ID: 914684228

View in Genome Browser
Species Human (GRCh38)
Location 1:149964283-149964305
Sequence TTGTATGCACTGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914684228_914684232 8 Left 914684228 1:149964283-149964305 CCCTTCTCCATCAGTGCATACAA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 914684232 1:149964314-149964336 GCAGCATCAAGTCCCGATCATGG 0: 1
1: 0
2: 0
3: 5
4: 69
914684228_914684235 27 Left 914684228 1:149964283-149964305 CCCTTCTCCATCAGTGCATACAA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 914684235 1:149964333-149964355 ATGGAAACCCCACATTCCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914684228 Original CRISPR TTGTATGCACTGATGGAGAA GGG (reversed) Exonic
903028139 1:20443964-20443986 GTGCATGCACTGGTGGATAAGGG - Intergenic
903582144 1:24379190-24379212 TTGTATTCACTGACGCAGAATGG - Intronic
904321841 1:29702933-29702955 ATGTTTGATCTGATGGAGAAAGG + Intergenic
905555773 1:38882882-38882904 TTCTATGAACTAATAGAGAAAGG + Intergenic
905736491 1:40331062-40331084 ATGTATGAAATGATGAAGAAAGG - Intergenic
906932920 1:50187136-50187158 TTGTATGCACTCAGAGAAAAGGG + Intronic
907750729 1:57260774-57260796 TTGCATGCAGTGATGGGGGAAGG - Intronic
908028953 1:59979774-59979796 TTGTAGGAACAGATGGAAAATGG + Intergenic
908412683 1:63882983-63883005 TTGTATGGAGTGATGAAAAATGG + Intronic
909073614 1:71026531-71026553 TTGTATGCAATGCAGGAAAATGG + Intronic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
912387662 1:109280286-109280308 TTGTATGGAAAGATGGAGAGAGG - Intronic
913438348 1:118870845-118870867 TAGAATGCCCTGATGGAGAGTGG - Intergenic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
916912570 1:169366938-169366960 TTTTAAGCACTTATGGATAACGG - Intronic
918235653 1:182577953-182577975 TTGTATACACTGAGAGAGAGAGG - Intronic
919818565 1:201457971-201457993 TTGGTGGCAGTGATGGAGAAGGG - Intergenic
921540678 1:216410955-216410977 TTGGCTGCAGTGAGGGAGAATGG - Intronic
922993988 1:229941485-229941507 TGGTAGGGACTGATGGAGAGGGG + Intergenic
1063328142 10:5126169-5126191 ATGTCTGCATTGATGGACAAGGG - Intronic
1063477195 10:6339685-6339707 CAGTGTCCACTGATGGAGAATGG + Intergenic
1064247046 10:13676822-13676844 TTGCATTGATTGATGGAGAATGG - Intronic
1064754353 10:18560961-18560983 TGAAATGCAGTGATGGAGAATGG + Intronic
1064755264 10:18567392-18567414 TGAAATGCAATGATGGAGAATGG - Intronic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1067861507 10:49853880-49853902 TTGTAAGCACCCATGGATAAAGG - Intronic
1069865495 10:71500390-71500412 GTGTCTGCACTGATGGGGACAGG - Intronic
1073913035 10:108368899-108368921 GTGTATGCACTGAAGGGCAATGG - Intergenic
1074254186 10:111783910-111783932 TTGTAGGCAGTCATTGAGAAGGG + Intergenic
1075202914 10:120421153-120421175 TTGAATACACTAATGAAGAAAGG - Intergenic
1075632636 10:124010491-124010513 TTGGAAGCACTGAGGGAGGAAGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1080697924 11:34619316-34619338 TTGTGTGTAGTGATGGTGAAGGG - Intergenic
