 TAGGAGGAATATAATAAGCTAGG + Intergenic
1149412033 17:56418756-56418778 TAGGGGAAATATAATGAACTGGG - Intronic
1149534428 17:57421531-57421553 GAGGAGGAGGAGAATGAATGGGG - Intronic
1150225193 17:63520876-63520898 CAGGCTGAGGATAATGAACTAGG - Intronic
1151158541 17:72145037-72145059 TAGGAGGAGGAGAAAGAAGGAGG - Intergenic
1151263845 17:72938349-72938371 TAGGAGGAAGATGTGGAACTGGG - Intronic
1152417234 17:80170628-80170650 TAGGAGAAGGATGTTGACCTGGG + Intronic
1153858231 18:9172680-9172702 AAGGTGGGTGATAATGAACTTGG - Intronic
1155046441 18:22107600-22107622 AAAGAGGAGAATAATGAACATGG + Intergenic
1157558356 18:48628288-48628310 TCAGAGGAGGATAATGAGCTGGG + Intronic
1158291975 18:55953453-55953475 TGGGAGGAGGATAATCCTCTGGG + Intergenic
1158652932 18:59303830-59303852 TAGGAGGAGCAAACCGAACTGGG + Intronic
1159024546 18:63170634-63170656 TTGCAGAAGGATAATGAAATGGG - Intronic
1159583336 18:70259196-70259218 TCCGAGGAAGATAATGGACTTGG - Intergenic
1161810607 19:6468955-6468977 TAGGAAGAGAAGAGTGAACTGGG + Intronic
1162552962 19:11368072-11368094 TAGGAGTTGGAGAATGACCTGGG + Intergenic
1165466607 19:35978592-35978614 TAAGAGGAGGAGAAAGAACGGGG - Intergenic
1167376991 19:49117688-49117710 TTGGAGGAGGACACTGAACCAGG + Intronic
1167696538 19:51018770-51018792 TAAGAGGAGGAGAAAGAACGCGG + Intronic
1167975091 19:53219832-53219854 TAGGAGGGTGATAATTAATTGGG - Intergenic
1168144536 19:54413487-54413509 GAGGAGGAGGATAGTGATATTGG - Intergenic
1168435081 19:56310241-56310263 TGTGTGGAGGGTAATGAACTGGG + Intronic
926455270 2:13059755-13059777 GAGGAGGAAGTTAATAAACTAGG + Intergenic
926726614 2:16003723-16003745 CAGGAGGAGGCAAATGAATTGGG + Intergenic
926788662 2:16546957-16546979 AAGGAGGTGGAGAATGACCTGGG + Intergenic
926861773 2:17317493-17317515 AAGGAGGAGGAGAAGGAAGTGGG + Intergenic
929124359 2:38509822-38509844 CAGGAGAAGGGTAATGACCTGGG - Intergenic
929642452 2:43595612-43595634 TAGGAGGAGTGTAATTTACTGGG - Intronic
930189090 2:48440196-48440218 TAGGAGTGGGAGAATGAAGTGGG + Intergenic
930213020 2:48662878-48662900 TAGGAGGGGAACAATGAACACGG + Intronic
932202887 2:69848191-69848213 TAGGAAGAGGGCAATGGACTAGG - Intronic
935868069 2:107413516-107413538 TAGTAGAAGGAAAATGAATTAGG + Intergenic
935933452 2:108154902-108154924 CAGGAGTAGGATAAAGAACCAGG + Intergenic
936605117 2:113944370-113944392 TAGGTACAGGAAAATGAACTAGG + Intronic
937195234 2:120149034-120149056 TAGGATGAGTATAATAAACAAGG - Intronic
937951840 2:127394228-127394250 TGGGAAGAGGAGAATGAATTTGG - Intergenic
938852791 2:135278634-135278656 TGGGAGGAGGTTAAATAACTAGG + Intronic
939340805 2:140894278-140894300 GAGGAGGAGGATACTGAAACTGG - Intronic
939648260 2:144729099-144729121 CTGAAGAAGGATAATGAACTAGG - Intergenic
941555955 2:166981694-166981716 TAAGAAGAGGAGAAGGAACTGGG - Intronic
941727788 2:168882680-168882702 TTGGAGGAGGATAATTTAATGGG - Intronic
941794590 2:169585198-169585220 TAGGAGGAAGATGATGATTTCGG + Intronic
941801654 2:169666112-169666134 GAAGAGGAGGATGATGAATTTGG - Intronic
942350978 2:175052651-175052673 ACCGAGGAGGATAATGAACATGG + Intergenic
942358069 2:175141240-175141262 TAGGAGGAGGGAAAAAAACTAGG - Intronic
