ID: 914684575

View in Genome Browser
Species Human (GRCh38)
Location 1:149967183-149967205
Sequence ATCAGATAACACACTTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914684572_914684575 -1 Left 914684572 1:149967161-149967183 CCCACTGACTCCTGACTTTGCAA 0: 1
1: 0
2: 2
3: 17
4: 194
Right 914684575 1:149967183-149967205 ATCAGATAACACACTTAAACTGG 0: 1
1: 0
2: 2
3: 15
4: 197
914684571_914684575 24 Left 914684571 1:149967136-149967158 CCATTCTTTGACAGCACAAGTTT 0: 1
1: 1
2: 1
3: 38
4: 2280
Right 914684575 1:149967183-149967205 ATCAGATAACACACTTAAACTGG 0: 1
1: 0
2: 2
3: 15
4: 197
914684573_914684575 -2 Left 914684573 1:149967162-149967184 CCACTGACTCCTGACTTTGCAAT 0: 1
1: 0
2: 2
3: 19
4: 227
Right 914684575 1:149967183-149967205 ATCAGATAACACACTTAAACTGG 0: 1
1: 0
2: 2
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914684575 Original CRISPR ATCAGATAACACACTTAAAC TGG Intronic
902132897 1:14279262-14279284 ATCAGATAAGACACTGAATTAGG + Intergenic
906716233 1:47971567-47971589 CTCAGATACCACACCTTAACAGG + Intronic
910467306 1:87514237-87514259 TTCCGATAACACTCTTAAAAGGG - Intergenic
910473288 1:87578475-87578497 AACAGAAAGGACACTTAAACTGG + Intergenic
911741447 1:101390376-101390398 ATCTGGTCACACACATAAACAGG + Intergenic
914684575 1:149967183-149967205 ATCAGATAACACACTTAAACTGG + Intronic
918503823 1:185229170-185229192 ATCACAGTACACACCTAAACCGG - Intronic
919013786 1:192001687-192001709 ATGAAATAACACACTTCCACAGG + Intergenic
919289132 1:195605897-195605919 AACAGACAACACATTTTAACTGG + Intergenic
920760017 1:208774518-208774540 ATCAAATGACACATTTAAAAGGG + Intergenic
1065206553 10:23362692-23362714 AACAGATGACACACTTAGAAAGG + Intergenic
1065912258 10:30318640-30318662 ATAAGAAAACACAAATAAACAGG + Intronic
1067398600 10:45949134-45949156 ATCAAATGACACACTTTAAAAGG + Intergenic
1067866923 10:49918229-49918251 ATCAAATGACACACTTTAAAAGG + Intronic
1069218125 10:65848311-65848333 AACAGATAAAACACATAATCAGG + Intergenic
1069921329 10:71817543-71817565 ATCAGATATCACCCCAAAACAGG + Intronic
1070495251 10:77015483-77015505 AACAGATGACAAACTTAAATGGG - Intronic
1070516204 10:77209482-77209504 TTCAGATAACAAACTCAAAAGGG + Intronic
1071556002 10:86602034-86602056 AACAGATGACACACTAAAACAGG + Intergenic
1072027428 10:91475721-91475743 AACAGACAACACACTCAAATTGG + Intronic
1073373618 10:103013256-103013278 ATCACAAAACAGACTTAAAAAGG - Intronic
1074194187 10:111166365-111166387 ATCCAATAATACACTTAAAAGGG + Intergenic
1074513886 10:114146382-114146404 AACAGATGGCACACTTAAACCGG - Intronic
1077513987 11:2990797-2990819 ATGAGTTAACACACGCAAACAGG + Intronic
1077734726 11:4777681-4777703 ATCAGATAACATCCAAAAACAGG - Intronic
1078186520 11:9056217-9056239 ATGAGATAACATACCTAAAAAGG + Intronic
1078871699 11:15351490-15351512 ATCACATTGCACACTTAAAATGG - Intergenic
1079375077 11:19885131-19885153 ATAAGATGACACATTTGAACTGG - Intronic
1079427131 11:20354317-20354339 ATCAAATAACACAGTCAGACAGG - Intergenic
1079593813 11:22215729-22215751 ATCAAACTACACACTTAAAATGG - Intronic
1080613959 11:33930067-33930089 ATCATATAATACATTTAAAATGG + Intergenic
1081550087 11:44102853-44102875 AACAGAAAACACACTTAAACAGG - Intronic
1082887272 11:58099725-58099747 CCCAGATAAAAAACTTAAACTGG - Intronic
