ID: 914684571

View in Genome Browser
Species Human (GRCh38)
Location 1:149967136-149967158
Sequence AAACTTGTGCTGTCAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2321
Summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 2280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914684571_914684575 24 Left 914684571 1:149967136-149967158 CCATTCTTTGACAGCACAAGTTT 0: 1
1: 1
2: 1
3: 38
4: 2280
Right 914684575 1:149967183-149967205 ATCAGATAACACACTTAAACTGG 0: 1
1: 0
2: 2
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914684571 Original CRISPR AAACTTGTGCTGTCAAAGAA TGG (reversed) Intronic
Too many off-targets to display for this crispr