943472680 2:188314405-188314427 GAGGGGGAGGATAAAGATCTAGG - Intronic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944518655 2:200540550-200540572 GATGAGGAGGATAATGAAGGGGG + Intronic
944658069 2:201896890-201896912 TATAAGGATGATAATAAACTTGG - Intergenic
945115779 2:206406490-206406512 TAGGAGGGAGAAACTGAACTGGG + Intergenic
945257144 2:207812262-207812284 TGGGAGAGGGAGAATGAACTTGG + Intergenic
945728250 2:213500372-213500394 TAGGAGGAAGATAATTGATTTGG + Intronic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
1169231919 20:3895529-3895551 TAGGAGGAGGAAGATAGACTAGG + Intronic
1172546788 20:35768098-35768120 GAGGGGGAGGAGAATTAACTAGG - Intergenic
1177375068 21:20259216-20259238 TAGTGGGATGATAAAGAACTTGG + Intergenic
1178717919 21:34983771-34983793 AAGGAAGAGGAGAATGAAGTTGG + Intronic
1179620594 21:42613303-42613325 CAGGAGGAAGAGAATGAAGTTGG + Intergenic
1182906609 22:33943248-33943270 TAGGAAGAGGTTAATGAAAAAGG - Intergenic
949644632 3:6078512-6078534 TGGGAGGAGGAAAATCAAATGGG + Intergenic
949977329 3:9473002-9473024 TAAGAGGAAGATAATAAACTAGG - Intronic
951068144 3:18292042-18292064 TAGGAAGTAGATATTGAACTTGG + Intronic
951305875 3:21061395-21061417 TAGGAGAAGGAAAAAGAACATGG - Intergenic
951437139 3:22677588-22677610 TAGTAGGAAATTAATGAACTTGG - Intergenic
951947047 3:28150147-28150169 TAGGGGGAAGAAAATGATCTAGG - Intergenic
952270471 3:31826078-31826100 TAGGAGGAAGAAAATTAATTTGG - Intronic
952332493 3:32377086-32377108 TACCAGGTGGCTAATGAACTGGG + Intergenic
954055767 3:48023047-48023069 TAGGATGACGATAATGCACTAGG + Intronic
955224267 3:57048351-57048373 TGGGTGGAGGAGAATTAACTGGG + Intronic
955999635 3:64715373-64715395 AAGGAGGAGGATAAGGAAACAGG - Intergenic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956295171 3:67704491-67704513 GAGCAGGAGGACAATGAACTAGG - Intergenic
958069647 3:88593765-88593787 TGGGAGGAGGGTAAAGAACTAGG + Intergenic
959383379 3:105670305-105670327 TAGCAGGAGGCAAAGGAACTTGG + Exonic
959750085 3:109824072-109824094 TAAGAGGAGGAAAATGAAACAGG - Intergenic
961696897 3:128711614-128711636 TAGGTGAAAGAAAATGAACTTGG + Intergenic
961990794 3:131188607-131188629 TAGGAGCAGGAAAATCAATTAGG - Intronic
962593951 3:136920632-136920654 TAGGATGATGATACTGATCTTGG - Intronic
964172368 3:153785927-153785949 AAGGAGGAGCAGAATAAACTGGG + Intergenic
964744050 3:159995621-159995643 TAGGATGTGGATTAAGAACTAGG + Exonic
965949962 3:174296957-174296979 TAGGAAGAGAATAAGGAATTGGG - Intergenic
967426251 3:189330678-189330700 TAGGAAGAGGCTAAGAAACTTGG + Intergenic
967560220 3:190908722-190908744 TAAGAGGAGAATAATGGACCTGG - Intergenic
967614083 3:191544143-191544165 TAGAAGGAGGTTATTCAACTAGG + Intergenic
968158494 3:196404182-196404204 AAGCAGGAAGATAATGAATTAGG - Intronic
968864051 4:3196328-3196350 CAGGAGGATGAGGATGAACTTGG - Intronic
969084977 4:4649635-4649657 TGAGAGGAAGAGAATGAACTTGG + Intergenic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
970637711 4:18026927-18026949 TAGGTGGATAATAGTGAACTTGG - Intergenic
971472713 4:27043973-27043995 TAGGAGTAGGATCATGTTCTAGG + Intergenic