1085497255 11:76981408-76981430 ATCAAACCATACACTTAAACTGG - Intronic
1086900555 11:92362703-92362725 AACAGATGGCACACTCAAACTGG - Intronic
1090542335 11:127722120-127722142 AAGAGATGCCACACTTAAACTGG + Intergenic
1090560983 11:127932215-127932237 ATCAGATAACACAAGCAAACAGG + Intergenic
1095391849 12:41716426-41716448 ATCACATAAGACATTTAAATAGG - Intergenic
1099359981 12:81688241-81688263 ATCAAATAACACATTTAAAGAGG - Intronic
1099366449 12:81771132-81771154 ATAAGATGACACACATACACAGG - Intergenic
1099714149 12:86269221-86269243 ATGATATAAAACACTTAAGCAGG - Intronic
1099975575 12:89542547-89542569 AACAGATGACACTCTCAAACAGG + Intergenic
1100349554 12:93766489-93766511 ATCAGATAACACAGCTCAAAGGG - Intronic
1101342008 12:103850449-103850471 CTCTGTTAACACACATAAACTGG + Intergenic
1102816311 12:115869217-115869239 AGCAGATAACAGACTCAAACTGG + Intergenic
1102903206 12:116655093-116655115 ATCAAATCAAACACTTAAAATGG + Intergenic
1104668944 12:130667333-130667355 AACAGATGGCTCACTTAAACTGG + Intronic
1108039117 13:46322845-46322867 ATCAGACAATACACTTAAAATGG + Intergenic
1109473682 13:62847854-62847876 ATCACATAACACAGTTTAAGAGG + Intergenic
1109504505 13:63282704-63282726 ATGAGAAAAGACACTTACACAGG - Intergenic
1109677084 13:65691373-65691395 ACCAAATAATACATTTAAACAGG - Intergenic
1110314786 13:74093386-74093408 ATCAGGTAACACATTTGAGCTGG - Intronic
1110717433 13:78722206-78722228 TTCATAGAACACACATAAACAGG - Intergenic
1111392189 13:87611022-87611044 AATAGATAACTCACTTACACGGG + Intergenic
1118085444 14:62410408-62410430 ATAAGATAATACAAGTAAACTGG + Intergenic
1118131782 14:62973669-62973691 AGCACATAACAAACTTAGACAGG + Intronic
1120662728 14:87269936-87269958 ATCAGATTATACACTTAAAATGG + Intergenic
1120731656 14:88009395-88009417 ATCATATTTCACTCTTAAACAGG - Intronic
1123903143 15:24896454-24896476 ATCAGATGAGCCACTTAAAATGG + Intronic
1125179262 15:36862753-36862775 TTCAGATAATACACTTAGAATGG + Intergenic
1126887335 15:53164846-53164868 AGCAGATGCCACTCTTAAACAGG - Intergenic
1127367452 15:58304924-58304946 ATCAAATTGCACACTTAAAATGG + Intronic
1127490939 15:59462536-59462558 ATTAGATTATACACTTAAAATGG - Intronic
1129426093 15:75464138-75464160 CTCTGAAAACACACTAAAACTGG + Exonic
1129595631 15:76961837-76961859 ATCATATTCCACACTGAAACTGG - Intergenic
1132095651 15:98982564-98982586 TTCAGATAACCCACTGAAGCGGG + Intronic
1137722383 16:50635033-50635055 AGCAGATTACACACTCAAATTGG + Exonic
1137734443 16:50713570-50713592 AACAGATGACACACTTAAAATGG + Intronic
1139932943 16:70544127-70544149 ATAAGATGATACACTTAAAATGG + Intronic
1140542689 16:75772875-75772897 ATCAAATAGAACATTTAAACAGG + Intergenic
1140596211 16:76417286-76417308 ATCAGATAAGGAACTTAAAATGG - Intronic
1140806474 16:78536675-78536697 ATCAGAGACCACACTTTAGCTGG - Intronic
1142703679 17:1680385-1680407 ATCAAATTACACACTTTAAATGG + Intronic
1143065619 17:4244865-4244887 AATAGATAAGAGACTTAAACTGG - Intronic
1145288157 17:21521972-21521994 ATCAAAGAACACACTTACAAAGG + Intergenic
1145950270 17:28811930-28811952 ATCAGATACCACACAAAAAAGGG + Intronic
1146712672 17:35056144-35056166 ATCAGACAGCACACTTACTCTGG + Intronic
1147795908 17:43042642-43042664 ATCAGGTAGCACTCTTAACCTGG + Intergenic