1080749049 11:35135950-35135972 TTTACTGCACTAATGGAGAAGGG + Intergenic
1085911844 11:80836034-80836056 TTGTTTTCTCTGATGGACAAAGG - Intergenic
1088032462 11:105267729-105267751 TTCTATGCACTTGTGGATAAAGG + Intergenic
1088354511 11:108928292-108928314 TTCTATGTATTGATAGAGAAAGG - Intronic
1090284936 11:125491662-125491684 TTGTAGGTAGAGATGGAGAATGG - Intronic
1090948585 11:131452755-131452777 TTGTCTGCACTGCAGGAGAAGGG - Intronic
1092593343 12:9972864-9972886 TTTTATACACTGAAAGAGAATGG + Intronic
1093401389 12:18751251-18751273 TTGTATGCACTGAAGCCAAAAGG + Intergenic
1096699486 12:53372708-53372730 TTGAAGGCCCTGAAGGAGAAAGG - Intergenic
1097500102 12:60391426-60391448 CTGTATGGACTGTTGGACAAGGG - Intergenic
1097676314 12:62605887-62605909 TAGTATGTACTTATTGAGAAGGG - Intergenic
1098051236 12:66455516-66455538 CTGTATGCACTCATGGAGGTAGG + Exonic
1098360842 12:69653219-69653241 TTTTATGCATTCATAGAGAAGGG - Intronic
1099977494 12:89561222-89561244 ATGTATCCACTCCTGGAGAAAGG - Intergenic
1100547802 12:95619968-95619990 TTCTATGCACTGGTGGGGAAGGG + Intergenic
1101647279 12:106643103-106643125 CTGTATTCAGTGATGGACAATGG - Intronic
1102821772 12:115914759-115914781 TGGGATGCACTTATGGGGAAGGG + Intergenic
1103442219 12:120971665-120971687 TTGTCTGGACTGAAGGACAAGGG + Intergenic
1106223198 13:27764839-27764861 TTATATGCACAGATATAGAAAGG + Intergenic
1106471658 13:30061353-30061375 TTTTATGGAGTGATGGAGAGGGG + Intergenic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1110133021 13:72029981-72030003 ATGTATGAACTGCTGGACAAAGG + Intergenic
1111705655 13:91745878-91745900 TTGTATAGTCGGATGGAGAATGG - Intronic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116333855 14:43631471-43631493 TTGTATGGACTCTAGGAGAAAGG + Intergenic
1117755495 14:58970470-58970492 TTGAAAGCCCTGCTGGAGAAGGG - Intergenic
1118494163 14:66291677-66291699 GTGTATGCACTTAGGGAGCATGG - Intergenic
1121429314 14:93875689-93875711 TTGTGGGTAGTGATGGAGAAAGG + Intergenic
1121526596 14:94623688-94623710 TTGTCTCCACTAATGCAGAAAGG - Exonic
1122014105 14:98778956-98778978 TTGTATGCACTCTGGTAGAAAGG - Intergenic
1122051606 14:99064784-99064806 TTGGATGCAAAGATGAAGAAAGG - Intergenic
1124821502 15:33050901-33050923 CTGTATGCACTGACATAGAAAGG + Intronic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1126568830 15:50128338-50128360 TCTGATGCTCTGATGGAGAAGGG - Intronic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1128848251 15:70921566-70921588 TTGTATGCACTGACCCAGCATGG + Intronic
1128870251 15:71149677-71149699 TTGTATTAACTGAGGAAGAAAGG + Intronic
1133798634 16:9066913-9066935 TTTTATGCGGTGATGGAGAGGGG - Intergenic
1134010759 16:10850838-10850860 TTGCATGCACTGACATAGAAAGG + Intergenic
1134261805 16:12656929-12656951 TTGTAGGCACTGAAGGAGAGCGG - Intergenic
1134309910 16:13066547-13066569 TTGAATGAACTGATTGATAATGG + Intronic
1135112012 16:19697711-19697733 TTGTATGCAGGGATTAAGAATGG - Intronic