973064149 4:45766414-45766436 GAGGAGGAGGAGAAAGAAGTTGG - Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973696345 4:53494508-53494530 GAGGAGGAAGATCTTGAACTTGG - Intronic
975948987 4:79745064-79745086 TAGGAAGAGGAGAAGGAAGTGGG - Intergenic
976326342 4:83776082-83776104 TATGAGGAGGCAAATCAACTGGG + Intergenic
976348651 4:84034356-84034378 TAGGAAGAGGATAGGGTACTGGG + Intergenic
977282253 4:95055323-95055345 TAAGAGGAGGATAACAAACATGG + Intronic
977938020 4:102827778-102827800 AGGGAGGAGGATCATGAGCTGGG + Intronic
978292127 4:107153600-107153622 TAGGTCAAGGAGAATGAACTAGG + Intronic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
978350723 4:107818120-107818142 GAGGAGGAGGCTAATGAATAAGG - Intergenic
978720647 4:111904843-111904865 TAAGAGAAGGTTAATGAAATTGG + Intergenic
981103380 4:140854968-140854990 TGGGAGGAGGATCATGAAGATGG + Intergenic
986726221 5:10599469-10599491 TAGGAGGAGGAAGAGGGACTGGG - Intronic
987041004 5:14062099-14062121 TAAAAGGACGATAATGAAGTTGG - Intergenic
987759323 5:22139748-22139770 TAGGAGGAAGATAGGGAAGTTGG - Intronic
988440498 5:31227582-31227604 TAGGAAGAGGTTGAAGAACTAGG - Intronic
988467872 5:31508316-31508338 TAGGATGAGGAGAGAGAACTTGG - Intronic
989201658 5:38770099-38770121 TTTGAGGAGGGTAATGAAGTTGG + Intergenic
989661758 5:43806795-43806817 AATGATGAGCATAATGAACTGGG + Intergenic
991215590 5:64154928-64154950 TAGGAGTAGGAGAAGGATCTGGG - Intergenic
991369889 5:65907295-65907317 TCAAAGGAGGATAATGAAATAGG - Intergenic
991894040 5:71373177-71373199 TAGGAGGAAGATAGGGAAGTTGG - Intergenic
993026279 5:82650799-82650821 AAGGAGCAGGACAATGAAGTAGG - Intergenic
994689191 5:102995687-102995709 TAGGAAGAGAAAAAAGAACTAGG - Intronic
995000183 5:107118577-107118599 AATTAGGAGAATAATGAACTGGG + Intergenic
996663251 5:126028056-126028078 AAGGAGGGAGATAATGAAGTTGG + Intergenic
997807497 5:136933629-136933651 TAGGAGACGTATAATGAACATGG + Intergenic
1000623416 5:163510790-163510812 TACGAGGAGGAAAAAAAACTTGG - Intronic
1000633965 5:163622487-163622509 TAGGAAAATGATTATGAACTTGG - Intergenic
1001684544 5:173583735-173583757 TAGGAGGAGCATAAGAACCTGGG + Intergenic
1002093640 5:176818376-176818398 TAGCAGAAGGAGAATGAATTTGG - Intronic
1002655647 5:180744605-180744627 TAGGGGGAGGATGATGAGTTCGG - Intergenic
1003740090 6:8926623-8926645 TAGGAAGAGGCTAAATAACTTGG - Intergenic
1005019672 6:21405510-21405532 TAAGTGGATGGTAATGAACTGGG + Intergenic
1005423348 6:25675593-25675615 TAGGAGGACGAGAGTGACCTCGG - Intronic
1005712598 6:28516169-28516191 CAGGAGAAGGGTAAAGAACTTGG - Intronic
1007029165 6:38612396-38612418 CAAGAGAAGGATAATAAACTTGG - Intronic
1007348911 6:41254106-41254128 TAGGATGAGGATTTTGAAGTGGG + Intergenic
1008495836 6:52133278-52133300 TAGAGGCAGGATAATAAACTAGG + Intergenic
1010134052 6:72529292-72529314 AATGAGGAGAATAATCAACTTGG - Intergenic
1010635709 6:78256902-78256924 TAGGAGACATATAATGAACTTGG - Intergenic
1016324763 6:142888102-142888124 TGGGCGTAGGATAGTGAACTAGG - Intronic
1016719813 6:147282912-147282934 TAGAAGGAGGAGAATTATCTAGG + Intronic
1017783401 6:157734074-157734096 TAGGATAAGAATATTGAACTAGG + Intronic