1149154723 17:53613996-53614018 ATGACATAATTCACTTAAACGGG + Intergenic
1151409858 17:73915179-73915201 GTCAAATATCACACTAAAACTGG - Intergenic
1151606584 17:75141350-75141372 ATCAGATCAGAAACTTAAAAAGG + Intronic
1153595559 18:6721570-6721592 ATCAAATAACACACTTCCCCAGG - Intergenic
1154232566 18:12570812-12570834 ATCAGATAACACACCAAATGAGG + Intronic
1155614113 18:27701602-27701624 GTCAGATAACACCCTTGAAGAGG + Intergenic
1156381513 18:36565989-36566011 ACTAGATAACTCCCTTAAACGGG + Intronic
1157077878 18:44486484-44486506 ATGATAAAAAACACTTAAACTGG + Intergenic
1157383616 18:47244670-47244692 ATCAGGTTACACAATGAAACAGG - Intronic
1158698156 18:59721072-59721094 ATCAAAGAAGACACTTAAAAAGG - Intergenic
1159344680 18:67185299-67185321 ATAAAATAACTCACTTAAAATGG + Intergenic
930624861 2:53685793-53685815 AGCAGATCACACATTTAACCTGG + Intronic
931717339 2:65039518-65039540 AGCAGATGGCACACTCAAACTGG + Intergenic
938126573 2:128677872-128677894 ATCAAATTAAACACTTAAAATGG - Intergenic
940987890 2:160066527-160066549 ATCAGATAAAAGACTAAACCTGG - Intergenic
943145448 2:184038604-184038626 ATCAGATGGAACACTCAAACTGG + Intergenic
947979093 2:234393613-234393635 ATCATAAAACAGACTGAAACAGG - Intergenic
1169062334 20:2670359-2670381 ATCAGACAACACACTAAGGCTGG - Intergenic
1170797202 20:19558620-19558642 AAGAGATGACAAACTTAAACTGG - Intronic
1174535395 20:51247479-51247501 AAAAGAAAAAACACTTAAACTGG + Intergenic
1178839336 21:36126301-36126323 TCCAGACATCACACTTAAACTGG + Intergenic
1184577706 22:45385963-45385985 GTCAATTAACACACTTAATCTGG - Intronic
949298928 3:2560530-2560552 ATGAGATAACACAAGTAAAATGG - Intronic
952007264 3:28856271-28856293 ATTAGATAACTCACTTACTCAGG + Intergenic
953202960 3:40794302-40794324 AAGAGATGAAACACTTAAACGGG + Intergenic
953284674 3:41595129-41595151 AACAGATGACACACTCAAAAGGG + Intronic
954822157 3:53339298-53339320 AACAGAAAACTCACTTAACCAGG - Intronic
955150737 3:56364358-56364380 ATTAGATTGCACACTTAAAATGG + Intronic
955194282 3:56790695-56790717 ATAAGATAGCACACTTGAAATGG + Intronic
955440202 3:58946895-58946917 ATGAGATAACACAGGTAAAATGG - Intronic
955915324 3:63902099-63902121 ATCAAATTGCACACTTAAAATGG + Intronic
956216755 3:66857454-66857476 ACCAGATAACAAGCTTTAACAGG - Intergenic
957521176 3:81320164-81320186 AACATACAACACACTTAAAGAGG - Intergenic
959108312 3:102091831-102091853 AACAGATGACACTGTTAAACAGG + Intergenic
959552870 3:107683261-107683283 ATCAAATAAAACACTAAAATCGG - Intronic
961069472 3:123908539-123908561 TTAATATAAAACACTTAAACAGG - Intronic
964960748 3:162421636-162421658 ATGAGATAATCCACTTAAAAAGG - Intergenic
965157863 3:165087719-165087741 ATCTGATAGCAAAATTAAACTGG - Intergenic
965474734 3:169141919-169141941 ATCAGAGAAAATACTTAATCTGG - Intronic
966044786 3:175534676-175534698 AACAGAAAACACAATTCAACTGG + Intronic
966377287 3:179309356-179309378 AGCAGACAATACACTGAAACAGG + Intergenic
966635696 3:182130800-182130822 ATCAAATAAAAAAGTTAAACAGG - Intergenic
968063283 3:195742819-195742841 ATCAGTTGACACATTTATACAGG + Intergenic
970017396 4:11527682-11527704 CTCAAATATTACACTTAAACTGG + Intergenic
970228652 4:13885981-13886003 ATCAGAAACCAGACTTAAACCGG + Intergenic
970335036 4:15028926-15028948 CTCAGATAATACATTTAAAGTGG + Intronic