1136191953 16:28622156-28622178 TTTTATGGGGTGATGGAGAAAGG - Intronic
1138739470 16:59291088-59291110 TTTTTTCCACTGCTGGAGAAAGG - Intergenic
1139192532 16:64881224-64881246 TTGTTTGCACAGCTGGAAAAGGG + Intergenic
1139194326 16:64900925-64900947 TTCTCTGCAGTGAGGGAGAAGGG + Intergenic
1140164185 16:72531821-72531843 TTGGACGCACAGATAGAGAACGG - Intergenic
1140409517 16:74733570-74733592 TCGTGAGCACTGAAGGAGAAAGG + Intronic
1141798863 16:86293761-86293783 TTGTATGCAATGAAGAGGAATGG - Intergenic
1144587788 17:16498476-16498498 GTGTCGGCACTGATGGACAACGG - Intergenic
1146678098 17:34787218-34787240 TTGTCTCCACTGATGAGGAAAGG + Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1152534537 17:80942875-80942897 TTCTAAGCACTGAAGGACAAAGG - Intronic
1155053563 18:22167532-22167554 TTGTAAGCACTGACGGAAATGGG - Intergenic
1155070203 18:22308239-22308261 GTTGATGCACTGATTGAGAAGGG + Intergenic
1158035077 18:53018574-53018596 TTGCATGCTTTGATAGAGAAAGG - Intronic
1159696800 18:71569013-71569035 TTGGGTGAACTGATGGTGAATGG + Intergenic
1160482906 18:79259536-79259558 TTGAAAGCACTGAAGGTGAAGGG + Intronic
1161189876 19:2947972-2947994 TAGTATGCAGTGGTGGAGAGAGG + Intergenic
1162363573 19:10233983-10234005 TTGTGTGTACTGATGGGAAATGG + Intergenic
1164500886 19:28819400-28819422 TTGTGTGCATTGATGGAGAGTGG + Intergenic
1165562393 19:36691101-36691123 TTGCATGGATTTATGGAGAAGGG + Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
926156067 2:10454631-10454653 TTGGATGGACTGATGGAGGCTGG - Intergenic
928873772 2:36012837-36012859 TTTTATGCTTGGATGGAGAAGGG - Intergenic
931676083 2:64697726-64697748 TTGTATGCCCTGATGTGAAAAGG - Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
938938827 2:136150953-136150975 TGGTATGCAATGTGGGAGAAAGG - Intergenic
945440717 2:209875767-209875789 GTGTTTTGACTGATGGAGAATGG - Intronic
945811847 2:214558463-214558485 GTGTATGGAATGCTGGAGAAGGG - Intronic
947579023 2:231300363-231300385 TTGTAGGAACTAATGGGGAAGGG + Intronic
948094865 2:235325412-235325434 TTGTCTCCACTTATGGAAAAGGG + Intergenic
1169774817 20:9240884-9240906 TTGTCTGCTCTGATGGATCATGG + Intronic
1171368472 20:24644378-24644400 TTATATGCCTTAATGGAGAAGGG - Intronic
1173459130 20:43228592-43228614 TTATATGTACTGGGGGAGAAGGG - Intergenic
1174045195 20:47728237-47728259 TTGTGTGCACTCAAGGAGAGAGG + Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1177998598 21:28132888-28132910 ATTTATGGTCTGATGGAGAAGGG + Intergenic
1178556222 21:33592693-33592715 TTGTATGAACTGAATGAGGAGGG + Intronic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
949540478 3:5027976-5027998 TGGGATGCAGTGATGGAGAAAGG - Intergenic
949543752 3:5054553-5054575 TTGAATGAACTGATGAAGAAGGG - Intergenic
949940457 3:9150466-9150488 TTCCATGCACAGATGGAGAAAGG + Intronic
950865753 3:16187904-16187926 TTGTTTTCACTGAGGGAGAATGG - Intronic
953193308 3:40709804-40709826 TTCTATGCATTGATGCTGAAAGG + Intergenic