1018439547 6:163797507-163797529 TATGAGGAAGTTAATGAAATAGG + Intergenic
1019736900 7:2654932-2654954 TAAGAAGAGGAAAATGAGCTGGG - Intronic
1021058479 7:16080403-16080425 AAGGGGGAGGATAAAGAACAGGG - Intergenic
1021150411 7:17144072-17144094 CAGGAGGATGGTAATGAACAGGG - Intergenic
1023646076 7:42317260-42317282 TTGGAGGAGGAAAATAAAGTTGG - Intergenic
1023753264 7:43391844-43391866 TTGGAGGTGGAAAAGGAACTTGG + Intronic
1025770538 7:64501237-64501259 GAGGAGGAGGAAAATGTGCTGGG - Intergenic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1027250523 7:76395988-76396010 TAAGAGGGGGATAATGGGCTGGG - Intronic
1027598947 7:80214045-80214067 GAGCAGGAGGACAATGGACTTGG - Intronic
1027630789 7:80602802-80602824 TTGGAAGAGGATAATCAAATTGG - Intronic
1027907997 7:84211289-84211311 AAAGAGGAGGATAAAGAAGTGGG + Intronic
1028637448 7:93005418-93005440 TATGAGGAGGGTAATGAAGGTGG - Intergenic
1031141728 7:117950072-117950094 AAGTAAGAGGATTATGAACTCGG + Intergenic
1032479228 7:132233245-132233267 GAGGACAAGGATAATGAATTAGG - Intronic
1033678246 7:143566201-143566223 TAGGAGAGGGACAATGAACTTGG + Intergenic
1033691051 7:143737601-143737623 TAGGAGAGGGACAATGAACTTGG - Intergenic
1033693595 7:143763245-143763267 TAGGAGAGGGACAATGAACTTGG - Intergenic
1034579388 7:152029309-152029331 TGGTAGTAGGATAATGAAGTAGG + Intronic
1034839933 7:154386382-154386404 TTGCAGGAGGAGACTGAACTTGG + Intronic
1035311950 7:157975095-157975117 CAGGAGGAGGAGAATGTGCTGGG - Intronic
1036504486 8:9342869-9342891 CAAAAGGAGGATAATGAAGTAGG + Intergenic
1037307591 8:17522023-17522045 TAAGAGGAGGAAAATGACCCAGG + Intronic
1037555740 8:20020483-20020505 TAGGAGGTGGGTAATGAATAGGG - Intergenic
1038283159 8:26183646-26183668 GAGGAGGAGGAAAGTGAAATAGG + Intergenic
1038688921 8:29743311-29743333 TAGGTGGAGGATAAAGGACAAGG - Intergenic
1039128546 8:34232968-34232990 TAAAAGGAGGACAATAAACTTGG + Intergenic
1042783246 8:72516245-72516267 TGGGAGGAGGAAATTGAACAGGG + Intergenic
1043593153 8:81852942-81852964 TAGGAGGAGGATAAAGATCTAGG + Intergenic
1044447472 8:92296070-92296092 AAGGTGGATAATAATGAACTTGG - Intergenic
1047160683 8:122375366-122375388 GGGTAGGAGGATAATGAAATAGG + Intergenic
1047843873 8:128785009-128785031 CAGGAGGAAGAGAATGAAGTGGG + Intergenic
1052233679 9:26185574-26185596 TAATAGGAGGATAACGACCTGGG - Intergenic
1052785622 9:32825550-32825572 TAGGATAAAGATAATGACCTGGG + Intergenic
1056084297 9:83129721-83129743 GAGGAGGAAGGTATTGAACTGGG - Intergenic
1059509151 9:114827891-114827913 TAGGAGGAGGATAAGGGAAGTGG - Intergenic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1185944515 X:4359904-4359926 TGGGAGGAGGAGAAAGGACTAGG + Intergenic
1192316484 X:70055713-70055735 TAGGAGGAGGGTCAGGAACAAGG + Intergenic
1192986615 X:76406706-76406728 TTGGAGGAGGATAATAAATTGGG - Intergenic
1193732749 X:85120978-85121000 TAGTAGAAGAACAATGAACTGGG + Intergenic
1194244570 X:91494803-91494825 CAGGAGGAAGAGAATGAAATGGG + Intergenic
1196016371 X:110944521-110944543 TGGGAGGAGGAGCAGGAACTGGG - Intronic
1198565350 X:137898705-137898727 TAGGAGGCAAATAATAAACTTGG - Intergenic