970378705 4:15483823-15483845 ATCAGAGAACTCTCTTAAAGTGG - Intronic
971508002 4:27387262-27387284 ATAAGACAACACAATTAGACAGG - Intergenic
973256226 4:48116416-48116438 ATCAGAAGGCACACTCAAACTGG + Intronic
973283788 4:48392248-48392270 ATCAGATTACACACAGAATCAGG - Intronic
974703968 4:65487588-65487610 ATCATACAGAACACTTAAACTGG + Intronic
974732253 4:65883275-65883297 ATCATATAACACACTATACCTGG + Intergenic
976660568 4:87536117-87536139 ATCAGATAACACAGACAAAATGG - Intergenic
976785877 4:88820216-88820238 ATAAAATCACACACTTACACGGG + Intronic
976942299 4:90718183-90718205 ATTAGTTAACACATTTAAAAGGG + Intronic
977849596 4:101809702-101809724 ATCATATAAGCCACTTAATCAGG + Intronic
979392356 4:120141831-120141853 ATCAGAAATCACACTGAAATGGG - Intergenic
980236253 4:130110743-130110765 ATAAGATAAGACAATGAAACAGG + Intergenic
980634474 4:135481969-135481991 ACCATATAACAAACTTAAAATGG - Intergenic
981038378 4:140195677-140195699 AACAGATGGCACACTCAAACTGG - Intergenic
983606147 4:169587059-169587081 AACATATAACACACTAAAAAGGG - Intronic
985333116 4:188862828-188862850 ATCTGATGACACACGTCAACTGG + Intergenic
985906715 5:2843453-2843475 ATCAAATTATACACTTAAAATGG - Intergenic
987500769 5:18707121-18707143 AACAAATAGCACACTTAAAGTGG + Intergenic
987826725 5:23039549-23039571 ATCAGATAAAGCTCTTAAAAGGG - Intergenic
987994638 5:25261014-25261036 ATCAGAAAACACACTTTGAGGGG - Intergenic
989364648 5:40642215-40642237 ATAAGATAACACAGACAAACTGG - Intergenic
989503034 5:42191603-42191625 AACAGATGGCACACCTAAACAGG - Intergenic
991564899 5:67995016-67995038 AACAGATGACACATTTAAATTGG - Intergenic
991914192 5:71589640-71589662 ATCAGGAAACACAGCTAAACTGG - Intronic
992023417 5:72647696-72647718 ATCAGTTAACCCAGTTAATCAGG - Intergenic
992370367 5:76137545-76137567 ACCAGAGAACACAGCTAAACAGG + Intronic
992372651 5:76160693-76160715 ATAAGACAACCCACTTAAAATGG + Intronic
992579509 5:78157369-78157391 AACAGATGGCACACTTAAAAGGG - Intronic
993876787 5:93316708-93316730 AAGAGATGACATACTTAAACAGG - Intergenic
995112736 5:108445585-108445607 AATAGATGACACCCTTAAACTGG - Intergenic
995752485 5:115468232-115468254 ATCAGATATAACAATTAAAATGG + Intergenic
995784233 5:115811637-115811659 TACATATAACTCACTTAAACTGG + Intronic
996606991 5:125334899-125334921 AACAGATGGCACACTCAAACAGG + Intergenic
996743938 5:126829171-126829193 GTCAGAAAACCCAATTAAACTGG + Intronic
997543314 5:134682968-134682990 GTCACATAAGACACTTAAATGGG - Intronic
998808827 5:145945362-145945384 ATCAAAGTAGACACTTAAACTGG + Intronic
999232665 5:150070636-150070658 GTCAGATAACAGCCTTAAAGGGG + Intronic
1002096769 5:176835807-176835829 ATCTGTTAAGACACTTAGACAGG - Intronic
1002354825 5:178617653-178617675 TTCAGATAAGATACTTAAAGTGG + Intronic
1005162367 6:22878980-22879002 TTCAAATAACACACTCAAACAGG - Intergenic
1008344149 6:50405434-50405456 ATCAGATAATACACTCTGACAGG - Intergenic
1008352780 6:50512859-50512881 TTCAGATAACACTCTTTAGCTGG + Intergenic
1008679860 6:53860854-53860876 GTCAGATACCACACTAAAATGGG + Intronic
1010295403 6:74190406-74190428 ATCAGATAACACAAACAAATGGG - Intergenic
1010464155 6:76147201-76147223 ATCAGATAACACAATTTTTCGGG + Intergenic
1011375903 6:86686792-86686814 TTCAGATAACACACTTTATTTGG - Intergenic