956585048 3:70855228-70855250 CTGTCTGCACTCAAGGAGAAGGG - Intergenic
958497726 3:94865632-94865654 TTATATGTACTCATTGAGAAAGG - Intergenic
958754354 3:98233168-98233190 TAGTATTCACTGAAGGAAAAAGG - Intergenic
959979695 3:112502283-112502305 TTGCATCCAATGATGGAGCAAGG + Intergenic
960246737 3:115408015-115408037 CTATATGCATTGGTGGAGAAAGG + Intergenic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961618263 3:128201150-128201172 TAATATGCACTGAAGGAAAATGG - Intronic
962502366 3:136008571-136008593 ATATATGTACTGATGTAGAAGGG + Intronic
962940906 3:140124102-140124124 CAGTATGAACTGCTGGAGAAAGG + Intronic
963127784 3:141831224-141831246 TTGTGTGTAGAGATGGAGAAAGG + Intergenic
963398411 3:144763811-144763833 TTGTATGCCCAGATGGAATATGG - Intergenic
967483931 3:190008289-190008311 TTATATGCACTGATTAAAAATGG - Intronic
968052663 3:195666108-195666130 TTGGATCTCCTGATGGAGAATGG + Intergenic
968103148 3:195982246-195982268 TTGGATCTCCTGATGGAGAATGG - Intergenic
970368165 4:15381876-15381898 TGGCATGCACTGATAGAGAAAGG - Intronic
970412736 4:15825285-15825307 CTGTTTCCACTCATGGAGAAGGG + Intronic
971214593 4:24651401-24651423 TTGTATGCATTGGTGGAGGTGGG + Intergenic
972373624 4:38449716-38449738 TGGTATGCACTGGTGGAGGGAGG - Intergenic
972391519 4:38618076-38618098 TTGTATTCAATGATGGTGATAGG - Intergenic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
976187182 4:82453522-82453544 TAGTTTGCACTCATGGAGACAGG - Intronic
976411680 4:84720578-84720600 TTGTGTGAACTGATAGAGTAAGG - Intronic
977219215 4:94319508-94319530 TTGTATTCATTGATAGATAAAGG + Intronic
977359831 4:95988070-95988092 GTGTATGCATTTATGGAGGATGG + Intergenic
979498606 4:121412603-121412625 GTGTATGCATGGATGGAGAGTGG - Intergenic
979584107 4:122394632-122394654 TTGTAAGAACTGATGAAGAGAGG + Intronic
981602095 4:146501383-146501405 TTATGTGCCCTGAAGGAGAAAGG - Intronic
983493437 4:168415984-168416006 TTCTATGTTATGATGGAGAAAGG - Intronic
983860390 4:172698658-172698680 TTGTGTGCTTTGATGGAGATGGG + Intronic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
984953369 4:185022443-185022465 TTCTATGAAGTGATGGAGCATGG + Intergenic
985498913 5:228227-228249 TTGGATCTCCTGATGGAGAATGG + Exonic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
987410159 5:17606835-17606857 TTGGAAGAACTGATGGAGATGGG + Intergenic
987410816 5:17613041-17613063 TTGGAAGAACTGATGGAGATGGG + Intergenic
988244639 5:28663978-28664000 TTCTATTCTCTGATTGAGAAAGG - Intergenic
989112511 5:37920170-37920192 TTGTCTCCACTGAGTGAGAATGG - Intergenic
989361960 5:40611841-40611863 TTGTATGCAATAATTTAGAATGG + Intergenic
991271283 5:64784921-64784943 TTGTAAAAACTGATGCAGAATGG - Intronic
992680230 5:79145584-79145606 TGGTATGTACTGAAGGAAAAGGG + Intronic
993629823 5:90272411-90272433 TTGGAAGTACTGTTGGAGAAGGG + Intergenic
995195955 5:109368722-109368744 CTGAATGCAGTGATGGGGAATGG - Exonic
996541257 5:124631826-124631848 TTGTGTGTACTGAGGGACAAGGG - Intergenic
997346459 5:133195939-133195961 TTGTCTGGACAGATGGAGATGGG + Intergenic
997902144 5:137776814-137776836 TTTAGTGCAGTGATGGAGAAAGG + Intergenic
998519304 5:142785282-142785304 TTGGATGCACTGAAGGAAAAGGG - Intronic
1002654926 5:180738517-180738539 TTGTGTCCACTTATGGAGAGTGG - Intergenic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1003266135 6:4566221-4566243 CTGTGTGCAGTGATGGAGAGTGG + Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1004744255 6:18494191-18494213 TTGTTTGCACTTTTGGACAAAGG + Intergenic
1005719230 6:28584628-28584650 TTGGATGCATTGATCCAGAATGG - Intronic
1007395688 6:41576341-41576363 CTGTTTGCACTGATGATGAACGG + Intronic
1008850941 6:56020781-56020803 TTGTATGCTTTGATGAAGCAGGG + Intergenic
1009039964 6:58164393-58164415 TTGTAAACACTCATGGGGAATGG - Intergenic
1009215857 6:60919242-60919264 TTGTAAACACTCATGGGGAATGG - Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1016580790 6:145627636-145627658 CTGCATGCGCTGCTGGAGAAGGG - Exonic
1017026771 6:150188072-150188094 TTTTAGTCACTGTTGGAGAAAGG + Intronic
1019327040 7:443600-443622 GTGTATGGAGGGATGGAGAATGG + Intergenic
1021105695 7:16637211-16637233 TTGAATGTGCTGAGGGAGAAAGG + Intronic
1026574445 7:71560517-71560539 TTTTATGGAATGATGGAGAGGGG + Intronic
1029861161 7:103573686-103573708 TTGTATTCACTTATTGAAAATGG - Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1031169608 7:118276208-118276230 TTGTGTGCAATACTGGAGAATGG - Intergenic
1031366091 7:120902009-120902031 TTAAATGACCTGATGGAGAATGG + Intergenic
1033524575 7:142197536-142197558 CTGTACTCACTCATGGAGAAGGG - Intronic
1037682959 8:21113378-21113400 TTGTTTCCGCTCATGGAGAAGGG + Intergenic
1039974711 8:42352655-42352677 TTGTATCTACTGATTGAGAATGG - Intronic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1041691141 8:60688543-60688565 CTGGTTGCACTGATGGACAAAGG - Intronic
1044362342 8:91302261-91302283 TTTTTTGCACTGACTGAGAAAGG + Intronic
1049149133 8:141023109-141023131 TTGTGAGCACTGCTGGAGACTGG + Intergenic
1056272801 9:84963161-84963183 ATTTATGCCCTGATGGAAAAAGG - Intronic
1056325292 9:85473289-85473311 TTATAAGTACTGATGGAGACAGG + Intergenic
1058010416 9:99970717-99970739 TAATATGCAGTGATGAAGAAGGG - Intergenic
1060493980 9:124104609-124104631 GTGGATCCACTGATGCAGAAAGG - Intergenic
1060858562 9:126935017-126935039 TGGTCTGCACTGGTGGGGAAGGG - Intronic
1060938282 9:127528429-127528451 TCAGATGCACTCATGGAGAAAGG + Intronic
1062715640 9:138008814-138008836 TTGTCAGCACTGATGGGGAGGGG + Intronic
1189241151 X:39525809-39525831 CCATATGCACTGATGGGGAAAGG - Intergenic
1189690835 X:43615324-43615346 TTGTTTTCTCTGATAGAGAAAGG + Intergenic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1194862037 X:99011413-99011435 TTGTAAGCACTGAGGAAGCAGGG - Intergenic
1196377476 X:115049762-115049784 TTTCATGCATTTATGGAGAAAGG - Intergenic
1197254808 X:124251514-124251536 TTGTATGCATATATGGACAAAGG + Intronic
1200014852 X:153152108-153152130 GCGTAAGCACTGATGGACAAAGG + Intergenic