1012962814 6:105640572-105640594 CTTAGATAACACACATAAACCGG + Intergenic
1014553204 6:122812754-122812776 ATCAGATAACAAAATTATAAGGG + Intergenic
1016899302 6:149085827-149085849 TTCAGATAACACATTTACATGGG - Intergenic
1020395966 7:7718122-7718144 ATCAGATAAGAAAGTAAAACTGG + Intronic
1020597966 7:10234480-10234502 GTCAGAGAAAACACTTTAACTGG + Intergenic
1021450732 7:20781727-20781749 AACAGATAACTCATTTCAACAGG + Intergenic
1022420869 7:30222363-30222385 ATCAGATCATACACTTGAAAAGG + Intergenic
1023854829 7:44176397-44176419 ATCAGATACCCAACTAAAACTGG - Intronic
1024843684 7:53617751-53617773 ATCAGATTCAATACTTAAACTGG - Intergenic
1024925007 7:54602886-54602908 AACAGATGGCACACTTAAATTGG - Intergenic
1026121333 7:67540622-67540644 TTCAGACAACACACTTAAACAGG + Intergenic
1028582401 7:92421725-92421747 AACAGATGACACACTCAAATAGG + Intergenic
1033000839 7:137502615-137502637 ATTAAATAACACAGTAAAACTGG - Intronic
1034642956 7:152619486-152619508 GTCAAATAACACACATATACAGG - Intergenic
1037984932 8:23284474-23284496 GTCAAATAACAAACATAAACTGG + Intronic
1041086806 8:54264220-54264242 ATAATACAAAACACTTAAACTGG - Intergenic
1042934516 8:74045552-74045574 AACAGAAGACACATTTAAACTGG + Intergenic
1043006379 8:74824086-74824108 ATCAGCTAACATAGTTAATCTGG - Intergenic
1046902400 8:119537370-119537392 ACCAGATATCCCACTTAAAATGG + Intergenic
1047860690 8:128963199-128963221 AACAGATAACAGCCATAAACTGG + Intergenic
1048603029 8:135939218-135939240 ATCAGATAAGAAATTTAAAATGG - Intergenic
1049127077 8:140800783-140800805 AACAGAAAAATCACTTAAACTGG + Intronic
1049171452 8:141163951-141163973 ATCAAACCACACACTTAAAATGG - Intronic
1049226653 8:141455034-141455056 AACAGATAACACACTCAAATTGG - Intergenic
1050886511 9:10773375-10773397 AACAGATGGCACACTTAAATAGG + Intergenic
1050993575 9:12184245-12184267 ATCAGAGACCACAGCTAAACAGG - Intergenic
1051084375 9:13330907-13330929 AGCAGATGACACACTCAAGCTGG - Intergenic
1054964939 9:71013612-71013634 AAGAGATAAAAGACTTAAACTGG - Intronic
1055250396 9:74296517-74296539 ATCAGATGGCACACTCAAACTGG + Intergenic
1055896128 9:81177852-81177874 AACAGATAAGACCCTGAAACAGG + Intergenic
1056292366 9:85156788-85156810 ATCAGATGACACACTCAAGCTGG + Intergenic
1056453036 9:86734989-86735011 AACACATGACACACTCAAACTGG + Intergenic
1060717209 9:125943663-125943685 AACAGATGTCACACTCAAACTGG + Intronic
1060782514 9:126423280-126423302 ATCAGAGAACACAGGTAAAGTGG - Intronic
1187653434 X:21439216-21439238 ATCAGATAATAAAATGAAACTGG + Intronic
1190033773 X:47000466-47000488 ATCAGATAACATTTTTAAAGTGG - Intronic
1193555095 X:82944348-82944370 GTGAGAAAACACACTTAAACTGG - Intergenic
1194696558 X:97059392-97059414 ATCTGATAAGACACTCAAAAAGG - Intronic
1194751299 X:97687329-97687351 ATGAGATAAGACACATAAAATGG - Intergenic
1195060877 X:101192848-101192870 ATTAGATAACATACCTAAAATGG - Intergenic
1196192116 X:112805736-112805758 AAAAGATAATACACTAAAACTGG + Intronic
1196317770 X:114249307-114249329 ATCAGAAAAAAGACTAAAACAGG + Intergenic
1198546748 X:137700638-137700660 ATCAGATAACAGAAATAAAGGGG - Intergenic
1201603534 Y:15759377-15759399 AACAAATAACACACTCAAATTGG - Intergenic
1202106120 Y:21368110-21368132 ATAAAATAACACACATAAATCGG + Intergenic